Application of OsOSR2 gene in regulating drought and heat resistance in rice

By identifying and regulating the OsOSR2 gene, the problem of insufficient resistance of rice to the combined stress of drought and high temperature was solved, the drought and heat resistance of rice varieties were improved, and new varieties with specific environmental tolerance were bred.

CN118813671BActive Publication Date: 2025-09-30HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410920505.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-10
Publication Date
2025-09-30
Estimated Expiration
2044-07-10

AI Technical Summary

Technical Problem

In the prior art, rice has insufficient resistance to drought and high temperature, making it difficult to effectively improve its growth and yield under combined stress conditions.

Method used

By isolating and identifying the OsOSR2 gene from rice, OsOSR2 mutants were screened using ozone fumigation, and its expression was enhanced or weakened to regulate the drought and heat resistance of rice. CRISPR-Cas9 technology was used for gene editing to improve or reduce the environmental tolerance of rice.

Benefits of technology

Significantly improve or reduce the drought and heat resistance of rice, cultivate new drought-resistant and heat-resistant varieties or environmentally sensitive varieties, and enhance their survival ability under the combined stress of drought and high temperature.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004936557380000011
    Figure HDA0004936557380000011
  • Figure HDA0004936557380000021
    Figure HDA0004936557380000021
  • Figure HDA0004936557380000031
    Figure HDA0004936557380000031
Patent Text Reader

Abstract

The present invention belongs to the technical field of plant genetic engineering. OsOSR2 Application of genes in genetic improvement of rice drought and heat resistance. The present invention uses ozone fumigation screening method to clone a gene that controls rice drought and heat resistance. OsOSR2 , biological function verification showed that it regulates the drought and heat resistance response of rice, and physiological experiments showed that osr2 The mutant is closely related to drought-sensitive and drought-high temperature combined stress-sensitive phenotypes. The present invention confirms the biological function of the gene and its application approach and method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering. Specifically, it relates to the application of the OsOSR2 gene in controlling drought and heat resistance in rice. The present invention uses ozone fumigation to screen receptor kinase mutants, cloning a gene, OsOSR2, that controls drought and heat resistance in rice. Biological function validation demonstrates its ability to improve drought tolerance and drought and heat resistance in rice. Co-segregation detection experiments indicate that the osr2 mutant is closely associated with drought and drought-high temperature sensitivity phenotypes. The present invention confirms the biological function of this gene and its application approaches and methods. Background Art

[0002] In recent years, global extreme weather events have become increasingly frequent due to human activities, significantly impacting crop growth and yield. Drought is one of the most significant abiotic stressors in plants, with studies showing that crop yields can be reduced by up to 70% after drought (Khan MA, Gemenet DC, Villard A. Root System Architecture and Abiotic Stress Tolerance: Current Knowledge in Root and Tuber Crops. Front Plant Sci. 2016 Nov 1;7:1584). Furthermore, high temperatures are becoming increasingly frequent during extreme weather events, and heat stress can even harm plants throughout their entire growth cycle (Mittler R, Blumwald E (2010) Genetic engineering for modern agriculture: challenges and perspectives. Ann Rev Plant Biol 61:443–462). Severe weather conditions in nature often occur in isolation, so studying the mechanisms by which plants cope with combined stresses is not only a frontier of scientific research but also a key goal for future agricultural development of stress-resistant crops. Plants have pores in their leaves and stems that allow them to exchange gas and liquid with the environment. The process of photosynthesis requires the opening of stomata to absorb and fix carbon dioxide, but if the stomata are continuously open, too much transpiration water will be lost, resulting in a significant decrease in the water utilization rate of the plant. Therefore, plants have evolved very specific stomatal guard cells to sense signals and balance and coordinate the photosynthesis and transpiration processes. Ozone in air pollution can induce plants to close their stomata. If the stomatal closing factors are disordered, the stomata will not close normally, causing ozone to enter the plant cells, produce too much reactive oxygen, and cause yellowing and damage to the leaves. Therefore, ozone can be used to screen for related factors involved in regulating stomatal closure in stomatal guard cells. For example, researchers used ozone screening to identify the key stomatal response factors SLAC1, GHR and MPK12 in guard cells, and found that they played a very important regulatory function in the process of stomatal opening and closing (Vahisalu T, Kollist H, Wang YF, Nishimura N, Chan WY, Valerio G, A,BroschéM,MoldauH,Desikan R,Schroeder JI, J.SLAC1is required for plant guard cell S-type anion channel function in stomatal signalling.Nature.2008Mar 27;452(7186):487-91. H,Sierla M, K,Wang C,Wang YS,Nuhkat M,Valk E,PechterP,Merilo E, J,Overmyer K,Loog M,BroschéM,Schroeder JI, J,KollistH.A Dominant Mutation in the HT1Kinase Uncovers Roles of MAP Kinases and GHR1in CO2-Induced Stomatal Closure.Plant Cell.2016Oct;28(10):2493-2509.JakobsonL,Vaahtera L, K,Nuhkat M,Wang C,Wang YS, H,Valk E,Pechter P,Sindarovska Y,Tang J,Xiao C,Xu Y,Gerst Talas U, AT, S,MaranU,Remm M,Roelfsema MR,Hu H, J,Loog M,Schroeder JI,Kollist H,BroschéM.Natural Variation in Arabidopsis Cvi-0 Accession Reveals an Important Roleof MPK12 in Guard Cell CO2 Signaling.PLoS Biol.2016Dec 6;14(12):e2000322.)。

