TaPUB4 gene knockout mutant of wheat and its application in regulating tiller number and spikelet number

Abstract

The present invention discloses a wheat TaPUB4 gene knockout mutant and its application in regulating tiller number and spikelet number. The specific guide single-stranded RNA sgRNA of the wheat TaPUB4 gene knockout mutant is obtained by using gene editing technology; the pBUE411-TaPUB4 plant binary expression vector containing the sgRNA is constructed; the callus induced from wheat immature embryos is infected with Agrobacterium, and the sgRNA and the Cas9 element are co-transformed into wheat to specifically knockout the TaPUB4 gene, and the transgenic wheat with the TaPUB4 gene knockout is obtained, and the wheat TaPUB4 gene knockout mutant with reduced tiller number and spikelet number is obtained, significantly reducing the tiller number and spikelet number of wheat, laying a new foundation for optimizing and improving wheat varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing and molecular breeding, and particularly relates to a wheat TaPUB4 gene knockout mutant and its application in regulating tiller number and spikelet number. Background Art

[0002] The statements herein only provide background art related to the present invention and do not necessarily constitute prior art.

[0003] Wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the world's three major food crops and is also the main food crop in China second only to rice. Wheat is rich in nutrition and provides 20% of the protein and energy for the global population. Therefore, increasing wheat yield is of great significance for stabilizing global food security. However, with the continuous increase in the global wheat supply and the instability of yields caused by climate and environment, measures still need to be taken to increase wheat yield to meet future demands.

[0004] Protein ubiquitination is one of the most common and important post-translational modifications of proteins. Ubiquitination regulates protein stability, subcellular localization, activity, and interactions, etc., and is widely involved in a series of life activities such as plant growth and development, stress response, and signal transduction, and is of great significance in the life cycle of plants. In the ubiquitination cascade reaction process, the E3 ubiquitin ligase can specifically recognize target proteins and plays a decisive role in the ubiquitin pathway. Research shows that the E3 ubiquitin ligase can affect crop yield by regulating protein stability in plants.

[0005] E3 ubiquitin ligases regulate many important aspects of crop growth. In regulating the number of grains per panicle, the rice RING-type E3 ubiquitin ligase WIDTH OF LEAF AND GRAIN (WLG) can ubiquitinate and degrade the HECT-type E3 ligase LARGE2 that regulates panicle size, grain width, and leaf width, positively regulating the development of rice leaf width and grain width, thus affecting the number of grains per panicle and the yield per plant of rice, which is of great significance for rice genetic breeding improvement. In regulating grain size, when a quantitative trait locus (QTL) GRAIN WIDTH 2 (GW2) that affects rice seed size and weight was discovered, the importance of the ubiquitin system in controlling seed size was first recognized. GW2 controls the stability of the protein EXPLA1 that blocks cell proliferation and development, inhibits the proliferation of glume cells, and accelerates grain filling with milk, thereby reducing grain size and weight. There are also some reports on regulating tillering. The MOC1 gene of rice plays a key role in controlling the number of tillers in rice. Two APC-type E3 ligases ubiquitinate and degrade MOC1, inhibiting the expression of the meristem identity gene OSH1, thereby affecting the number of tillers in rice. Due to the extensive role of E3 ubiquitin ligases in the process of plant growth and development, their application in wheat production has also received increasing attention.

[0006] Through research, the applicant found a U-box type E3 ubiquitin ligase TaPUB4 in wheat, which has the function of regulating the number of tillers and the number of spikelets. This regulatory function provides a very important theoretical basis for studying the effect of ubiquitination on wheat growth and development and high-yield breeding. The search found that the regulatory function of TaPUB4 on the number of tillers and spikelets in wheat described in this application is reported for the first time, and there is no report on the TaPUB4 knockout mutant and its application in the number of tillers and spikelets in wheat. Summary of the Invention

[0007] Aiming at the deficiencies of the existing technology, the purpose of the present invention is to provide a wheat TaPUB4 gene knockout mutant and its application in regulating the number of tillers and spikelets.

[0008] To achieve the above purpose, the present invention is realized through the following technical solutions:

[0009] In the first aspect, the present invention provides a specific guiding single-stranded RNA sgRNA targeting the TaPUB4 gene. The coding nucleotide sequence of the TaPUB4 gene is shown in SEQ ID NO.3; the sgRNA is the TaPUB4 coding sequence or the complementary sequence of the TaPUB4 coding sequence, with a sequence length of 23 deoxyribonucleotides, and the last three deoxynucleotide sequences at its 3' end are NGG, where N is adenine or guanine or thymine or cytosine.

