A method for artificial rejuvenation of black soldier flies

Abstract

The present invention relates to a method for artificial rejuvenation of black soldier flies, comprising: raising black soldier flies indoors for multiple generations, clarifying the number of degeneration generations and degradation indicators thereof, analyzing the evolutionary sources through gene analysis of new black soldier fly populations from different places, and determining comparative advantage traits; selecting populations with target traits, hybridizing with degraded varieties to obtain F1 generation seed worms, and artificially screening to obtain black soldier fly varieties with stable target traits after colonization of composite microbial agents and feeding target livestock and poultry feces. This method solves the problem of degeneration of black soldier flies raised for multiple generations, and compared with the original strain, the efficiency of black soldier fly larvae in processing livestock and poultry feces is significantly improved after artificial rejuvenation, the larval development period is shortened, and the quality of larvae is improved, meeting the needs of large-scale processing of livestock and poultry feces and producing insect protein using black soldier flies, and has good economic and social benefits.

Description

Technical Field

[0001] The invention belongs to the technical field of artificial breeding methods, and in particular relates to a method for artificial rejuvenation of black soldier flies. Background Art

[0002] Black soldier fly (Hermitia illucens L.), scientifically known as Hermitia illucens, is a saprophytic insect with a wide range of diets, large biomass, easy breeding, and strong resistance to adversity. As a new technology for treating organic waste, black soldier fly bioconversion can efficiently treat various organic wastes such as kitchen waste, livestock and poultry manure, and fruit and vegetable residues, and convert them into rich biological proteins and oils, effectively solving problems such as waste resource treatment and lack of feed protein resources.

[0003] During the large-scale breeding of black soldier flies, long-term indoor artificial breeding will lead to population degeneration and other problems. Studies have found that when black soldier flies are continuously bred indoors for the F9 generation, the biological indicators of larval weight, nutrient content, and bioconversion efficiency are reduced, and in the F20 generation, the amount of adult eggs is greatly reduced. This restricts the healthy and effective development of the black soldier fly industry. At present, black soldier fly breeding companies mainly solve the impact of population degeneration by increasing the amount of feed and the number of adults, but the above measures are prone to cause material waste and corruption, reduced production efficiency, and increased costs. Therefore, in order to effectively treat waste, obtain high-quality insect bodies, and improve ecological and economic benefits, it is urgently necessary to carry out black soldier fly hybrid rejuvenation technology to support industrial development. Summary of the invention

[0004] In response to the above problems, the present application provides a method for artificial rejuvenation of black soldier flies to improve the body weight of black soldier flies, shorten the larval development period, and ensure that black soldier flies maintain high biological treatment efficiency when treating livestock and poultry manure.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] S1. Continuous multi-generation indoor artificial breeding of black soldier fly populations:

[0007] The original black soldier flies were of Jiangsu origin (purchased from Jiangsu silkworm fry breeding base) and were raised for multiple generations under artificial breeding conditions. The biological traits of each offspring were measured, such as body weight, crude protein, conversion efficiency, and adult egg production, and the number of generations of trait degeneration was recorded.

[0008] The above "raising under artificial conditions" is a conventional raising method in the art, such as according to the method disclosed by Beniers et al. (Effect of protein and carbohydrate feed concentrations on the growth and composition of black soldier fly (Hermetia illucens) larvae. Journal of Insects as Food and Feed. The effects of larval diet On adult life-history traits of the blacksoldier fly, Hermetia illucens (Diptera: Stratiomyidae). European Journal of Entomology.).

[0009] S2. Determination of traits of different geographical populations:

[0010] Black soldier flies were purchased from different regions, mainly from Guangzhou (purchased from Guanghui breeding base), Shanghai (purchased from Shanghai Hushen special breeding base), Guangxi (purchased from Guangxi Xiangsheng black soldier fly breeding base), Guizhou (purchased from Guizhou graduation special breeding base), Hainan (purchased from Yuanquan Biological Enterprise Company), Xinjiang (purchased from Xinjiang special line cyan breeding base), Sichuan (purchased from Sichuan special live breeding base), and 6-day-old larvae (i.e. larvae cultured for 6 days) were preferably inoculated on artificial feed and raised to the pupal stage. The population was identified by CO1 genotype, and phylogenetic tree analysis was performed using MEGA 6 software to determine the differences in the collected black soldier flies at the genetic level.