[0003] Plants experience diverse biotic and abiotic stresses and have therefore evolved sophisticated mechanisms for stress perception and response regulation. Receptor-like kinases (RLKs), one of the largest families in plants, have been reported to play important roles in stress responses. Plant genomes encode numerous cell-surface RLKs that participate in stress perception and signaling through their protein kinase function. The LRR-RLKs kinase DPR1, identified in rice, plays an important role in the early drought stress response of millet. The phosphorylation level of DPR1 is enhanced under osmotic stress, and it dephosphorylates downstream key osmotic stress factors such as SnRK2s, thereby transmitting osmotic signals (Meicheng Zhao, Qi Zhang, Hong Liu, Sha Tang, Chunyue Shang, Wei Zhang, Yi Sui, Yuxue Zhang, Chunyan Zheng, Hui Zhang, Cuimei Liu, Jinfang Chu, Guanqing Jia, Haigang Wang, Xigang Liu, Diaoguo An, Feng Zhu, Hui Zhi, Chuanyin Wu, Xianmin Diao, The osmotic stress–activated receptor-like kinase DPY1mediates SnRK2 kinase activation and drought tolerance in Setaria, The Plant Cell, Volume 35, Issue 10, October 2023, Pages 3782–3808). The OsOSR2 gene involved in the present invention belongs to the S domain subfamily (SDRLKs).

[0004] Rice is an important food and cash crop. Due to increasingly harsh natural environments, rice yield growth has far outpaced population growth. Therefore, breeding rice with strong stress tolerance, particularly the ability to withstand multiple adverse stresses, is crucial. Currently, there are no reports on whether the OsOSR2 gene can enhance stress tolerance in rice. Therefore, isolating the OsOSR2 gene from rice and characterizing its role in enhancing stress tolerance will be crucial for developing new stress-tolerant rice varieties. Summary of the Invention

[0005] The present invention relates to a member of the receptor-like kinase (RLKs) superfamily, OsOSR2, and its application in genetic improvement of rice drought resistance and / or heat tolerance. The protein encoded by the OsOSR2 gene is shown in SEQ ID NO.2.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] OsOSR2 belongs to the S-domain kinase subfamily (SDRLKs). It was screened through ozone fumigation, and mutants were found to be abnormally sensitive to ozone. The applicant named this gene ozone-sensitive receptor kinase 2 (OsOSR2). The present invention identified and cloned a fragment containing the OsOSR2 gene. Mutations in this gene lead to increased leaf temperature in rice and reduced tolerance to drought and combined drought and high-temperature stress. The CDS sequence of the OsOSR2 gene is shown in SEQ ID NO: 1, with a length of 2451 bp. The encoded protein is shown in SEQ ID NO: 2, with an amino acid sequence of 816.

[0008] The protection scope of the present invention includes:

[0009] The OsOSR2 gene in rice is used to control the environmental tolerance of rice. The protein encoded by the OsOSR2 gene is shown in SEQ ID NO. 2. The environmental tolerance is drought resistance and / or high temperature resistance.

[0010] The applications described above are specifically:

[0011] Increasing the expression of the OsOSR2 gene in rice can enhance the environmental tolerance of rice;

[0012] Specifically, a substance that increases the expression level of the OsOSR2 gene in rice is introduced into the rice. Preferably, the substance is a nucleic acid molecule containing the OsOSR2 gene, or its expression cassette, recombinant vector, or recombinant microorganism.