[0010] It was found through research that the TaPUB4 gene specifically guides single-stranded RNA to play a role in reducing the tiller number and spikelet number of wheat.

[0011] In some embodiments, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.4 or SEQ ID NO.5.

[0012] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.4.

[0013] In a second aspect, the present invention provides a pBUE411-TaPUB4 plant binary expression vector containing sgRNA. The pBUE411-TaPUB4 plant binary expression vector is composed of expression cassette E1 and expression cassette E2; wherein the nucleotide sequence of expression cassette E1 is as shown in SEQ ID NO.1, which sequentially includes from upstream to downstream: the TaU3 promoter from wheat, the sgRNA of the TaPUB4 gene, and terminator T1; the nucleotide sequence of expression cassette E2 is as shown in SEQ ID NO.2, which sequentially includes from upstream to downstream: the ubiquitin promoter Ubi from maize, the maize Cas9 coding sequence, and terminator T2.

[0014] In some embodiments, the nucleotide sequence of the TaU3 promoter of wheat is as shown in SEQ ID NO.6; the nucleotide sequence of terminator T1 is as shown in SEQ ID NO.7; the nucleotide sequence of the maize ubiquitin promoter Ubi is as shown in SEQ ID NO.8; the nucleotide sequence of the maize Cas9 coding sequence is as shown in SEQ ID NO.9; the nucleotide sequence of terminator T2 is as shown in SEQ IDNO.10.

[0015] In a third aspect, the present invention provides a wheat TaPUB4 gene knockout mutant, and its construction method is as follows:

[0016] Obtain the specific guiding single-stranded RNA sgRNA of the wheat TaPUB4 gene knockout mutant by gene editing technology;

[0017] Construct the pBUE411-TaPUB4 plant binary expression vector containing sgRNA;

[0018] Use Agrobacterium to infect the callus induced by wheat young embryos, co-transfer sgRNA and Cas9 elements into wheat, specifically knockout the TaPUB4 gene, obtain transgenic wheat with the TaPUB4 gene knocked out, and obtain a wheat TaPUB4 gene knockout mutant with reduced tiller number and spikelet number.

[0019] In a fourth aspect, the present invention provides the application of the wheat TaPUB4 gene knockout mutant in regulating tiller number and spikelet number.

[0020] The beneficial effects achieved by one or more of the above-described embodiments of the present invention are as follows:

[0021] The transgenic wheat with TaPUB4 gene knockout significantly reduces the tiller number and spikelet number of wheat, laying a new foundation for optimizing and improving wheat varieties. In summary, the present invention provides a feasible method for exploring the improvement of wheat yield using genetic engineering technology, with important breeding application value and broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings forming a part of this specification are used to provide a further understanding of the present invention. The schematic embodiments and descriptions thereof of the present invention are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0023] Figure 1 It is for the evolutionary analysis of TaPUB4.

[0024] Figure 2 It is the nucleotide sequence of the coding region of the TaPUB4 gene in wheat variety JW1.

[0025] Figure 3 It is the identification result of the T0 generation wheat transgenic lines.

[0026] Figure 4 It is the gene editing result of the Tapub4 knockout lines.

[0027] Figure 5 It is the identification result of the T1 generation wheat transgenic lines.

[0028] Figure 6 It is the phenotype statistics of the T1 generation transgenic wheat in Example 3 of the present invention. Among them, A is the phenotype pattern diagram of JW1 and three TaPUB4 knockout mutant lines, B is the plant height statistics of JW1 and TaPUB4 knockout mutants, C is the tiller statistics of JW1 and TaPUB4 knockout mutants, D is the spikelet number statistics of JW1 and TaPUB4 knockout mutants, E is the grain number per spike statistics of JW1 and TaPUB4 knockout mutants, F is the spike length statistics of JW1 and TaPUB4 knockout mutants, G and H are the grain length and grain width pattern diagrams of JW1 and TaPUB4 knockout mutants respectively, and I and J are the grain length and grain width statistics of JW1 and TaPUB4 knockout mutants respectively. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0029] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0030] The present invention will be further described below in conjunction with embodiments.