[0011] CO1 genotype identification primer design (derived from NCB1):

[0012] CO1-F:caacaaatcataaagatattggaac

[0013] CO1-R: gtccgaagaatcaaaataaatgytg

[0014] The sequence of the C01 gene fragment of the Jiangsu-origin black soldier fly is as follows (SEQ ID NO: 1):

[0015]

[0016] The sequence of the CO1 gene fragment of Guizhou-derived black soldier fly is as follows (SEQ ID NO: 2):

[0017]

[0018]

[0019] The parameters involved in the breeding of black soldier flies include crude protein, crude fat, egg laying, etc. According to the actual production needs, the 5th-instar black soldier fly larvae (i.e., larvae that have molted 5 times) are used as the measurement objects, and the following growth traits are selected as the measurement targets of black soldier fly populations in different fields. The above growth traits include: (1) development period, (2) body weight, (3) bioconversion rate, (4) crude fat and crude oil, and (5) reproductive capacity.

[0020] Method for determining the above properties:

[0021] (1) Bioconversion efficiency:

[0022] Bioconversion rate = H1 / (W1-W2)×100%, wherein H1 is the dry weight of the harvested black soldier fly larvae, W1 is the dry weight of the initial material, and W2 is the dry weight of the residue.

[0023] (2) Reduction rate:

[0024] Reduction rate = (W1-W2 / W1) × 100%, where W1 is the dry weight of the initial material and W2 is the dry weight of the residue.

[0025] (3) Crude fat and crude protein:

[0026] The protein was determined by the Kjeldahl method (GB 5009.5-2010), and the crude fat was determined by the Soxhlet extraction method (GB / T 5009.6-2003).

[0027] (4) Reproductive capacity:

[0028] Cumulative egg laying = L1+L2+L n , where L1 is the amount of eggs laid on the first day (g), L n is the number of eggs laid on day n.

[0029] S3. Variety hybridization:

[0030] According to the population division and trait performance of black soldier flies, parents (from Guizhou) with high-quality traits (the five traits in step S2) were screened out, and the adults were collected after they emerged from the shells and cross-paired with the degenerate populations. The adults mated and laid eggs under artificial conditions, and the F1 generation of breeding insects was obtained after the eggs hatched.

[0031] The above-mentioned "high-quality traits" refer to: the growth traits of black soldier flies are measured in step S2, and larvae that meet the following conditions are screened: black soldier flies that are not in the same evolutionary source branch, have a high bioconversion rate (≥30%), and are heavy (≥190 mg) are raised under artificial conditions until they become pupae, and the emerged adults are collected separately, and the black soldier fly adults that meet the conditions are cross-paired with the degenerate population (F9) at a rate of 100 pairs per cage (25 cm*25 cm*25 cm), and the egg masses are collected and hatched into F1 generation breeding insects.

[0032] In specific implementation, according to actual needs, the step S3 can be continuously repeated using the F1 generation, and continuous directional self-pollination can be performed, so that the F1 generation has better indicator traits such as bioconversion rate and weight target.

[0033] In the above step S2, the black soldier fly population is identified by genotype and analyzed by phylogenetic tree; the artificial feed is alfalfa meal, corn meal and wheat bran in a ratio of 6:3:1.

[0034] S4. Composite microbial culture:

[0035] Lactobacillus plantarum CICC 25125, Enterococcus faecalis CVCC4316, Leuconostoc lactis CICC 25071 and Bacillus velezensis ClCC 21082 were inoculated into 4 mL sterilized test tube liquid culture medium, cultured at 30°C constant temperature shaker (200 rpm) for 12 h, and the obtained products were inoculated into the culture medium at an inoculum amount of 5 wt %, and cultured at 30°C constant temperature shaker (200 rpm) to OD 600 =3, the bacterial culture solution was mixed in equal volumes, inoculated into LB medium at an inoculum of 5wt%, and cultured in a shake flask at 30°C and 200rpm for 24h. After the fermentation was completed, the total OD of the composite microbial agent was 600 =6.

[0036] S5. Black soldier fly taming

[0037] The obtained composite microbial agent (OD 600=6) put it into 5kg pig manure at an inoculum amount of 10wt%, and ferment it in an environment at an ambient temperature of 25℃-30℃ for 24h. Separate the obtained 5-day-old S3 hybrid F1 larvae from artificial feed and inoculate them into livestock and poultry manure containing composite microorganisms, let the larvae feed freely, wait for the larvae to transform into pupae, and then pick out the pupae from the insect manure and residual target feed. After the selected pupae emerge, collect the adults and pair them for mating. After mating under natural light conditions, lay eggs. After the eggs hatch, the rejuvenated black soldier flies can be obtained after three consecutive generations, named ZJ3.