[0013] The expression vector carrying the OsOSR2 gene of the present invention can be introduced into plant cells using conventional biotechnology methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, Method for Plant Molecular Biology VIII, Academy Press, New York, 1998, pp. 411-463; Geiserson and Corey, Plant Molecullar Biology (2nd Edition), 1998).

[0014] Reducing the expression of the OsOSR2 gene in rice weakens the environmental tolerance of rice;

[0015] Knockout, inhibition or silencing of the OsOSR2 gene in rice can weaken the environmental tolerance of rice; the above method can achieve the purpose of weakening the environmental tolerance of rice as long as the OsOSR2 protein function is lost.

[0016] The aforementioned reduction of rice environmental tolerance is preferably achieved by CRISPR-Cas9 knockout, wherein the target sequence to be knocked out is GAAAATCGCAGGTACGCACT, and the resulting rice mutant contains the gene shown in SEQ ID NO. 3 or SEQ ID NO. 4. The preferred polynucleotide of the aforementioned OsOSR2 gene is shown in SEQ ID NO. 1.

[0017] Compared with the prior art, the advantages of the present invention are:

[0018] The expression vector containing the OsOSR2 gene of the present invention can be transformed into various plant hosts such as rice and used to cultivate new drought-resistant and heat-resistant plant varieties. By knocking out the gene, environmentally sensitive rice varieties can be cultivated. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of wild-type Kitaake rice and osr2 mutant after ozone fumigation and mutant gene editing;

[0020] Among them: A. Comparison of ozone fumigation phenotypes of wild-type rice and osr2 mutant B. Gene editing of OsOSR2 in rice osr2-1 and osr2-2 mutants.

[0021] Figure 2 Schematic diagram of the leaf temperature phenotype of rice wild-type Kitaake and osr2 mutant.

[0022] Figure 3 Schematic diagram of the phenotypes of wild-type Kitaake and osr2 mutant after drought stress at the seedling stage;

[0023] A shows the phenotypes of wild-type Kitaake and osr2 mutants after drought stress at the seedling stage; B shows the statistical data of rice survival rate after drought stress; osr2-1 and osr2-2 are two allelic mutants of OsOSR2, and Kitaake is the control group.

[0024] Figure 4 Schematic diagram of the phenotypes of wild-type Kitaake and osr2 mutant after drought and high temperature combined stress at the seedling stage;

[0025] A shows the phenotypes of wild-type Kitaake and osr2 mutants after drought and high temperature combined stress at the seedling stage; B shows the statistical data of rice survival rate after drought and high temperature combined stress; osr2-1 and osr2-2 are two allelic mutants of OsOSR2, and Kitaake is the control group. DETAILED DESCRIPTION

[0026] The following examples define the present invention and describe methods for verifying the function of the OsOSR2 gene. Based on the following description and these examples, one skilled in the art will be able to ascertain the essential features of the present invention and, without departing from the spirit and scope of the invention, to make various changes and modifications to adapt the invention to various uses and conditions.

[0027] Example 1: Ozone screening of rice RLKs related to stomata

[0028] Ozone can induce plant stomatal closure. If the stomatal development or response of the plant is defective, after ozone fumigation, the leaves of the plant will have more severe brown spots than the control group because the stoma cannot close normally. Wild-type rice (kitaake) seeds were mixed with mutant seeds of 231 genes in the RLKs mutant library - from Professor Xie Kabin's laboratory at Huazhong Agricultural University. The mutant library was generated based on the CRISPR-Cas9 system technology. For specific reference (Chen K, Ke R, Du M, Yi Y, Chen Y, Wang X, Yao L, Liu H, Hou X, Xiong L, Yang Y, Xie K. AFLASH pipeline for arrayed CRISPR library construction and the gene function discovery of rice receptor-like kinases. Mol Plant. 2022 Feb 7; 15(2): 243-257.). Specifically, the target sites of all genes of the RLKs family were designed and constructed into the modified CRISPR-Cas9 vector (the vector contains FLASH Markers of different sizes from V1 to V11, and the corresponding vector can be determined by PAGE detection). The mixed genes were then genetically transformed into rice. Positive plants were obtained through resistance screening, and the targeted editing genes corresponding to the positive plants were determined by identifying the FLASH Markers. The plants were then numbered, and the CRISPR knockout mutant library of the RLKs family was obtained after the individual plants were harvested.

