A class of spirocyclic amide compounds and preparation method and use thereof

Abstract

The present invention provides a class of spirocyclic amide compounds and a preparation method and use thereof. The structure of the spirocyclic amide compound 1-4 is shown in formula (I). The present inventors conducted a study on Aspergillus antarctica. Aspergillus sp. SCSIO 05702 solid fermentation extract was separated and purified, and the compounds Spirochrains A‑D (1‑4) were obtained from them. Structural analysis showed that compounds 1‑4 belong to a class of spirocyclic amides, all of which are new compounds. Through the evaluation of the anti-respiratory syncytial virus activity of the compounds, it was found that the different configurations of the two ortho-dihydroxyl groups contributed differently to the activity; among them, the new compound Spirochrain B (2) with the strongest inhibitory activity against RSV virus had the strongest binding ability with RSV G protein, and the equilibrium dissociation constant reached 7.95 nM, which is of great significance for the development and utilization of microbial resources from extreme environments such as polar regions.

Description

Technical Field

[0001] The invention belongs to the field of marine natural product chemistry, and specifically relates to a class of spirocyclic amide compounds and a preparation method and use thereof. Background Art

[0002] Antarctica is one of the coldest, driest and windiest environments on Earth. Due to its extreme environmental conditions and ecological pressures, it has laid the foundation for the emergence of novel and highly active secondary metabolites. Therefore, the study of polar natural products is a huge untapped source of biologically active natural products. Respiratory syncytial virus (RSV) is an important pathogen causing acute lower respiratory tract infections in children worldwide. RSV infection can manifest as mild upper respiratory tract infections, and a small number can lead to severe acute lower respiratory tract infections such as bronchiolitis and pneumonia. At present, there are no specific therapeutic drugs and safe and effective preventive measures for RSV infection. Adhesion protein (G protein) and fusion protein (F protein) are the main glycoproteins on the surface of RSV virus particles, and play an important role in the entry of virus particles. G glycoprotein mainly acts as an attachment protein, binding virus particles to target cells by interacting with one or more host cell surface molecules. F protein mainly mediates the fusion of virus and host cell membranes. Targeting the viral envelope protein can effectively inhibit viral entry, prevent the inflammatory factor storm from disrupting the host's immune function, and protect the host from further viral damage from the source. Summary of the invention

[0003] The first object of the present invention is to provide a spirocyclic amide compound, the structure of which is as shown in formula (I):

[0004] Formula (I);

[0005] Compound 2 includes Compound 2a and Compound 2b, and Compound 4 includes Compound 4a and Compound 4b.

[0006] The second object of the present invention is to provide the use of the above-mentioned spirocyclic amide compounds in the preparation of anti-respiratory syncytial virus drugs.

[0007] Preferably, the spirocyclic amide compound is compound 2.

[0008] Preferably, the drug inhibits the adsorption of respiratory syncytial virus to target cells.

[0009] Preferably, the drug inhibits the adsorption of respiratory syncytial virus to target cells by interfering with the function of G protein.

[0010] Preferably, the respiratory syncytial virus is HRSV-A-GZ08-0.

[0011] The third object of the present invention is to provide Aspergillus Aspergillus sp. SCSIO 05702, accession number: CGMCC No.10279.

[0012] The fourth object of the present invention is to provide the above-mentioned Aspergillus Aspergillus sp. Application of SCSIO 05702 in the preparation of the above-mentioned spirocyclic amide compounds.

[0013] A fifth object of the present invention is to provide the above-mentioned Aspergillus Aspergillus sp. The method for cultivating SCSIO 05702 comprises the following steps: Aspergillus sp. SCSIO 05702 is inoculated into a seed culture medium to obtain a seed liquid, and then the seed liquid is inoculated into a fermentation culture medium for fermentation culture; the formula of the seed culture medium is that per liter of culture medium contains: 15 g of malt extract powder, 32 g of sea salt, pH is 6.5, and the balance is water; the formula of the fermentation culture medium is 150 g / L of rice, 32 g / L of sea salt, and the balance is water.