[0031] In the following embodiments, the test materials used, unless otherwise specified, are all purchased from conventional biochemical reagent companies.

[0032] The high-fidelity enzyme required for PCR amplification is KOD-□FX NEO (Toyobo); the restriction endonuclease BsaI and T4 ligase required for Gibson assembly are both purchased from NEB; the gel recovery kit and plasmid extraction kit required for recovering enzyme-digested fragments are both purchased from Thermo Fisher Scientific. The inorganic salts required for medium preparation are purchased from Sinopharm Group, and vitamins and antibiotics are purchased from Sigma. The plant CRISPR / Cas9 gene editing vector is pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9 mimics the characteristics of grass plant genes with a relatively high GC content at the 5' end and is a plant codon-optimized gene designed and synthesized. The plasmid pBUE411 can be obtained by the public from China Agricultural University, and its sequence is already known, which is 17430 bp. The E. coli strain used in the present invention is E. coli Transgen5α, purchased from Beijing TransGen Biotech Co., Ltd.; the primers used are synthesized by Qingdao Rebo Xingke Biotechnology Co., Ltd., and the relevant primer sequences are shown in Table 1:

[0033] Table 1 Relevant primer sequences

[0034]

[0035] The wheat variety JW1 used in the present invention is a new germplasm with good tissue culture ability self-selected by the Crop Research Institute of Shandong Academy of Agricultural Sciences, and can be obtained by the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences.

[0036] Construction of Expression Vector in Example 1

[0037] 1. Evolutionary analysis of TaPUB4

[0038] Using the protein sequence of rice Os08t0110500 for Blast-P sequence alignment on the Ensemble Plant website (http: / / plants.ensembl.org / index.html), the searched databases include: Arabidopsis thaliana (TAIR10), wheat (IWGSC), rice (IRGSP-1.0). After obtaining the alignment results, genes with relatively high homology are selected, and their protein sequences in FASTA format are downloaded.

[0039] Perform ClustalW alignment analysis using MEGA7 software and construct a neighbor-joining tree. The results are as Figure 1As shown, the arrow indicates the PUB4 gene in Arabidopsis thaliana, and the circle indicates the sequence in wheat that is relatively homologous to the AtPUB4 sequence. The three genes, TraesCS3A02G521300, TraesCS3B02G591000, and TraesCS3D02G527900, have the highest homology with AtPUB4. Therefore, the CRISPR / Cas9 lines of the three genes were edited simultaneously.

[0040] 2. Design of sgRNA targeting TaPUB4

[0041] Download the genomic sequences of the three genes, TraesCS3A02G521300, TraesCS3B02G591000, and TraesCS3D02G527900, and perform target sequence prediction on the CRISPRdirect website (http: / / crispr.dbcls.jp / ), selecting the IWGSC wheat genome database. From the generated result data, screen out the target sequence information that meets the conditions. The screening conditions are as follows:

[0042] a. The GC content is appropriate, generally between 45% and 70%;

[0043] b. The target sequence starting with A at the 5' end to adapt to the transcription start of the U3 promoter;

[0044] c. Select the target sequence close to the 5' end of the gene to increase the degree of gene disruption after editing, and also consider whether the position of the target sequence is located in the key domain of the gene protein;

[0045] d. Select the target sequence with 20mer off-target number of 3 to facilitate the knockout of genes in the ABD three genomes.

[0046] e. Perform BLAST analysis of the target sequence with the wheat genome database to further verify the specificity of the target sequence.

[0047] Finally, a total of 2 suitable target sequences were found in this example. One target sequence close to the U-box domain was selected for subsequent analysis. Its sequence information is shown in SEQ ID NO.4, and its nucleotide sequence is: TATGCACGAGCGCCTTCTCA GGG, with the underlined part being the sgRNA sequence targeting the TaPUB4 gene. The sequence length is 20bp, and the GGG at its 3' end is the PAM sequence ( Figure 2 ).

[0048] 3. Amplification of the fragment containing sgRNA

[0049] Two primers, TaPUB4-gR-F and TaPUB4-gR-R (Table 1), used for constructing the binary expression vector pBUE411-TaPUB4, were synthesized by Qingdao Ruibo Xingke Biotechnology Co., Ltd. Phosphorylate the two primers separately and directly anneal them to form double strands. The reaction system is as follows: 4 μL TaPUB4-gR-F (10 μM), 4 μL TaPUB4-gR-R (10 μM), 1.5 μL 10×T4 PNK buffer, 1 μL PNK, 1 μL ATP, and ddH2O is added to make up to 15 μL. Mix the components well and centrifuge briefly, then place them in a PCR instrument for reaction. The reaction program is: 37 °C for 30 min; 95 °C for 5 min; ramp to 25 °C at 5 °C / min.