[0038] In specific implementation, according to actual needs, the ZJ generation can be used to continuously repeat step S5, and continuous artificial restoration can be performed, so that the ZJ generation has better indicator traits such as bioconversion rate and weight target.

[0039] As a further improvement of the present invention, in the above step S5, the black soldier fly population is identified by genotype and analyzed by evolutionary tree; and is domesticated by composite microorganisms and livestock and poultry manure, which is conducive to the fixation of target traits of black soldier flies.

[0040] Beneficial effects of the present invention: Compared with the traditional method, the present invention is more suitable for industrial black soldier fly breeding, does not require modification and editing of the black soldier fly genes, and has high operating efficiency. In addition, the relevant traits of black soldier flies can be changed in a timely manner according to the type of organic waste and actual production needs to meet market-oriented production.

[0041] The present invention proposes for the first time to improve the degenerate traits of black soldier flies by using a composite microbial agent and a hybridization method. By applying this method to improve the degenerate traits of black soldier flies, it is easy to fix the already obtained high-quality traits. The present invention has the advantages of strong operability, high success rate, and short cycle. It is suitable for conducting basic theoretical research on interspecific hybridization and for industrial promotion and application. Compared with other aquaculture varieties, the black soldier flies obtained by the method designed by the present invention have a significantly shortened development period, which improves the efficiency of organic waste treatment, and produces high-quality insect bodies, with high ecological and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] In order to more clearly illustrate the technical solution of the embodiment of the present invention, the following briefly introduces the drawings required for describing the embodiment, wherein:

[0043] Figure 1 This is the nutrient changes of black soldier flies raised indoors for multiple generations.

[0044] Figure 2 This shows the weight changes of black soldier fly larvae raised indoors for multiple generations.

[0045] Figure 3 This shows the changes in egg-laying patterns of black soldier flies adults raised indoors for multiple generations.

[0046] Figure 4 Phylogenetic tree analysis of different populations of black soldier flies.

[0047] Figure 5 Shown is the weight change of black soldier fly larvae after rejuvenation and hybridization.

[0048] Figure 6 This is the nutritional changes of black soldier fly larvae after rejuvenation and hybridization.

[0049] Figure 7 This is the change of egg-laying of adult black soldier flies after rejuvenation and hybridization. DETAILED DESCRIPTION

[0050] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0051] Embodiment 1:

[0052] S1. Indoor multi-generation artificial breeding of black soldier flies:

[0053] 1) Under artificial breeding conditions (28°C-30°C, RH: 70%), black soldier flies from Jiangsu were raised for multiple generations. The artificial feed was prepared with alfalfa meal, corn meal and wheat bran in a mass ratio of 6:3:1.

[0054] 2) Determine the biological traits of each offspring, such as body weight, crude protein, conversion efficiency, and egg laying of adults, and record the number of generations at which traits degenerate.

[0055] Figures 1 to 3 The degenerate traits and degenerate generations of black soldier flies reared for a long time indoors. After being reared indoors continuously to the F9 generation, the body weight and nutrient composition began to decline; the egg-laying capacity of black soldier flies adults decreased in the F20 generation.

[0056] S2. Determination of traits of different geographical populations:

[0057] The black soldier fly populations from different sources were identified based on the CO1 gene, and the phylogenetic tree analysis was performed using MEGA 6 software to determine the differences in the genetic level between the collected black soldier flies and the hybridized and rejuvenated varieties. At the same time, the 6-day-old black soldier fly larvae from different populations were inoculated into artificial feed at an inoculation density of 2000 heads / kg, and the black soldier fly prepupae were collected for nutrient determination and the black soldier fly development period was recorded. When all the larvae were transformed into pupae, they were collected and preserved as materials for the directed hybridization experiment.

[0058] like Figure 4 As shown, the laboratory original species (Jiangsu source), Hainan source, Xinjiang source and Sichuan source are on the same evolutionary line; the Guangzhou source, Shanghai source and Guangxi source are on the same evolutionary line.

[0059] Since the newly introduced black soldier fly population is not on the same evolutionary line as the original laboratory population (Jiangsu source), the Guangzhou source, Shanghai source, Guangxi source and Guizhou source were selected for subsequent growth trait determination and hybridization experiments. As shown in Table 1, four populations were initially selected for further biological trait comparison. The results showed that the weight, nutrient composition and bioconversion rate of the Guizhou source were higher than those of the other three sources. Therefore, the Guizhou source was selected as the newly introduced parent and the degenerate parent for hybridization experiments.