[0014] A sixth object of the present invention is to provide a method for preparing the above-mentioned spirocyclic amide compounds, which comprises the following steps:

[0015] a) Preparation of Aspergillus Aspergillus sp. Fermentation culture of SCSIO 05702;

[0016] b) The fermentation culture was extracted with two times of ethyl acetate and concentrated to obtain a crude extract; the crude extract was subjected to medium-pressure normal phase silica gel column chromatography, and dichloromethane / methanol was gradient eluted from 100:0 to 0:100, and 7 components were obtained in the gradient elution order, and the fraction fr3 eluted with a dichloromethane / methanol volume ratio of 9:1 was collected; the fraction fr3 was subjected to ODS reverse phase column chromatography purification, and methanol / water was gradient eluted from 0:100 to 100:0 to obtain 9 fractions fr3-1 to fr3-9, and the fraction fr3-2 eluted with a methanol / water volume ratio of 20:80-30:70 and the fraction fr3-5 eluted with a methanol / water volume ratio of 45:55-60:40 were collected;

[0017] c) Fraction fr3-2 was purified again by ODS reverse phase column chromatography, with a gradient elution of methanol / water from 0:100 to 100:0, to obtain 8 fractions fr3-2-1 to fr3-2-8, and the fraction fr3-2-4 eluted with a methanol / water volume ratio of 35:65 was collected; the fraction fr3-2-4 was detected at a wavelength of 220 nm, with a flow rate of 2.5 mL / min, and a methanol:water volume ratio of 50:50 was used for semi-preparative high performance liquid separation by isocratic elution, the HPLC column was YMC-pack ODS-A, 10 × 250 mm, 5µm, to obtain 5 fractions fr3-2-4-1 to fr3-2-4-5, and the fraction fr3-2-4-5 with a retention time of 31-35 min was collected; the fraction fr3-2-4-5 was detected at a wavelength of 220 nm, with a flow rate of 2.5 mL / min flow rate, isocratic elution with a methanol:water volume ratio of 60:40, semi-preparative HPLC separation, HPLC column YMC-pack ODS-A, 10 × 250 mm, 5µm, to obtain compounds 1 and 3;

[0018] d) Fraction fr3-5 was purified again by ODS reverse phase column chromatography, with a gradient elution of methanol / water from 0:100 to 100:0, to obtain 7 fractions fr3-5-1 to fr3-5-7, and the fraction fr3-5-4 eluted with a methanol / water volume ratio of 55:45 was collected; the fraction fr3-5-4 was detected at a wavelength of 220 nm, with a flow rate of 2.5 mL / min, and an acetonitrile:acid water volume ratio of 28:72, and semi-preparative high performance liquid separation was performed by isocratic elution, the HPLC column was YMC-pack ODS-A, 10 × 250 mm, 5 µm, to obtain 6 fractions fr3-5-4-1 to fr3-5-4-6, and the fraction fr3-5-4-1 with a retention time of 12-15 min was collected; the fraction fr3-5-4-1 was detected at a wavelength of 220 nm, with a flow rate of 2.5 The semi-preparative high performance liquid separation was carried out by isocratic elution at a flow rate of 50 mL / min with a methanol:acid water volume ratio of 52:48. The HPLC column was YMC-pack ODS-A, 10 × 250 mm, 5µm, to obtain compounds 2 and 4.

[0019] Preferably, the Aspergillus Aspergillus sp. The fermentation culture of SCSIO 05702 is prepared by the following method: activated Aspergillus Aspergillus sp.SCSIO 05702 was inoculated into a seed culture medium, cultured at 24°C, 180 rpm, for 3 days to obtain a seed solution, and the seed solution was inoculated into a fermentation culture medium at an inoculation rate of 5% by volume, and cultured at 24°C for 30 days to obtain a fermentation culture. The formula of the seed culture medium is as follows: per liter of culture medium liquid contains: 15 g malt extract powder, 32 g sea salt, pH 6.5, and the balance is water.

[0020] Advantages of the present invention:

[0021] The inventors of the present invention have used Aspergillus Aspergillus sp. The solid fermentation extract of SCSIO 05702 was separated and purified, and the compounds Spirochrains AD (1-4) were obtained. After structural analysis, compounds 1-4 were all new compounds, and their specific structures are shown in formula (I). Through the evaluation of the anti-respiratory syncytial virus activity of compounds 1-4, it was found that compounds 1-4 can inhibit RSV virus to varying degrees. At the same time, compound 2 with the best inhibition rate and the most relative stability was selected, and IC 50 ( Figure 3 ) and protein chips ( Figure 4 ), the results showed that compound 2 could bind to RSV-G protein, and the equilibrium dissociation constant reached 7.95 nM.

[0022] In the process of studying the secondary metabolites of Antarctic fungi, the present invention isolated a class of novel spirocyclic amide compounds, which can act on the entry stage of RSV virus and inhibit the adsorption of the virus to target cells. This not only provides an ideal lead compound for screening novel, highly effective and low-toxic antiviral drugs, but also has important significance for the development and utilization of microbial resources from extreme environments such as polar regions.

