A molecular marker related to the 1000-grain weight trait of Brassica napus and its application

Abstract

The present invention discloses a molecular marker closely related to the thousand-grain weight of Brassica napus, an amplification primer and an application thereof. The molecular marker is DA03‑213, comprising two sequences of nucleotide sequences such as SEQ ID NO.3 and SEQ ID NO.4; an amplification primer for identifying the molecular marker is also disclosed, comprising primers of nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2. The genomic DNA of Brassica napus is amplified and identified by the amplification primer, and the thousand-grain weight phenotype of the Brassica napus can be determined according to the band conditions of the amplification results, which can be used for the identification and prediction of the grain weight trait of Brassica napus, improve the selection efficiency of the thousand-grain weight trait of Brassica napus, accelerate the breeding process, and has application value in the field of Brassica napus planting.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a molecular marker closely related to the thousand-grain weight of Brassica napus and a molecular marker amplification primer and application thereof. Background Art

[0002] Rapeseed (Brassica napus L.) is one of the most important oil crops in the world and the largest oil crop in my country. Rapeseed oil accounts for more than 55% of the total domestic edible vegetable oil. It is estimated that the world population will reach 9 billion by 2050. In order to meet the supply gap, rapeseed production needs to be increased urgently (Liu SY, Raman H, Xiang Y, Zhao CJ, Huang JY, Zhang Y Y. De novo design of future rapeseed crops: Challenges and opportunities. The Crop Journal, 2022, 10 (3): 587-596.). The cultivation of new high-yield rapeseed varieties is of great significance to meet domestic and foreign market demand, and provides an important guarantee for the development of my country's rapeseed industry and the security of oil supply.

[0003] Grain weight is the main component of rapeseed seed yield. Previous researchers have conducted a large number of QTL positioning or association analysis on rapeseed grain weight in an attempt to analyze its genetic basis. At present, only a few functional genes have been identified, and the understanding of the regulation mechanism of rapeseed grain weight is limited (Dong HL, Yang L, Liu Y L, Tian GF, Tang H, Xin SS, Cui YX, Xiong Q, Wan HF, Liu Z, Jung C, Qian W. Detection of new candidate genes controlling seed weight by integrating gene coexpression analysis and QTL mapping in Brassica napus L. The Crop Journal, 2022.). With the completion of rapeseed genome sequencing and the establishment of a pan-genomic platform, further research on rapeseed grain weight traits with the help of quantitative trait loci (QTL) positioning and molecular markers will help promote the discovery of rapeseed grain weight functional genes, lay the foundation for revealing the regulatory mechanism of rapeseed grain weight, and contribute to molecular marker-assisted selection of high-yield rapeseed breeding. Therefore, it is hoped to provide an InDel marker closely related to the major effect QTL locus of thousand-grain weight of Brassica napus, which can detect or predict the thousand-grain weight of Brassica napus and effectively select the thousand-grain weight of Brassica napus. It can be used for the fine positioning and map-based cloning of the QTL locus of Brassica napus grain weight, which is of great significance for analyzing the regulatory mechanism of rapeseed grain weight. It can also be used for molecular marker-assisted breeding of Brassica napus grain weight traits, and accelerate the breeding process of high-yield rapeseed varieties. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker closely related to the thousand-grain weight of Brassica napus and its amplification primers, in order to solve the shortcomings of conventional breeding methods, such as the thousand-grain weight trait must be examined and identified after the seeds are mature and harvested, the large workload and long cycle of group identification, and improve breeding and production efficiency.

[0005] In order to achieve the above-mentioned object, the present invention provides a molecular marker related to the thousand-grain weight trait of Brassica napus, the molecular marker is DA03-213, and comprises two sequences of nucleotide sequences such as SEQ ID NO.3 and SEQ ID NO.4. The molecular marker can be used to identify the thousand-grain weight trait of Brassica napus.

[0006] The present invention also provides an amplification primer for identifying the above molecular marker, the amplification primer comprises two primers with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2, and the amplification primer can also be prepared into a kit for identifying the thousand-grain weight trait of Brassica napus.

[0007] The amplification primers and kit provided by the invention can be used in the field of planting Brassica napus, and can be specifically used for identifying the thousand-grain weight trait of Brassica napus and improving the breeding efficiency of Brassica napus.