[0060] Table 1 Comparison of biological characteristics of different black soldier fly sources

[0061]

[0062] S3. Variety hybridization:

[0063] According to the population division and trait performance of black soldier flies, parents with high-quality traits (from Guizhou) were screened out. After they were reared until they emerged from the shell, the adults were collected and cross-paired with the degenerate population. The adults mated and laid eggs under artificial conditions, and the F1 generation of breeding insects was obtained after the eggs hatched.

[0064] The above-mentioned "high-quality traits" refer to: the growth traits of black soldier flies are measured in step S2, and larvae that meet the following conditions are screened: black soldier flies that are not in the same evolutionary source branch, have a high bioconversion rate (≥30%), and are heavy (≥190 mg) are raised under artificial conditions until they become pupae, and the emerged adults are collected separately, and the black soldier fly adults that meet the conditions are cross-paired with the degenerate population (F9) at a rate of 100 pairs per cage (25cm*25cm*25cm), and the eggs laid under natural light conditions are collected and hatched into F1 generation breeding insects.

[0065] In specific implementation, according to actual needs, the step S3 can be continuously repeated using the F1 generation, and continuous directional self-pollination can be performed, so that the F1 generation has better indicator traits such as bioconversion rate and weight target.

[0066] In the above step S2, the black soldier fly population is identified by genotype and analyzed by phylogenetic tree; the artificial feed is alfalfa meal, corn meal and wheat bran in a ratio of 6:3:1.

[0067] S4. Composite microbial culture:

[0068] Lactobacillus plantarum CICC 25125, Enterococcus faecalis CVCC4316, Leuconostoc lactis CICC 25071 and Bacillus velezensis CICC 21082 were inoculated into 4 mL sterilized test tube liquid culture medium, cultured at 30°C constant temperature shaker (200 rpm) for 12 h, and the obtained product was inoculated into the culture medium at an inoculation rate of 5-10 wt%, and cultured at 30°C constant temperature shaker (200 rpm) to OD 600 =3. The bacterial culture solution was mixed and inoculated into LB medium, and cultured in a shaking flask at 30°C and 200rpm for 24h. After the fermentation was completed, the total OD of the composite microbial agent was 600 =6.

[0069] S5. Domestication of Black Soldier Fly Rejuvenation Varieties

[0070] The obtained composite microbial agent (OD 600 =6) 10% of the inoculum is added to 5 kg of pig manure, and the mixture is placed in an environment at 25°C-30°C for fermentation for 24 hours. The 5-day-old F1 larvae obtained by hybridization of the varieties in step S3 are separated from the artificial feed and inoculated into the pig manure (chicken manure) containing the composite microorganisms at a rate of 2000 heads / kg, and the larvae are allowed to feed freely. After the larvae are transformed into pupae, the pupae are picked out from the insect manure and the residual target feed. After the pupae emerge, the adults are collected and paired for mating. After mating under natural light conditions, eggs are laid. After the eggs are hatched, the rejuvenated black soldier flies can be obtained after three consecutive generations. The rejuvenated variety is named ZJ3.

[0071] In specific implementation, according to actual needs, the ZJ generation can be used to continuously repeat step S5, and continuous artificial restoration can be performed, so that the ZJ generation has better indicator traits such as bioconversion rate and weight target.

[0072] As a further improvement of the present invention, in the above step S5, the black soldier fly population is identified by genotype and analyzed by evolutionary tree; and is domesticated using composite microorganisms and pig manure (chicken manure), which is beneficial to fix the target traits of the black soldier flies.

[0073] like Figure 5 , 6As shown in Figure 7, after artificial rejuvenation of black soldier flies, the weight of larvae was significantly higher than that of the degenerated population. The nutrient content of black soldier flies was improved by measuring crude protein and crude fat. After continuously raising the rejuvenated variety for 10 generations (ZJ3-10), the egg-laying amount was measured. The results showed that the egg-laying amount of black soldier flies adults was similar to that of the original population and significantly higher than that of the degenerated population. The experimental results show that the artificial rejuvenation technology of black soldier flies is conducive to improving the biological traits of degenerated varieties and promoting the development of large-scale breeding of black soldier flies.

[0074] Embodiment 2:

[0075] Comparison between the rejuvenated variety ZJ3 and its parents:

[0076] The experiment of comparing different strains was conducted in a constant temperature incubator (28-30℃, RH: 70%). The rejuvenated ZJ3 and parent black soldier flies were raised to 6 days old using artificial feed, and randomly inoculated on pig manure or chicken manure at a density of 2000 heads / kg, and allowed to feed freely. Every day, 100 black soldier flies were randomly selected, weighed and recorded, and black soldier fly prepupae were collected to determine the crude fat and crude protein content.