[0023] Aspergillus of the present invention Aspergillus sp. SCSIO 05702 was deposited on January 6, 2015 at the General Microbiology Center of China Microorganism Culture Collection (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. The deposit number is CGMCC No.10279. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 :Spirocyclic amide compounds 1 and 3 are mainly 1 H- 1 H COSY, HMBC information.

[0025] Figure 2 : ECD calculated spectra of spirocyclic amide compounds 1 and 3.

[0026] Figure 3: Cytotoxicity and anti-respiratory syncytial virus activity of spirocyclic amide compound 2.

[0027] Figure 4 : The mechanism of action of spiroamide compound 2 in inhibiting respiratory syncytial virus.

[0028] Figure 5 : Effect of spiroamide compound 2 on RSV-G protein chip. DETAILED DESCRIPTION

[0029] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0030] Example 1: Preparation and structural identification of compounds 1-4

[0031] 1. Preparation of Antarctic Aspergillus Aspergillus sp. Fermentation culture of SCSIO 05702.

[0032] The preparation method for each 1000 mL culture medium (seed culture medium) is: 15 g malt extract powder, 32 g sea salt, then dissolve in an appropriate amount of water, dilute to 1000 mL with water, pH 6.5, sterilize at 121℃ for 20 min, and set aside. The fermentation medium formula is rice (150 g / L), sea salt (32 g / L), sterilize at 121℃ for 20 min, and set aside. Aspergillus sp. SCSIO 05702 (deposit number: CGMCC No. 10279) was inoculated into the above seed culture medium, cultured at 24°C, 180 rpm, for 2 days to obtain seed solution, and the seed solution was inoculated into the fermentation medium at a volume percentage of 5%, and cultured at 24°C for 30 days to obtain Antarctic Aspergillus Aspergillus sp. Static culture fermentation products of SCSIO 05702.

[0033] 2. Isolation and purification of compounds 1-4

[0034] The fermentation culture was extracted with two times of ethyl acetate and concentrated to obtain a crude extract; the crude extract was subjected to medium-pressure normal phase silica gel column chromatography, and dichloromethane / methanol was gradient eluted from a volume ratio of 100:0 to 0:100, and 7 components were obtained in the gradient elution order. The fraction fr3 eluted with a dichloromethane / methanol volume ratio of 9:1 was collected for ODS reverse phase column chromatography purification, and methanol / water was gradient eluted from a volume ratio of 0:100 to 100:0 to obtain 9 fractions fr3-1 to fr3-9; the fraction fr3-2 eluted with a methanol / water volume ratio of 20:80-30:70 was collected and subjected to ODS reverse phase column chromatography purification again, and methanol / water was gradient eluted from a volume ratio of 0:100 to 100:0 to obtain 8 fractions fr3-2-1 to fr3-2-8; the fraction fr3-2-4 eluted with a methanol / water volume ratio of 35:65 was collected and purified by ODS reverse phase column chromatography. The semi-preparative HPLC separation was performed by HPLC (YMC-pack ODS-A, 10 × 250 mm, 5 µm) with methanol: water (50:50, v / v) as isocratic elution at a flow rate of 2.5 mL / min at a wavelength of 220 nm, and by HPLC (YMC-pack ODS-A, 10 × 250 mm, 5 µm) with a retention time of 31-35 min. The fraction fr3-2-4-5 was collected and semi-preparative HPLC separation was performed by HPLC (YMC-pack ODS-A, 10 × 250 mm, 5 µm) with methanol: water (60:40, v / v) as isocratic elution at a flow rate of 2.5 mL / min to obtain compound 1 (3.8 mg, retention time t R 16.5 min) and compound 3 (3.7 mg, retention time t R18.0 min). Fraction fr3-5 eluted with a methanol / water volume ratio of 45:55-60:40 was collected and purified by ODS reverse phase column chromatography again, with a methanol / water volume ratio of 0:100 to 100:0, and 7 fractions fr3-5-1 to fr3-5-7 were obtained; fraction fr3-5-4 eluted with a methanol / water volume ratio of 55:45 was collected and detected at a wavelength of 220 nm, with a flow rate of 2.5 mL / min, and acetonitrile: acid water (0.4‰ formic acid) (28:72, v / v) was used for isocratic elution for semi-preparative high performance liquid separation, HPLC (YMC-pack ODS-A, 10 × 250 mm, 5 µm), and 6 fractions fr3-5-4-1 to fr3-5-4-6 were obtained; fraction fr3-5-4-1 with a retention time of 12-15 min was collected and purified by HPLC (YMC-pack ODS-A, 10 × 250 mm, 5 µm), and 6 fractions fr3-5-4-2 to fr3-5-4-3 were obtained by isocratic elution at 220 nm. The semi-preparative HPLC separation was performed by isocratic elution with methanol: acid water (0.4‰ formic acid) (52:48, v / v) at a flow rate of 2.5 mL / min. HPLC (YMC-pack ODS-A, 10 × 250 mm, 5 µm) was used to obtain compound 2 (15.86 mg, retention time t R 14.0 min) and compound 4 (4.73 mg, retention time t R 26.0 min).