[0008] The present invention also provides a method for identifying the thousand-grain weight trait of Brassica napus, comprising the following steps:

[0009] (1) extracting genomic DNA of Brassica napus to be tested;

[0010] (2) using the extracted genomic DNA as a template and performing PCR amplification using the above-mentioned amplification primers;

[0011] (3) The 1000-grain weight trait of Brassica napus is determined by the amplification results. When the sequence of the amplified product is SEQ ID NO.3, it indicates that the Brassica napus to be tested has a low 1000-grain weight trait; when the sequence of the amplified product is SEQ ID NO.4, it indicates that the Brassica napus to be tested has a high 1000-grain weight trait; when the sequence of the amplified product is SEQ ID NO.3 and SEQ ID NO.4, it indicates that the Brassica napus to be tested has a medium 1000-grain weight trait.

[0012] Preferably, the above PCR amplification conditions are specifically:

[0013] The PCR reaction system was as follows: 1 μL of 50 ng / μL DNA template, 5 μL of 2× Taq mix, 0.5 μL of 10 mM forward and reverse amplification primers, and ddH2O to make up to 10 μL;

[0014] The PCR amplification program was gradient amplification: 94°C for 5 min; [94°C for 30 s, 62°C for 30 s (ΔT = -0.5°C), 72°C for 30 s] × 10 cycles; [94°C for 30 s, 57°C for 30 s, 72°C for 30 s] × 25 cycles; 72°C for 5 min, 16°C Pause.

[0015] The present invention has the following advantages:

[0016] The invention discloses a molecular marker related to the thousand-grain weight trait of Brassica napus and an amplification primer thereof. The molecular marker is amplified and identified by the amplification primer, so that the thousand-grain weight trait of Brassica napus can be determined, which effectively solves the shortcomings of conventional breeding methods, such as the thousand-grain weight trait must be identified only after the seeds are grown to maturity and harvested, the large workload of group identification, and the long cycle, etc., and significantly improves the selection efficiency of Brassica napus thousand-grain weight plants, saving the time of breeding selection. The detection is simple and fast, the cost is low, the results are stable, and it is suitable for large-scale promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1This is the result of the present invention mapping the main effect QTLqSW-A03-DA of 1000-grain weight in Brassica napus. Figure 1 A in the figure indicates the preliminary localization of the 1000-grain weight QTLqSW-A03-DA to chromosome A03 at 18.687-19.731 Mb (1.044-Mb) by Bin-map; Figure 1 B in the figure is the result of narrowing the interval of QTLqSW-A03-DA to 19.111-19.390 Mb (279-kb) of chromosome A03 by combining the thousand-grain weight phenotypes of 174 strains in the RIL population and 8 InDel markers developed in the laboratory in the early stage; Figure 1 C in the figure is the result of adding molecular marker DA03-213 and further narrowing the interval to 19.197-19.256Mb (59-kb) through analysis of exchange strains. Among them, the genotype consistent with the parent ZS11 is recorded as A, the genotype consistent with the parent DL704 is recorded as B, and the genotype containing both A and B is recorded as H; for the three exchange strain types Class1-3, N represents the number of exchange strains in the interval, and the corresponding phenotype is F 2:4 、F 2:5 、F 2:6 REP1 and F 2:6 The thousand-grain weight of REP2; for ZS11 and DL704, the corresponding phenotypes are the thousand-grain weight from 2015 to 2022; ** and *** represent P ttest <0.01, P ttest <0.001, "NS" means P ttest ≥0.05, no significant difference.

[0018] Figure 2 This is a schematic diagram of the detection of different strains of ZS11, DL704 and RIL populations by the molecular marker DA03-213 of the present invention, wherein the first channel is the marker, the second channel is the parent ZS11, the third channel is the parent DL704, and the 4th to 43rd channels are 40 strains randomly selected from the RIL population.

[0019] Figure 3 The molecular marker DA03-213 of the present invention was used to identify 174 strains of the RIL population to obtain the thousand-grain weight phenotypes corresponding to different genotypes. A represents a homozygous type with low thousand-grain weight, B represents a homozygous type with high thousand-grain weight, and H represents a heterozygous type with an intermediate thousand-grain weight. *** represents P ttest <0.001. DETAILED DESCRIPTION