[0077] After the insect feed is separated, the weight of the residual feed is measured to calculate the bioconversion efficiency and reduction rate.

[0078] As shown in Table 2, after artificial rejuvenation, the bioconversion rate, waste reduction rate and feed-worm ratio of black soldier flies for chicken manure or pig manure were significantly higher than those of their parents, which also shows that artificial rejuvenation technology can help improve the efficiency of black soldier flies in treating waste.

[0079] Table 2 Comparison of black soldier fly treatment performance

[0080]

[0081] Note: Mean ± standard error (n = 3); Different letters in the same footnote indicate significant differences (P < 0.05).

[0082] As shown in Tables 2 and 3, after artificial rejuvenation, the crude protein and crude fat content of the black soldier fly larvae treated with pig manure or chicken manure was about 36% and 28%, and the body weight was about 185g-190g. Compared with the parental degenerate F10 generation, artificial rejuvenation improved the nutrient index of the black soldier fly larvae, which is conducive to improving economic benefits. This shows that the method of artificial rejuvenation can significantly improve the development period of black soldier flies.

[0083] Table 3 Comparison of nutrients of black soldier fly larvae

[0084]

[0085] In summary, the present invention can significantly improve the biotransformation effect of black soldier flies on livestock and poultry feces, and improve their biomass accumulation and reproductive capacity; studies have shown that the method of artificial rejuvenation of the present invention is feasible, easy to restore and improve the biological traits of black soldier flies, and improve the large-scale breeding technology of black soldier flies.

[0086] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for artificial rejuvenation of black soldier flies, characterized in that: include (1) Cross-pairing newly introduced parent black soldier fly adults with degenerated parent black soldier fly adults to obtain F1 generation breeding insects; wherein the populations of the newly introduced parent black soldier fly adults and the degenerated parent black soldier fly adults are not in the same evolutionary source branch, and the bioconversion rate of the newly introduced parent black soldier fly adults is ≥30%, and the body weight is ≥190 mg; (2) Lactobacillus plantarum ( Lactobacillus plantarum ), Enterococcus faecalis ( Enterococcus faecalis , Leuconostoc lactis ( Leuconostoc lactis ) and Bacillus Velezii were mixed and fermented to obtain a composite microbial agent; (3) adding the composite microbial agent to livestock manure for fermentation, inoculating the F1 generation larvae obtained in step (1), mating under natural light conditions, and hatching three generations in succession to obtain rejuvenated black soldier flies; In step (1), the degraded parent is from Jiangsu provenance; the newly introduced parent is from Guizhou provenance; In step (2), Lactobacillus plantarum ( Lactobacillus plantarum )CICC 25125, Enterococcus faecalis( Enterococcus faecalis )CVCC4316, Leuconostoc lactis ( Leuconostoc lactis ) CICC 25071 and Bacillus velez ( Bacillus velezensis ) CICC 21082 strains were inoculated into liquid culture medium, cultured in a constant temperature shaker at 30°C, and expanded to OD 600 =3, and then mixed in equal volumes, inoculated into liquid culture medium at an inoculum of 5-10 wt%, and cultured in a shake flask at 30°C and 200 rpm for 24 h. After the fermentation, the total OD of the composite microbial agent was 600 =6; In step (3), the amount of the composite microbial agent added to the livestock manure is 5-10wt%; The CO1 gene fragment sequence of the Jiangsu provenance is shown as SEQ ID NO: 1; the CO1 gene fragment sequence of the Guizhou provenance is shown as SEQ ID NO:

2.

2. The method for artificial rejuvenation of black soldier flies according to claim 1, characterized in that: In step (1), the cross-matching is performed, and the artificial feed used is composed of alfalfa meal, corn meal and wheat bran, and the mass ratio of alfalfa meal: corn meal: wheat bran is 6:3:

1.

3. The method for artificial rejuvenation of black soldier flies according to claim 1 or 2, characterized in that: In step (3), the inoculation amount of F1 generation larvae is 2000-3000 larvae / kg.

4. The method for artificial rejuvenation of black soldier flies according to claim 1 or 2, characterized in that: The livestock manure includes pig manure or chicken manure.

5. The method for artificial rejuvenation of black soldier flies according to claim 1 or 2, characterized in that: In step (3), the fermentation is carried out in an environment of 25°C to 30°C for 24 hours.

Images