[0035] 3. Structural identification of compounds 1-4

[0036] The obtained spirocyclic amide compounds 1-4 were subjected to nuclear magnetic resonance (NMR), mass spectrometry (MS), circular dichroism (CD) and other data tests to determine the chemical structure of the compounds.

[0037] Structural identification of new compound 1: brown solid, high-resolution mass spectrometry m / z 340.1755 [M + H] + (calcd for 340.1755) The suggested molecular formula is C 17 H 25 NO6 contains 6 degrees of unsaturation. 1 H and 13 C NMR data are shown in Table 1. 13 C NMR combined with DEPT-135 spectrum suggests that its 17 carbon atom signals include: 3 methyl, 1 methylene, 1 sp 3 Hybridized methine, 4 sp 3 Hybridized oxygen-linked methine, 4 sp 2 Hybridized double bond methine, 2 quaternary carbons. 2D NMR spectrum 1H- 1 H COSY( Figure 1 ) confirmed the self-selected coupling systems of CH3-16 / CH-15 / CH-14 / CH-13 / CH-12 / CH-10 and CH-6 / CH-7 / CH2-8 / CH-9. Key related information of HMBC ( Figure 1 ) (H-7 is related to C-5; H-4 is related to C-9; H-12 is related to C-9), and the connection mode of the three rings was further determined. The BC correlation signals of CH3-11 and C-3, C-4, and the BC correlation signals of CH3-18 and C-3 proved the substitution position of the methyl group. Further NOESY, DP4 + Probability analysis and ECD quantum chemical calculations determined that the configuration of compound 1 is 3 R , 4 S , 5 S , 6 R , 7 S , 9 R , 10 S Scifinder search showed that compound 1 was a new structure that had not been reported and was named Spirochrain A.

[0038] Structural identification of new compound 2: brown solid, high-resolution mass spectrometry data and 1D NMR data show that compound 2 differs from compound 1 in molecular formula by only one methyl group, and further 2D NMR data COSY, HSQC, and HMBC spectra also confirm their planar structures. However, compound 2 includes compound 2a and compound 2b, which cannot be separated by any chromatographic column, and the ratio of 2a to 2b is stable at about 2:1. Based on the analysis of biogenic pathway and NOESY, compound 2a and compound 1 have the same 3 R , 4 S , 5 S , 6 R , 7 S , 9 R , 10 S The absolute configuration of compound 2b is different from compound 1 at C-3, namely 3 S , 4 S , 5 S , 6 R , 7 S , 9 R , 10 S . According to Scifinder search, compound 2 is a new structure and is named Spirochrain B.

[0039] The new compound Spirochrain C (3) has the molecular formula C 17 H 25A brown amorphous solid of NO6. A careful comparison of the 1D NMR data of 1 and 3 (Table 1) revealed that they were very similar except for some differences in the chemical shifts of H-5 / H-6 / H-7 / H-10, indicating that 3 is a diastereoisomer of 1. 1 H– 1 Analysis of H COSY, HSQC, and HMBC data ( Figure 1 ) further proved that they have the same planar structure. NOESY analysis showed a correlation between H-6 and H-4 / H3-18, and there was no NOESY correlation between H-6 and H-7 / H-10, which indicated that H-6 was located on the same face of H-4. Since the CD curves of compound 3 and compound 1 are very similar, after comparing the experimental with the calculated ECD ( Figure 2 ) were compared, the absolute configuration of compound 3 was determined to be 3 R , 4 S , 5 S , 6 S , 7 S , 9 R , 10 S . According to Scifinder search, compound 3 is a new structure and is named Spirochrain C.

[0040] Similarly, compound 4, including compound 4a and compound 4b, could not be separated on any chromatographic column. 13 C NMR data confirmed the molecular formula to be C 16 H 23 NO6.4 1 H and 13 The C NMR data are very similar to those of 3 (Table 2), except that one oxygen methyl group is missing ( δ C / H 48.8 / 2.99, C-18) and C-1 / C-3 / C-4 chemical shifts changed. Similar to 2, which appeared as a mixture, 4 was also a C-3 diastereomer, with a stable existence ratio of about 4:1. Scifinder search showed that compound 4 was a new structure, named Spirochrains D.

