Application of FOLR3 gene as a molecular marker for osteoporosis
Through kits and inhibitors to detect FOLR3 gene expression levels, the difficulties in diagnosis and treatment of osteoporosis were solved, rapid, accurate diagnosis and effective treatment of osteoporosis were achieved, and the bone marrow mesenchymal stem cells were significantly improved. Proliferation and osteogenesis capacity.
Patent Information
- Application Number
- CN202411333863.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-24
- Publication Date
- 2024-12-13
- Estimated Expiration
- 2044-09-24
AI Technical Summary
The prior art is unable to diagnose osteoporosis efficiently and in real time, and the lack of effective molecular markers leads to missed patients during the optimal prevention and treatment period.
The FOLR3 gene was used as a molecular marker of osteoporosis, and the diagnosis was carried out by a kit for detecting the expression level of FOLR3 gene, and the FOLR3 gene inhibitor was developed as a therapeutic drug. Real-time fluorescence quantitative PCR and specific amplification primers were used for detection, targeting Serum samples from patients with osteoporosis were analyzed.
It was found that the FOLR3 gene was significantly expressed in the serum of osteoporosis patients, providing a rapid and accurate diagnosis method, and by inhibiting the FOLR3 gene, it improved the proliferation and osteogenesis ability of bone marrow mesenchymal stem cells, significantly improving the treatment of osteoporosis potential.
Smart Images
Figure CN118853872B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to application of FOLR3 gene as a molecular marker for osteoporosis, and belongs to the technical field of biomedicine. Background Art
[0002] Osteoporosis is a chronic systemic bone disease characterized by decreased bone mass, increased bone brittleness, and changes in bone microstructure. Patients usually experience thinning of the bone cortex, decreased number of trabeculae, damaged bone microstructure, and decreased bone mineralization. With the increasing aging of the world, the incidence of osteoporosis is increasing year by year.
[0003] Usually, when patients are diagnosed, the best period for prevention and treatment has been missed. At present, osteoporosis is usually diagnosed by testing the patient's bone density in clinical practice. However, this method has disadvantages such as high cost and inconvenience, and cannot diagnose osteoporosis efficiently and in real time. Therefore, there is an urgent need to find a molecular marker for the rapid, effective and accurate diagnosis of osteoporosis in clinical practice.
[0004] Folate receptor gamma (FOLR3), also known as FR-G, FRgamma, FR-gamma or gamma-hFR, encodes a member of the folate receptor (FOLR) protein family. It has a high affinity for folic acid and several reduced folic acid derivatives, and mediates the delivery of 5-methyltetrahydrofolate to the cell interior. This gene is highly expressed in ovarian cancer and primary peritoneal cancer. At present, there are few reports on FOLR3, and its research on the pathogenesis, disease diagnosis and treatment of osteoporosis is still very lacking. Therefore, it is necessary to explore the role of the FOLR3 gene in the pathogenesis, disease diagnosis and treatment of osteoporosis, and at the same time provide an experimental basis and research direction for subsequent in-depth research. Summary of the invention
[0005] In view of the deficiencies of the prior art, the present invention provides the use of FOLR3 gene as a molecular marker for osteoporosis.
[0006] The technical solution of the present invention is as follows:
[0007] The application of FOLR3 gene as a molecular marker for osteoporosis includes the application of a detection reagent for FOLR3 gene in the preparation of an osteoporosis diagnostic product or the application of an inhibitor of FOLR3 gene in the preparation of a drug for treating osteoporosis.
[0008] The invention relates to the use of a reagent for detecting the expression level of the FOLR3 gene in the preparation of a product for diagnosing osteoporosis, wherein the nucleotide sequence of the FOLR3 gene is shown in SEQ ID NO.1.
[0009] Preferably according to the present invention, the detection reagent of the FOLR3 gene comprises a real-time fluorescence quantitative PCR detection reagent and a primer pair for specifically amplifying the FOLR3 gene.
[0010] Preferably according to the present invention, the real-time fluorescence quantitative PCR detection reagent includes a fluorescent dye and a real-time fluorescence quantitative PCR reaction solution; the real-time fluorescence quantitative PCR reaction solution includes deoxynucleoside triphosphates (dNTPs), MgCl2, TaqDNA polymerase and buffer, and the fluorescent dye is a green fluorescent nucleic acid stain (SYBR).