[0029] The seeds in the mutant question bank were germinated in water and then planted in soil. After growing to the five-leaf stage in a growth chamber (12 hours light / 12 hours dark) at 28°C and 75% relative humidity, they were fumigated with 0.5 ppm ozone for 10 hours daily for 3 days. The yellowing and chloasma on the leaves of the wild-type and mutant plants were compared and analyzed.

[0030] After ozone fumigation, the leaves of the mutant plants numbered R157 showed a more obvious yellow-brown spot phenotype than the wild type. The gene numbered R157 was named ozone-sensitive receptor kinase 1 (OsOSR2). The target sequence for knockout of this gene was GAAAATCGCAGGTACGCACT. Primers F: GTACTACTATTCGCCTTAAGCATC R: ATTGAGGAGAAGTAATCGCC were designed to identify the upstream and downstream sequences of the Crispr mutation target site of this gene. In the OsOSR2 mutant osr2-1, the OsOSR2 gene target site was deleted for 4 bases (the OsOSR2 gene with a 4-base deletion contains the sequence shown in SEQ ID NO.3), and the family osr2-2 gene target site was deleted for 3 bases (the OsOSR2 gene with a 3-base deletion contains the sequence shown in SEQ ID NO.4). Translation was terminated prematurely, resulting in loss of OsOSR2 protein function ( Figure 1 )

[0031] Example 2:

[0032] Identification of osr2 leaf temperature phenotype

[0033] Leaf temperature is correlated with the rate of transpirational water loss, so thermal imaging systems can be used to monitor plant stomatal capacity. Therefore, we examined the leaf temperature of the osr2 mutant. Screened homozygous mutants with identified mutation sites (osr2-1 and osr2-2) and Kitaake were germinated and seeded in 96-well hydroponic culture plates. After growing to the five-leaf stage in a growth chamber at 28°C and 75% relative humidity (12 hours light / 12 hours dark), leaf temperature measurements were taken. The results showed that compared to the wild-type Kitaake control, the leaf temperatures of the two osr2 mutants were significantly lower, indicating that the osr2 mutants have a larger total stomatal area and faster transpirational water loss.

[0034] Example 3:

[0035] Identification of drought stress phenotypes of osr2 mutants at the seedling stage

[0036] The homozygous mutants (osr2-1, osr2-2) and Kitaake with identified mutation sites were germinated and then spotted into 96-well plate nutrient solution culture boxes. After normal growth to the five-leaf stage, the mutant strains and wild-type Kitaake were subjected to drought stress. The nutrient solution in the culture box was replaced with 20% PEG6000 solution. After 2 days of treatment, photos were taken and recorded. Then the nutrient solution was replaced with normal solution. After 6 days of recovery, the survival rate was calculated. The results are shown in the figure. After a period of treatment with 20% PEG 6000 solution, the leaves of the osr2 mutant strain were more severely yellowed and wilted than those of the wild-type Kitaake. After 6 days of normal growth, we performed statistical analysis on the survival rate and found that the survival rate of the osr2 mutant strain was lower than that of the wild type ( Figure 3 ).

[0037] Example 4:

[0038] Identification of drought and high temperature stress phenotypes of osr2 mutants at the seedling stage

[0039] Drought and high temperature often occur together in nature. We identified the function of OsOSR2 in rice drought and high temperature combined stress. We cultured Kitaake and osr2 mutant strains in 96-well plates until the five-leaf stage. Then, the seedlings were subjected to a combined stress of 42°C high temperature and 20% PEG 6000. After 24 hours of treatment, the leaves of the osr2 mutant strains curled and wilted more than those of the wild type. After 6 days of growth under normal conditions (28°C + nutrient solution), the osr2 mutant plants showed drought and high temperature sensitivity compared to the wild type ( Figure 4 ).

Claims

1. Rice OsOSR2 Application of genes in controlling environmental tolerance of rice, the OsOSR2 The protein encoded by the gene is shown in SEQ ID NO.

2. The environmental tolerance is drought resistance and / or high temperature resistance. The application process is to reduce the OsOSR2 The expression of the gene weakens the environmental tolerance of rice.

2. The use according to claim 1, wherein the reduction of OsOSR2 The method of knocking out or silencing gene expression in rice OsOSR2 Gene.

3. The use according to claim 2, wherein the knockout is achieved by using CRISPR-Cas9 to reduce the OsOSR2 The expression level of the gene was determined, and the target sequence for knockout was GAAAATCGCAGGTACGCACT.

4. The use according to claim 1, wherein OsOSR2 The gene is shown in SEQ ID NO.1.