[0041] Table 1. 1 H and 13 C NMR spectral data of 1and 4in DMSO- d 6

[0042]

[0043] Table 2. NMR spectral data of2a / 2band4a / 4bat 500 MHz and 125 MHz in DMSO- d 6

[0044]

[0045] Example 2: Experimental data on the antiviral activity of spirocyclic amide compounds

[0046] Table 3. Inhibition rate of compounds 1-4 on RSV virus

[0047]

[0048] The inhibitory effects of compounds 1-4 on RSV virus were tested by referring to the in vitro anti-RSV virus effect study method of compound 2 described below. The experimental results (Table 3) show that compounds 1-4 can inhibit RSV virus infection of target cells to varying degrees. Compound 2 with the best inhibition rate and relative stability was selected to continue exploring its IC value against RSV. 50 and mechanism of action. The results showed that ( Figure 3 ) Compound 2 has low cytotoxicity and can inhibit RSV infection in a concentration-dependent manner, and has the potential to be further developed into an anti-RSV small molecule drug. Mechanism study results ( Figure 4-5 ) indicates that compound 2 works by targeting viruses rather than cells, targeting the virus entry stage, inhibiting virus adsorption, and strongly binding to RSV-G protein, affecting the function of viral G protein. The specific implementation is as follows:

[0049] 1. Cytotoxicity study of compound 2

[0050] The toxicity of compound 2 on HEp-2 cells was detected by MTT assay. HEp-2 cells in logarithmic growth phase were cultured at 1×10 5 The cells were inoculated at a density of 100 mL / mL in a 96-well plate, with 100 mL per well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. 100 mL of serum-free DMEM medium with two-fold dilutions of compound 2 (200, 100, 50, 25, 12.5, 6.25, 3.13, 1.56, 0 mM) was added to each well. A blank group without compound 2 was set up, with 3 replicates in each group, and cultured in a cell culture incubator at 37°C and 5% CO2 for 48 h. 20 mL of MTT solution (0.5 mg / mL) was added and cultured in the dark at 37°C for 4 h. The supernatant was discarded, 150 mL of DMSO was added and shaken for 15 min to dissolve the blue-purple formazan, and the absorbance value A at a wavelength of 570 nm was detected using an enzyme reader. The results are shown in Figure 3 As shown, the half cytotoxic concentration (CC50 ) was greater than 200 μM and had less toxicity to HEp-2 cells.

[0051] 2. Study on the anti-RSV effect of compound 2 in vitro

[0052] HEp-2 cells were cultured at 2×10 5 The cells were inoculated at a density of 100 / mL in a 12-well plate, 1 mL per well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. Respiratory syncytial virus HRSV-A-GZ08-0 (MOI = 0.1) was diluted with serum-free DMEM medium, and compound 2 was then diluted twice in the medium containing the virus (50, 25, 12.5, 6.25, 3.13, 1.56 mM). The virus and compound 2 mixture was added to the cells, 1 mL per well, and incubated at 37°C for 1 h. The supernatant was discarded, and compound 2 (50, 25, 12.5, 6.25, 3.13, 1.56 mM) was diluted twice in serum-free DMEM medium, 1 mL per well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. Cellular RNA was extracted using the RNA extraction kit of Chengdu Fuji Biotechnology Co., Ltd., and RNA was reverse transcribed into cDNA according to the instructions of the Takara Prime Script RT kit. The reaction system was RNA 200 ng, 5× Prime Script RT Master Mix 2 μL, and enzyme-free double distilled water was added to a total volume of 10 μL. Reverse transcription was performed on a T100 Thermal Cycler instrument, and the program was 37°C, 15 min; 85°C, 5s; 4°C, ∞. The quantitative polymerase chain reaction (qPCR) system was prepared according to the instructions of Vazyme SYBR green qPCR Master Mix, 2×qPCR Master Mix 5 μL, 0.4 μL of upstream and downstream primers, 1 μL of cDNA, and enzyme-free double distilled water was added to a total volume of 10 μL. qPCR reaction was performed on a real-time Applied Biosystems StepOne real-time fluorescence quantitative PCR instrument, and the reaction conditions were 95°C, 30 s, 1 cycle; 95°C, 5 s, 60°C, 10 s, 40 cycles. The primer sequence of RSV N gene was 5'CTCAATTTCCTCACTTCTC3' upstream and 5'CCTCTGTATTCTCCCATT3' downstream. The primer sequence of GAPDH gene was 5'AGGGCAATGCCAGCCCCAGCA3' upstream and 5'AGGCGTCGGAGGGCCCCCTC3' downstream. Three replicate wells were set for each sample, and GAPDH was used as an internal reference to detect RSV virus N gene expression.-ΔΔCt Calculate. The result is Figure 3 As shown in Figure 2, compound 2 inhibited RSV viral activity in a concentration-dependent manner, with a median effective concentration (IC 50 ) was 11.13±4.90 μM. Ribavirin was used as the positive control. The IC 50 6.49±0.94 μM( Figure 3 The therapeutic index (SI) of compound 2 is greater than 17.97, and it can be used as a safe and effective lead compound against respiratory syncytial virus.