[0050] 4. Ligation of sgRNA and pBUE411 vector

[0051] The ligation of pBUE411 and sgRNA was completed by Gibson assembly. The specific reaction system is: 2 μL pBUE411 plasmid (100 ng / μL), 2 μL of the product fragment in step 3, 1.5 μL 10×NEB T4 Buffer, 1.5 μL 10×BSA, 1 μL BsaI, 1 μL T4 Ligase, and ddH2O is added to make up 15 μL. After mixing, place it in a 37 °C constant temperature water bath for reaction for 5 hours to obtain the ligation product of pBUE411 vector and sgRNA.

[0052] 5. Transformation and identification

[0053] Transform the ligation product into Escherichia coli. The specific protocol is as follows: Add 15 μL of the ligation product to Escherichia coli competent cell Transgen 5α and incubate on ice for 30 min, then heat shock at 42 °C for 45 s and quickly incubate on ice for 2 min. Add liquid LB medium without antibiotics and resuscitate on a shaker at 37 °C for 40 min. Then use a spreader to spread it on a solid LB plate containing kanamycin and incubate it upside down at 37 °C for 12 h. Pick 3 monoclonal colonies for sequencing, and the sequencing primers are pBUE411-F and pBUE411-R.

[0054] The target sequence of sgRNA was detected by sequencing, and at the same time, the TaU3 promoter sequence was detected upstream of the target sequence. The sequencing results indicate that the expression cassette E1 containing sgRNA was successfully assembled into the pBUE411 binary expression vector, proving that the CRISPR / Cas9 gene editing vector of TaPUB4, namely the recombinant binary expression vector pBUE411-TaPUB4, was successfully constructed.

[0055] Obtaining and Identification of Transgenic Progeny in Example 2

[0056] 1. Obtaining of TaPUB4 transgenic offspring

[0057] The constructed recombinant binary expression vector pBUE411-TaPUB4 in Example 1 was transformed into Agrobacterium tumefaciens EHA105 competent cells. The EHA105 strain carried a nopaline-type Ti plasmid pEHA105 (pTiBo542DT-DNA) without its own transfer function. This plasmid contained the vir gene, enabling the strain to help the transferred binary vector T-DNA transfer smoothly into plants on the premise that the T-DNA transfer function of the plasmid itself was disrupted.

[0058] The specific implementation scheme is as follows:

[0059] (1) Take the EHA105 Agrobacterium tumefaciens competent cells stored at -80°C and thaw them in an ice-water bath. Under sterile conditions, add 1 μg of plasmid DNA to the competent cells, mix gently, and let it stand in the ice-water bath for 5 min. Place the centrifuge tube in liquid nitrogen for quick freezing for 5 min, quickly place the centrifuge tube in a 37°C water bath and keep it for 5 min without shaking the water surface, and then place the centrifuge tube in the ice-water bath and let it stand for 5 min. Under sterile conditions, add 800 μL of antibiotic-free YEB medium, and culture it with shaking at 28°C for 2 - 3 h to resuscitate the bacteria. Centrifuge at 5000 rpm for 3 min, discard the supernatant, collect the bacteria, add 100 μL of sterile water, gently pipette to resuspend the bacteria, and spread them on a YEB plate with the corresponding antibiotics, rifampicin, and streptomycin, and incubate it upside down in a 28°C incubator for 2 - 3 days.

[0060] Preparation of wheat genetic transformation medium: See the literature Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science + Businedd Media New York 2015.