[0020] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0022] DL704 is an artificially synthesized large-grained Brassica napus variety obtained in the early breeding work of our laboratory. The material was derived through distant hybridization (Wan Huafang, Wei Shuai, Feng Yuxia, Qian Wei. Creation of a new type of drought-resistant Brassica napus variety (AnArCnCo) using hexaploid (AnAnCnCnCoCo) as a bridge [J]. Chinese Agricultural Science, 2020, Vol. 53 (16): 27, 3226-3234.). After years of continuous self-pollination observation, the large-grain phenotype of DL704 can be stably inherited, which is of great significance for the breeding of high-yield rapeseed varieties. ZS11 is a Brassica napus variety selected and bred by the Chinese Academy of Agricultural Sciences for oil crop research (Wang Liangjun, Li Bo, Chen Yi, Zhang Junshou, Yuan Yingchun, Zheng Zufeng. Demonstration performance and high-yield cultivation technology of Zhongshuang 11 [J]. Hubei Agricultural Science, 2011, (10): 1964-1965, 1979). From 2015 to 2022, the thousand-grain weight of DL704 was 6.72±0.44 g, which was 52.52% higher than that of ZS11 (4.41±0.51 g) (P ttest <0.001). In the early stage, a recombinant inbred line (RIL) population was configured with Brassica napus DL704 and ZS11 as parents, and the grain weight QTL was located using the RIL population. The specific plan is as follows.

[0023] Experimental Example 1 Development of molecular markers closely related to 1000-grain weight of Brassica napus

[0024] This experimental example provides a molecular marker closely related to the major effect QTLqSW-A03-DA of Brassica napus grain weight, and the specific development method is as follows:

[0025] (I) Population construction and thousand-grain weight phenotype investigation:

[0026] A RIL population of 174 lines was constructed using DL704 and the high-quality rapeseed cultivar ZS11 as parents. The RIL population was propagated by self-pollination, and F 2:4Group, 2021 received F 2:5 Group, 2022 received F 2:6 Group, where F 2:6 The two repetitions of the population in 2022 are denoted as F 2:6 REP1 and F 2:6 REP2. In mid-to-late April each year, after the seeds mature naturally, 50 siliques are harvested from the bottom of the main inflorescence of healthy individual plants to examine the thousand-grain weight. Five plants are examined for each strain, and the average is taken as the thousand-grain weight phenotypic value of the strain that year.

[0027] (II) Bin-map construction and QTL analysis of thousand-grain weight:

[0028] DL704 and ZS11 were resequenced at a depth of 30×. Combined with the 1000-grain weight phenotype data of the RIL population for many years, 80 strains with extreme and relatively stable 1000-grain weight were selected for resequencing at a depth of 5×. Using ZS11.v0 (http: / / cbi.hzau.edu.cn / cgi-bin / rape / download_ext) as the reference genome, 1,261,526 markers were obtained after analysis of the resequencing data, which were merged into 1306 Bin markers for constructing Bin-map. The total length of the obtained Bin-map was 1588.128 cM, and the average interval between adjacent Bin markers was 1.648 cM.

[0029] Combined with F 2:4 、F 2:5 、F 2:6 REP1, F 2:6 The phenotypic effect of REP2 on grain weight QTL analysis revealed the location of the major QTL for thousand-grain weight in Brassica napus, qSW-A03-DA. Figure 1 The 1000-grain weight QTL was located using the composite interval mapping method of WinQTL Cartographer 2.5 software. When the 1000-grain weight QTL was detected simultaneously in different populations or different years, and the confidence intervals overlapped on the same chromosome, they were considered to be the same QTL. The main effect QTL qSW-A03-DA was identified, explaining 29.99%-46.56% of the phenotypic variation, with an additive effect of 0.70-0.95 and an F 2:4 、F 2:5 、F 2:6 REP1, F 2:6 The overlapping interval was located at 53.5-56.3 cM (2.8 cM) of the A03 linkage group, and the corresponding physical interval was 18.687-19.731 Mb (1.044-Mb) of the A03 chromosome. The preliminary location diagram of the 1000-grain weight QTLqSW-A03-DA on the A03 chromosome was obtained as shown in the figure. Figure 1 As shown in A.

[0030] (III) Candidate marker analysis:

[0031] Combining the variation annotation of the resequencing data of the parents ZS11 and DL704, the InDel sites in the 18.687-19.731Mb interval of chromosome A03 were found. The sequences corresponding to the differential sites were queried from the Brassica napus reference genome ZS11.v0. After obtaining the sequences, the software Primer Premier 5 was used to develop InDel markers, and 8 co-dominant molecular markers closely related to the major effect QTLqSW-A03-DA of thousand-grain weight were designed and screened, including DA03-4, DA03-28, DA03-202, DA03-206, DA03-211, DA03-210, DA03-50, and DA03-205. Combined with the thousand-grain weight phenotypes of 174 strains in the RIL population, the interval of QTLqSW-A03-DA was narrowed down to 19.111-19.390Mb (279-kb) of chromosome A03, see Figure 1 To further narrow the interval, molecular markers were developed within this 279-kb region and were labeled as DA03-213. The primers were synthesized and used in subsequent experiments.