[0053] 3. Study on the in vitro anti-RSV mechanism of compound 2

[0054] (1) Experiments with different administration methods

[0055] HEp-2 cells were cultured at 2×10 5 The cells were inoculated at a density of 100 / mL in a 12-well plate, 1 mL per well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. A blank group without RSV and compound treatment was set up, and a virus group inoculated with RSV alone was set up, with three replicates in each group. GAPDH was used as the internal reference gene, and the expression of the RSV virus N gene was detected by qRT-PCR. The cells were treated according to the following dosing method:

[0056] a. Compound pretreatment of cells: HEp-2 cells were pre-incubated with compound 2 (20 μM) at 37°C for 2 h. The supernatant was discarded, and 1 mL of serum-free DMEM medium diluted with RSV virus (MOI = 0.1) was added to each well and incubated at 37°C for 1 h. The virus solution was discarded, and 1 mL of serum-free DMEM medium was added to each well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h.

[0057] b. Compound pretreatment of virus: Compound 2 (20 μM) and RSV virus (MOI = 0.1) were diluted in serum-free DMEM medium, and the compound and RSV mixture was incubated at 37°C for 2 h. The mixture was added to HEp-2 cells, 1 mL per well, and incubated at 37°C for 1 h. The supernatant was discarded, and 1 mL of serum-free DMEM medium was added to each well, and cultured in a cell culture incubator at 37°C, 5% CO2 for 24 h.

[0058] c. Compound and virus co-treatment of cells: Compound 2 (20 μM) and RSV virus (MOI = 0.1) were diluted in serum-free DMEM medium, and the compound and RSV mixture was directly added to HEp-2 cells, 1 mL per well, and incubated at 37°C for 1 h. The supernatant was discarded, and 1 mL of serum-free DMEM medium was added to each well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h.

[0059] d. Compound treatment after virus infection: HEp-2 cells were infected with RSV virus (MOI = 0.1) at 37°C for 1 h, the supernatant was discarded, and serum-free DMEM medium containing compound 2 (20 μM) was added (1 mL per well) and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h.

[0060] e. Full treatment: Compound 2 (20 μM) and RSV virus (MOI = 0.1) were diluted with serum-free DMEM medium, and the compound and RSV mixture was incubated at 37°C for 2 h. At the same time, HEp-2 cells were pre-incubated with compound 2 (20 μM) for 2 h at 37°C, 1 mL per well. After 2 h, the supernatant was removed, and the compound and RSV mixture that had been pre-incubated for 2 h was added to the HEp-2 cells, 1 mL per well, and incubated at 37°C for 1 h. The supernatant was discarded, and 1 mL of serum-free DMEM medium containing compound 2 (20 μM) was added to each well, and cultured in a cell culture incubator at 37°C, 5% CO2 for 24 h.

[0061] (2) Time point experiment

[0062] HEp-2 cells were cultured at 2×10 5 The density of cells / mL was inoculated in a 12-well plate, 1 mL per well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. Respiratory syncytial virus HRSV-A-GZ08-0 (MOI = 0.1) was diluted with serum-free DMEM medium, 1 mL per well was added to HEp-2 cells, and incubated at 37°C for 1 h. The virus solution was removed, and compound 2 (20 μM) was treated at 0, 1, 2, 4, 8, and 12 h after incubation of the virus, 1 mL per well. Cell RNA was extracted using the RNA extraction kit of Chengdu Fuji Biotechnology Co., Ltd. 24 h after infection. A blank group without compound and RSV was set up, and a virus group inoculated with RSV alone was set up, with three replicates in each group. GAPDH was used as the internal reference gene, and the expression of RSV virus N gene was detected by qRT-PCR.