[0061] (2) Take JW1 wheat seeds 10 - 15 days after flowering and dissect immature embryos under sterile conditions. Pipette 1 ml of Agrobacterium suspension into a 1.5 ml EP tube, add 1.4 μl of acetosyringone (0.1 M), and mix well. Add the prepared bacterial solution and incubate for 5 minutes, then place it on the co-culture medium and incubate in the dark at 23°C for 3 days. After co-culture, place it on the resting medium and incubate in the dark at 25°C for 5 days. Transfer the callus to screening medium 1, seal the petri dish with sealing film, and incubate in the dark at 25.5°C in an incubator for 2 weeks. Cut the callus and transfer it to screening medium 2, seal the petri dish again with sealing film, and continue to incubate in the dark at 25.5°C in an incubator for 2 weeks. Two weeks after cutting and screening the callus, transfer the resistant callus with green bud points to the regeneration medium. Seal the petri dish and incubate in a 25°C incubator under light / dark (16 h / 8 h) conditions for 2 weeks. Two weeks after regeneration, transfer the healthy growing seedlings to a new resistant regeneration box. Wait until the seedlings grow to a certain size for sampling and detection.

[0062] (3) Take young leaves of regenerated wheat, extract genomic DNA by the CTAB method, and perform PCR identification using primers on two vectors, BUE-DF1 and BUE-DR1. The PCR reaction system is as follows: 10 μL of 2×PCR master mix, 0.5 μL of 10 μM pBUE411-F, 0.5 μL of 10 μM pBUE411-R, 1 μL of gDNA (50 ng / μL), and 8 μL of ddH2O. The PCR reaction program is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec; annealing at 58°C for 30 sec, extension at 72°C for 30 sec, for 32 cycles; final extension at 72°C for 5 min.

[0063] The results are as Figure 3 shown. The bands represent the successfully transformed T0 generation wheat transgenic lines. A total of 19 positive transgenic lines were obtained. Among them, lane M is the Transgen 2K marker, lane 1 is the wild-type material JW1, and lanes 2 - 19 are the T0 generation wheat transgenic lines.

[0064] 2. Identification of TaPUB4 transgenic knockout progeny

[0065] The target sequences designed in this example can directly target and edit homologous genes on the A / B / D three genomes. Therefore, it is necessary to simultaneously detect the gene editing of the TaPUB4-3A / B / D three homologous copies. In this experiment, the Hi-TOM gene editing site detection kit purchased from Xi'an Qingxue Biotechnology Co., Ltd. was used. This kit completes the high-throughput library construction process through PCR and directly analyzes the variant information of multiple samples and multiple sites using the Hi-TOM online software.

[0066] In this example, specific primers (Tapub4-gRNA-F and Tapub4-gRNA-R in Table 1) were designed for the sgRNA1 target sequence, which can simultaneously amplify the genes TaPUB4-3A, TaPUB4-3B, and TaPUB4-3D. Additionally, the amplified fragment contains SNP sequences that can distinguish the ABD genomes. After the amplified products were used to construct a library, they were sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing.

[0067] The first-round PCR reaction system was prepared using the genomic DNA of the leaves of the Tapub4 wheat knockout mutant plant as a template: 1 μL of gDNA (about 100 ng / μL), 10 μL of 2× Taq Master Mix, 0.5 μL of 10 μM Tapub4-gRNA-F and Tapub4-gRNA-R (Table 1), and sterile water was added to make up to 20 μL.

[0068] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, for a total of 32 cycles; and finally extension at 72°C for 5 min. After PCR, 5 μL of the product was taken for agarose gel electrophoresis to detect the PCR products and ensure the presence and good specificity of the target products. Then, log in to the Hi-TOM sample management system ( http: / / 121.40.237.174 / Hi-TOM / ), fill in the relevant information, and send the first-round PCR samples. The samples were used to construct a library. The specific system was 12 μL of Hi-TOM Mix, 1 μL of the first-round PCR product, and sterile water was added to make up the volume to 20 μL. The PCR reaction program was: denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 25 s, for a total of 33 cycles; and finally extension at 72°C for 5 min. The amplified products were mixed for gel extraction, and the gel extraction products were the library construction and sequencing samples, which were then sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing. Finally, the analysis results can be viewed from the Hi-TOM: High-Throughput Mutation Analysis website ( http: / / www.hi-tom.net / hi-tom / index-CH.php ).

[0069] The sequencing results showed that there were a total of 3 triple-edited transgenic lines, all of which had frameshift mutations caused by insertions or deletions. The gene editing results of TaPUB4-3A, TaPUB4-3B, and TaPUB4-3D are as Figure 4 shown. The sgRNA and Cas9 elements were successfully transformed and functioned, editing the TaPUB4 gene, resulting in frameshift mutations in the three proteins TaPUB4-3A, TaPUB4-3B, and TaPUB4-3D, and the conservative structural and functional domains could not be correctly expressed, causing the corresponding functions of the genes to be lost.