[0032] (IV) Detection of markers:

[0033] Young leaves of ZS11, DL704 and RIL were taken, gDNA was extracted respectively, and PCR amplification was performed using the molecular marker DA03-213.

[0034] The amplification primers for molecular marker DA03-213 are as follows:

[0035] Forward primer (SEQ ID NO.1):

[0036] 5'-TTCAAGAAATCCATGGAGTGTG-3',

[0037] Reverse primer (SEQ ID NO.2):

[0038] 5'-CTCACACTTTCTCATCAGTGTAGTAGT-3'.

[0039] The marker DA03-213 and the sample to be tested are detected by the involved amplification primers, and the steps are as follows:

[0040] (1) Using genomic DNA from different strains of ZS11, DL704, and RIL populations as templates;

[0041] (2) Use the forward primer and reverse primer mentioned above to carry out PCR process. The PCR reaction system is: add 1μL of DNA template (50ng / μL), add 5μL of 2×Taqmix, add 0.5μL of forward and reverse primers (10mM) respectively, and add ddH2O to 10μL. The gradient PCR amplification program is: 94℃5min; [94℃30s, 62℃30s (ΔT=-0.5℃), 72℃30s]×10 cycles; [94℃30s, 57℃30s, 72℃30s]×25 cycles; 72℃5min, 16℃Pause. After amplification, store in a refrigerator at 4℃.

[0042] (3) The PCR amplification products were separated by 10% polyacrylamide gel electrophoresis and then stained and the bands were analyzed.

[0043] The PCR amplification products were separated by 10% polyacrylamide gel electrophoresis. Figure 2 . Combined with the statistical results of grain weight phenotype, it can be seen that the molecular marker DA03-213 obtained two specific bands, among which the parent ZS11 with low thousand-grain weight phenotype only showed a single band with a slightly larger fragment, and the parent DL704 with high thousand-grain weight phenotype only showed a single band with a slightly smaller fragment (SEQ ID NO.4), and the strains with thousand-grain weight between extremely high and extremely low showed both bands. The two bands were recovered and sent for sequencing, and the band with a slightly larger fragment was 351bp, the specific sequence of which is shown in SEQ ID NO.3, and the band with a slightly smaller fragment was 314bp, the specific sequence of which is shown in SEQ ID NO.4.

[0044] The specific sequence of the molecular marker DA03-213 is as follows:

[0045] The marker sequence of low thousand-grain weight phenotype is SEQ ID NO.3:

[0046] TTCAAGAAATCCATGGAGGTGTGTTTGGTTAAATCTTTAGATCTACTTTGCATGAACAGAGAAAAAAAAAGAGAGAAGGTAAATGGTGTTTTCTCTCAGACAGAAAATGAGTTTTGAACCCTTCTTAGGAATGAGAGAATCAACCAAATGCATGAATCTAGGAAAGATCTCA CAGAATCATAACACTAACACCCCTAGAGAAGCAGAGACACAGAACAGAAGATGAAACACTTCAGATTCTGATTCCTCTCTCTCTCTCTTTAGCTGATAACACTCAAAGCATTATCTGCTAAACACAACAAATCAGTGCACTGAAACTACTACACTGATGAGAAAGTGTGAG.

[0047] The marker sequence of high thousand-grain weight phenotype is SEQ ID NO.4:

[0048] TTCAAGAAATCCATGGAGGTGTGTTTGGTTAAATCTTTAGATCTACTTTGCATGAACAGAGAAAAAAAGAGAGAAGGTAAATGGTGTGTTCCTTCAGACACACTTTCTTAGGAATGAGAGAATCAACCAAATGCATGAATCTAGGAAAGATCTC ACAGAATCATAACACCCCTAGAGAAGCAGAGACACAGAACAGAAGTTGAAACACTCGGGTTTCCTCCCTCTCTCTTTAGCTGATAACACTCAAAGCATTATCTGCTAAACACAACAAATCAGTGCACTGAAACTACTACACTGATGAGAAAGTGTGAG.

[0049] After testing, it was found that the molecular marker DA03-213 is a co-dominant marker that can detect and predict the size of the thousand-grain weight of Brassica napus and effectively select the size of the thousand-grain weight of Brassica napus. Its detection cost is low, the detection method is simple and fast, the detection result is stable and not affected by the environment, and it is suitable for large-scale promotion and application.