[0063] (3) Anti-adsorption test

[0064] HEp-2 cells were cultured at 2×105 The cells were inoculated with a density of 1 mL / mL in a 12-well plate, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. Respiratory syncytial virus HRSV-A-GZ08-0 (MOI=0.1) was diluted with serum-free DMEM medium, and compound 2 (20, 10, 5 μM) was then diluted twice with virus-containing medium. The mixture of virus and compound 2 was added to the cells, 1 mL per well, and the cells were inoculated at 4°C for 2 h. The supernatant was discarded and washed twice with pre-cooled PBS. 1 mL of serum-free DMEM medium was added to each well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. A blank group without compound and RSV was set up, and a virus group inoculated with RSV alone was set up, with three replicates in each group. After 24 h, the RNA extraction kit of Chengdu Fuji Biotechnology Co., Ltd. was used to extract cellular RNA, and GAPDH was used as the internal reference gene. The expression of RSV virus N gene was detected by qRT-PCR.

[0065] (4) Anti-penetration test

[0066] HEp-2 cells were cultured at 2×10 5 The cells were inoculated with a density of 100 / mL in a 12-well plate, 1 mL per well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. Respiratory syncytial virus HRSV-A-GZ08-0 (MOI=0.1) was diluted with serum-free DMEM medium, and the virus was added to the cells, 1 mL per well, and inoculated at 4°C for 2 h. The supernatant was discarded, and compound 2 (20, 10, 5 mM) was diluted twice with serum-free DMEM medium, 1 mL per well, and cultured at 37°C for 2 h. The supernatant was discarded, and 1 mL of serum-free DMEM medium was added to each well, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. A blank group without compound and RSV was set up, and a virus group inoculated with RSV alone was set up, with three replicates in each group. After 24 h, the RNA extraction kit of Chengdu Fuji Biotechnology Co., Ltd. was used to extract cellular RNA, and GAPDH was used as the internal reference gene. The expression of RSV virus N gene was detected by qRT-PCR.

[0067] like Figure 4 , the results of different administration methods ( Figure 4 A) shows that compound 2 pre-incubated cells cannot inhibit the expression of the viral N gene, indicating that compound 2 does not act on target cells and does not affect host factors to exert antiviral effects. Compound 2 can effectively inhibit RSV N gene expression after contact with the virus, indicating that compound 2 may exert its effect by affecting the entry of the virus into cells. Time point experimental results ( Figure 4B) shows that compound 2 can inhibit RSV N gene expression after 0 h and 1 h, but compound 2 treatment after 2 h has no inhibitory effect, indicating that compound 2 acts on the stage of virus entry, such as adsorption and penetration. At 4°C, the virus will only adsorb on the cell surface without subsequent endocytosis. Compound 2 and RSV virus co-incubated HEp-2 cells at 4°C can inhibit viral N gene expression in a concentration-dependent manner, indicating that compound 2 inhibits RSV adsorption ( Figure 4 C in the figure). Subsequently, a penetration test was performed to explore whether compound 2 has an inhibitory effect on the process of virus entry into cells after adsorption. The results showed that ( Figure 4 Compound 2 does not inhibit RSV virus penetration into cells.

[0068] 4. Binding of Compound 2 to RSV G protein

[0069] RSV G protein was spotted and fixed on an activated 3D Dextran chip (PLEXERA, C-Pn-010 protein coupling chip), PBS was used as the buffer, and compound 2 with a concentration gradient (200, 100, 50, 25, 12.5 and 6.25 μM) was diluted with PBS buffer and added to the buffer at a flow rate of 2 μL per second. The contact time was 300 s, the dissociation time was 300 s, and the chip was regenerated with glycine-hydrochloric acid (pH=2). The data was analyzed using a biomolecular interaction instrument (PlexArray HT A100). The data were exported using PlexArrayDE analysis software and fitted and analyzed using BIA evolution to calculate the equilibrium dissociation constant (KD). The G protein and F protein on the surface of RSV mediate the adsorption and membrane fusion processes of the virus, respectively. Based on the previous results, compound 2 may inhibit the virus adsorption process. Therefore, SPR technology was used to explore whether the G protein that mediates the adsorption process and compound 2 have a binding effect, and whether compound 2 prevents virus adsorption by interfering with the function of the viral G protein. The results are shown in Figure 2. Figure 5 As shown, compound 2 has a strong binding to RSV-G protein, and the equilibrium dissociation constant (KD) is 7.95nM, indicating that compound 2 can interfere with the function of RSV G protein and inhibit virus adsorption.

Claims

1. Spirocyclic amide compounds, whose structure is as shown in compound 1 or 2 in formula (I): Formula (I); Compound 2 includes Compound 2a and Compound 2b.

2. Use of the spirocyclic amide compound according to claim 1 in the preparation of anti-respiratory syncytial virus drugs.