[0070] Phenotype Identification of Wheat Offspring after Knocking out TaPUB4 Gene in Example 3

[0071] The wild-type receptor variety JW1 and three knockout strains Tapub4 1#, Tapub4 2# and Tapub4 3# were planted in the greenhouse of Shandong University Qingdao Campus (120.41°E, 36.07°N) under the following culture conditions: light / darkness = 16 / 8h; daytime temperature 22°C, nighttime temperature 16°C; humidity between 40% and 50%; CO2 concentration 500ppm to 700ppm.

[0072] During the grain filling period, wheat plant height, tiller number and main ear length were counted, and the plant morphology of the wild type and knockout mutants was photographed using a Canon high-performance SLR camera.

[0073] When the wheat reaches the middle and late stages of waxy maturity, harvest the wheat individually, take photos of the spikelets, and count the number of spikelets.

[0074] The harvested wheat seeds were placed in a 37°C constant temperature incubator for continuous drying for 14 days, and photographs were taken and the length and width of the wheat grains of JW1 and the three knockout lines were counted.

[0075] like Figure 6 As shown, the plant heights of JW1 and TaPUB4 knockout mutants were counted ( Figure 6 Middle B), tillering ( Figure 6 C), spikelet number ( Figure 6 D), number of grains per ear ( Figure 6 Middle E), ear length ( Figure 6 F) and grain length ( Figure 6 Medium I) Grain width ( Figure 6 (in J).

[0076] The results showed that the plant height, main spike length, grain length and grain width of the Tapub4 knockout mutant were not significantly different from those of the wild type, while the number of tillers and spikelets decreased significantly compared with the wild type JW1. The above results indicate that TaPUB4 has a positive regulatory effect on the number of tillers and spikelets in wheat.

[0077] The present invention constructs a pBUE411-TaPUB4 binary recombination vector containing sgRNA and capable of targeting TaPUB4, uses Agrobacterium to infect wheat immature embryos to induce callus tissue, and specifically targets and edits the TaPUB4 gene, causing a frameshift mutation in the U-box domain and thereby losing its function, thereby significantly reducing the number of wheat tillers and spikelets, laying a new foundation for optimizing and improving wheat varieties.

[0078] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of wheat TaPUB4 gene knockout mutant in reducing tiller number and spikelet number; The coding nucleotide sequence of the TaPUB4 gene is shown in SEQ ID NO.3; the nucleotide sequence of the sgRNA targeting the TaPUB4 gene is shown in SEQ ID NO.

4.

2. The use according to claim 1, characterized in that: A pBUE411- TaPUB4 plant binary expression vector containing sgRNA was constructed, wherein the pBUE411- TaPUB4 plant binary expression vector consisted of an expression cassette E1 and an expression cassette E2; wherein the nucleotide sequence of the expression cassette E1 included, from upstream to downstream: a TaU3 promoter from wheat, the sgRNA of the TaPUB4 gene, and a terminator T1; and the nucleotide sequence of the expression cassette E2 included, from upstream to downstream: a ubiquitin promoter Ubi from corn, a corn Cas9 coding sequence, and a terminator T2.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the wheat TaU3 promoter is shown in SEQ ID NO.6; the nucleotide sequence of the terminator T1 is shown in SEQ ID NO.

7.

4. The use according to claim 2, characterized in that: The nucleotide sequence of the maize ubiquitin promoter Ubi is shown in SEQ ID NO.8; the nucleotide sequence of the maize Cas9 coding sequence is shown in SEQ ID NO.9; and the nucleotide sequence of the terminator T2 is shown in SEQ ID NO.

10.

5. The use according to claim 1, characterized in that: The method for constructing wheat TaPUB4 gene knockout mutant is as follows: Gene editing technology was used to obtain the sgRNA of the wheat TaPUB4 gene knockout mutant; Construct the pBUE411- TaPUB4 plant binary expression vector containing sgRNA; The callus tissue induced by wheat immature embryos was infected with Agrobacterium, and the sgRNA and Cas9 elements were co-transferred into wheat to specifically knock out the TaPUB4 gene, thereby obtaining transgenic wheat with the TaPUB4 gene knocked out, and obtaining a wheat TaPUB4 gene knockout mutant.

Images