[0050] (V) Fine positioning using molecular marker DA03-213:

[0051] The RIL population containing 174 strains bred from ZS11 and DL704 as parents was used as research material. The thousand-grain weight phenotype was analyzed. The results showed that F2:4 、F 2:5 、F 2:6 REP1, F 2:6 The thousand-grain weight phenotypes of REP2 were normally distributed, ranging from 3.09 to 8.28 g, with a mean of 5.25 to 5.51 g and a phenotypic variation rate of 16.87% to 18.36%.

[0052] The gDNA of 174 strains of ZS11, DL704, and RIL populations was extracted as the template to be tested, and PCR amplification was performed using the amplification primers of DA03-213 in Experimental Example 1. The amplification steps were the same as those in Experimental Example 1. After adding the molecular marker DA03-213, combined with the thousand-grain weight phenotypes of ZS11, DL704, and RIL populations obtained in Experimental Example 1, the exchange strains within 19.197-19.390Mb were analyzed, and three types of exchange strains Class1-3 were obtained, which further narrowed the interval to 19.197-19.256Mb (59-kb), as shown in the schematic diagram. Figure 1 The results show that the molecular markers provided by the present invention can achieve the fine positioning of the QTLqSW-A03-DA of grain weight in Brassica napus.

[0053] Application Example 1 Application of Molecular Marker DA03-213 in Brassica napus Breeding

[0054] The molecular marker DA03-213 was amplified and identified by the amplification primers in Experimental Example 1, and combined with F 2:4 、F 2:5 、F 2: 6REP1, F 2:6 The genotype and thousand-grain weight phenotype of REP2 were analyzed. Figure 3 The results showed that there were 117 strains with only a single band of 351bp, and the average 1000-grain weight was 5.11±0.87g; there were 45 strains with only a single band of 314bp, and the average 1000-grain weight was 6.03±0.81g, which was 17.89% higher than the 117 strains of the former; there were 12 strains with both 351bp and 314bp bands, and the average 1000-grain weight was 5.60±0.98g, which was 9.59% higher than the 117 strains of the former. The results showed that strains with high 1000-grain weight could be effectively selected under the auxiliary selection of molecular marker DA03-213. Based on the above identification results, when using DL704 to cultivate large-grain and high-yield rapeseed varieties, identification and screening through molecular marker DA03-213 can effectively improve the identification efficiency of 1000-grain weight phenotype, reduce the workload of later phenotypic inspection, accelerate the breeding process, and play a positive role in the field of rapeseed cultivation.

[0055] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A molecular marker associated with the thousand-grain weight trait of Brassica napus, characterized in that: The molecular marker is DA03-213, which consists of two nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; the marker sequence of low thousand-grain weight phenotype is SEQ ID NO.3, and the marker sequence of high thousand-grain weight phenotype is SEQ ID NO.

4.

2. Use of the molecular marker as claimed in claim 1 in the identification of the thousand-grain weight trait of Brassica napus.

3. A method for identifying the thousand-grain weight trait of Brassica napus, characterized in that: The following steps are included: (1) Extracting genomic DNA from the Brassica napus to be tested; (2) using the extracted genomic DNA as a template, and performing PCR amplification using amplification primers identified as the molecular marker according to claim 1, wherein the nucleotide sequences of the amplification primers are SEQ ID NO.1 and SEQ ID NO.2; (3) The 1000-grain weight trait of Brassica napus was determined by the amplification results. When the sequence of the amplified product was SEQ ID NO.3, the Brassica napus had a low 1000-grain weight trait; when the sequence of the amplified product was SEQ ID NO.4, the Brassica napus had a high 1000-grain weight trait; and when the sequences of the amplified product were SEQ ID NO.3 and SEQ ID NO.4, the Brassica napus had a medium 1000-grain weight trait.

4. The identification method according to claim 3, characterized in that: The conditions for the PCR amplification include: The PCR reaction system was as follows: 1µL of 50 ng / µL DNA template, 5µL of 2× Taq mix, 0.5µL of 10mM forward and reverse amplification primers, and ddH2O was added to 10µL; The PCR amplification program was gradient amplification: 94°C for 5 min; 94°C for 30 s, 62°C for 30 s, 72°C for 30 s, with ΔT = -0.5°C for 10 cycles; 94°C for 30 s, 57°C for 30 s, 72°C for 30 s, for 25 cycles; 72°C for 5 min, and end at 16°C.

Images