3. The use according to claim 2, characterized in that: The spirocyclic amide compound is compound 2.

4. The use according to claim 2, characterized in that: The drug inhibits the adsorption of respiratory syncytial virus to target cells.

5. The use according to claim 2 or 3, characterized in that: The respiratory syncytial virus is HRSV-A-GZ08-0.

6. Aspergillus Aspergillus sp. Use of SCSIO 05702 in the preparation of the spirocyclic amide compound according to claim 1, wherein the Aspergillus Aspergillus sp. The accession number of SCSIO 05702 is: CGMCC No.10279.

7. A method for preparing the spirocyclic amide compound according to claim 1, characterized in that: The following steps are involved: a) Preparation of Aspergillus Aspergillus sp. Fermentation culture of SCSIO 05702, said Aspergillus Aspergillus sp. The deposit number of SCSIO 05702 is: CGMCC No.10279; b) The fermentation culture was extracted with two times of ethyl acetate and concentrated to obtain a crude extract; the crude extract was subjected to medium-pressure normal phase silica gel column chromatography, and dichloromethane / methanol was gradient eluted from 100:0 to 0:100, and 7 components were obtained in the gradient elution order, and the fraction fr3 eluted with a dichloromethane / methanol volume ratio of 9:1 was collected; the fraction fr3 was purified by ODS reverse phase column chromatography, and methanol / water was gradient eluted from 0:100 to 100:0 to obtain 9 fractions fr3-1−fr3-9, and the fraction fr3-2 eluted with a methanol / water volume ratio of 20:80-30:70 and the fraction fr3-5 eluted with a methanol / water volume ratio of 45:55-60:40 were collected; c) Fraction fr3-2 was purified again by ODS reverse phase column chromatography, with a gradient elution of methanol / water from 0:100 to 100:0, to obtain 8 fractions fr3-2-1−fr3-2-8, and the fraction fr3-2-4 eluted with a methanol / water volume ratio of 35:65 was collected; the fraction fr3-2-4 was detected at a wavelength of 220 nm, with a flow rate of 2.5 mL / min, and a methanol:water volume ratio of 50:50 was used for semi-preparative high performance liquid separation by isocratic elution, the HPLC column was YMC-pack ODS-A, 10 × 250 mm, 5µm, to obtain 5 fractions fr3-2-4-1−fr3-2-4-5, and the fraction fr3-2-4-5 with a retention time of 31-35 min was collected; the fraction fr3-2-4-5 was detected at a wavelength of 220 nm, with a flow rate of 2.5 mL / min flow rate, isocratic elution with a methanol:water volume ratio of 60:40 was used for semi-preparative HPLC separation, and the HPLC column was YMC-pack ODS-A, 10 × 250 mm, 5µm to obtain compound 1; d) Fraction fr3-5 was purified again by ODS reverse phase column chromatography, with a gradient elution of methanol / water from 0:100 to 100:0, to obtain 7 fractions fr3-5-1−fr3-5-7, and the fraction fr3-5-4 eluted with a methanol / water volume ratio of 55:45 was collected; the fraction fr3-5-4 was detected at a wavelength of 220 nm, with a flow rate of 2.5 mL / min, and an acetonitrile:acid water volume ratio of 28:72, and semi-preparative high performance liquid phase separation was performed by isocratic elution, the HPLC column was YMC-pack ODS-A, 10 × 250 mm, 5 µm, to obtain 6 fractions fr3-5-4-1−fr3-5-4-6, and the fraction fr3-5-4-1 with a retention time of 12-15 min was collected; the fraction fr3-5-4-1 was detected at a wavelength of 220 nm, with a flow rate of 2.5 The semi-preparative HPLC separation was performed by isocratic elution at a flow rate of mL / min with a methanol:acid water volume ratio of 52:

48. The HPLC column was YMC-pack ODS-A, 10 × 250 mm, 5 µm, to obtain compound 2; Aspergillus Aspergillus sp. The fermentation culture of SCSIO 05702 is prepared by the following method: activated Aspergillus Aspergillus sp. SCSIO 05702 was inoculated into a seed culture medium, cultured at 24°C, 180 rpm, for 3 days to obtain a seed solution, and the seed solution was inoculated into a fermentation culture medium at an inoculation rate of 5% by volume, and cultured at 24°C for 30 days to obtain a fermentation culture. The formula of the seed culture medium is as follows: 15 g malt extract powder, 32 g sea salt, pH 6.5, and the balance is water per liter of culture medium liquid; the formula of the fermentation culture medium is as follows: 150 g / L rice, 32 g / L sea salt, and the balance is water.

Images