[0011] Preferably, according to the present invention, the primer pair for specific amplification of FOLR3 is an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3;
[0012] Upstream primer: 5′- CGCAAAGAGCGCATTCTGAAC -3′ (SEQ ID NO. 2),
[0013] Downstream primer: 5′-CTGGGCTGAGTCAAACCACA -3′ (SEQ ID NO. 3).
[0014] Preferably according to the present invention, the test sample of the osteoporosis diagnostic product is selected from serum, plasma or whole blood.
[0015] An osteoporosis diagnostic kit comprises a reagent for detecting the expression level of FOLR3 gene.
[0016] The invention relates to the use of an inhibitor of the FOLR3 gene in the preparation of a drug for treating osteoporosis, wherein the nucleotide sequence of the FOLR3 gene is shown in SEQ ID NO.1.
[0017] Preferably according to the present invention, the FOLR3 gene inhibitor is a gene inhibitor and / or a chemical inhibitor that inhibits the expression of the FOLR3 gene.
[0018] Further preferably, the gene inhibitor is FOLR3 gene knockout lentivirus sh-FOLR3, and the FOLR3 gene knockout lentivirus sh-FOLR3 is double-stranded, and its nucleotide sequence is shown in SEQ ID NO.6~7 or SEQ ID NO.8~9.
[0019] A drug for treating osteoporosis, comprising an inhibitor of the FOLR3 gene.
[0020] Beneficial effects:
[0021] 1. The present invention first discovered that the FOLR3 gene is significantly highly expressed in the serum of osteoporosis patients, which indicates that the FOLR3 gene can be used as a molecular marker for diagnosing osteoporosis. The present invention also provides the use of a reagent for detecting the expression level of the FOLR3 gene in the preparation of an osteoporosis diagnostic product, mainly using the FOLR3 gene as a detection marker to prepare a corresponding fluorescent quantitative PCR detection kit for diagnosing osteoporosis. In addition, overexpression of the FOLR3 gene inhibits the proliferation and osteogenesis of human bone marrow mesenchymal stem cells (BMSCs), while knocking down FOLR3 can significantly improve the proliferation and osteogenesis of human bone marrow mesenchymal stem cells (BMSCs), indicating that the inhibitor of the FOLR3 gene can be used to prepare drugs for the treatment of osteoporosis, which is of great significance in the research and development of drugs for the treatment of osteoporosis.
[0022] 2. The present invention designs a primer pair for specific amplification of the FOLR3 gene, which can specifically and effectively detect the expression of FOLR3. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 This is a statistical chart showing the difference in expression levels of FOLR3 gene in the serum of normal people and osteoporosis patients.
[0024] Figure 2 This is the specificity and sensitivity analysis result of FOLR3 gene expression level in the diagnosis of osteoporosis.
[0025] Figure 3 This is a graph showing the results of overexpression of FOLR3 gene inhibiting the proliferation and osteogenic capacity of human bone marrow mesenchymal stem cells (BMSCs);
[0026] In the figure, A is the statistical result of CCK8 experiment, and B is the result of Alizarin red staining.
[0027] Figure 4 This is the result of knocking down the FOLR3 gene to improve the proliferation and osteogenic capacity of human bone marrow mesenchymal stem cells (BMSCs);
[0028] In the figure, A is the statistical result of CCK8 experiment, and B is the result of Alizarin red staining. DETAILED DESCRIPTION
[0029] The technical solution of the present invention is further described below in conjunction with the embodiments, but the protection scope of the present invention is not limited thereto. The reagents and materials involved in the embodiments are all common commercially available products unless otherwise specified.
[0030] The human bone marrow mesenchymal stem cells (BMSCs) used in the examples were purchased from China Saiye Biotechnology Co., Ltd.
[0031] The FOLR3 gene overexpression lentivirus (OE-FOLR3) and negative control (OE-NC) used in the examples were artificially synthesized by Shanghai GenePharma Company, China according to the sequence information.
[0032] The FOLR3 gene knockout lentivirus (sh-FOLR3#1 and sh-FOLR3#2) and negative control (sh-NC) used in the examples were artificially synthesized by Shanghai GenePharma Company, China according to the sequence information.
[0033] The collection and testing of whole blood samples from osteoporosis patients and normal volunteers used in the examples were approved by the Medical Ethics Committee of Qilu Hospital of Shandong University, and the collection of all clinical samples obtained the informed consent of the patients.
[0034] Example 1
[0035] After extensive research, the present invention found that the FOLR3 gene as shown in SEQ ID NO.1 is abnormally highly expressed in the osteoporosis environment, and is related to the proliferation ability and osteogenesis ability of human BMSCs. It is speculated that it may be used as a marker for the diagnosis of osteoporosis, and its inhibitor can be used as a drug for the treatment of osteoporosis.
[0036] Next, the expression level of FOLR3 gene in the serum of osteoporosis patients was detected by real-time fluorescence quantitative PCR for verification.
[0037] The specific implementation process is as follows:
[0038] (1) Whole blood was collected from clinical osteoporosis patients (n=12) and normal volunteers (n=12), and two groups of serum samples were obtained by centrifugation;
[0039] (2) Extraction of total RNA: Total RNA was extracted from the serum of the two groups of patients using the TRIzol kit (Invitrogen, USA). The extraction method was strictly carried out according to the steps described in the kit instructions. The concentration and purity of RNA were detected using NanoDrop2000.
[0040] (3) Real-time quantitative PCR: Reverse transcription was performed using a reverse transcription kit (ABI, USA) to synthesize cDNA. The specific method was carried out according to the steps in the kit instructions. Power SYBR™ Green PCR premix (Thermo Fisher Scientific) and specific primers such as SEQ ID NO. 2 and SEQ ID NO. 3 were used for fluorescence quantitative PCR, with 18S as the internal reference and 2 -ΔΔCTMethods The relative expression levels of FOLR3 gene in the serum of osteoporosis group (OP group) and control group (CTL group) were calculated. Figure 1 shown.
[0041] The nucleotide sequences of the primer pairs are as follows:
[0042] Upstream primer: 5′- CGCAAAGAGCGCATTCTGAAC -3′ (SEQ ID NO. 2),
[0043] Downstream primer: 5′-CTGGGCTGAGTCAAACCACA -3′ (SEQ ID NO. 3).
[0044] The reverse transcription PCR system and the real-time fluorescence quantitative PCR system are established according to the kits.
[0045] Reverse transcription PCR program: 95°C for 10 minutes; 37°C for 1 hour, 85°C for 5 minutes, 2 cycles; cool to 4°C.
[0046] Real-time fluorescence quantitative PCR program: 95°C for 10 min; denaturation at 95°C for 30 s, annealing at 60°C for 60 s, and extension at 72°C for 60 s, for a total of 40 cycles; 72°C for 5 min.
[0047] The present invention first found that compared with the control group (CTL), the expression level of FOLR3 gene in the serum of patients with osteoporosis (OP group) was significantly increased, and the difference was statistically significant (such as Figure 1 ). This indicates that the FOLR3 gene is significantly overexpressed in the serum of osteoporosis patients.
[0048] Example 2
[0049] High-throughput sequencing data of FOLR3 gene expression level in osteoporosis were obtained from the GEO database (GSE56815). The receiver operating characteristic curve (ROC) was used to evaluate the specificity and sensitivity of FOLR3 gene expression level in the diagnosis of osteoporosis. The test results are shown in Figure 2. Figure 2 shown.
[0050] Depend on Figure 2 It can be seen that the area under the ROC curve (AUC) is 0.718 (CI: 0.604-0.831). When the Youden index is the largest, its specificity is 65% and its sensitivity is 77.5%, which indicates that the expression level of the FOLR3 gene has a good efficacy in the clinical diagnosis of osteoporosis.
[0051] Example 3
[0052] Verification of the inhibition of human BMSCs proliferation and osteogenic capacity by overexpression of FOLR3 gene, wherein both FOLR3 overexpression lentivirus (OE-FOLR3) and negative control (OE-NC) are double-stranded, the OE-FOLR3 sequence is shown in SEQ ID NO.4~5, and OE-NC is an existing publicly available sequence.
[0053] The specific implementation process is as follows:
[0054] (1) Using Lipofectamine 2000 (Invitrogen, USA), FOLR3 overexpression lentivirus (OE-FOLR3) and negative control (OE-NC) were transfected into human BMSCs, respectively. 48 hours after transfection, human BMSCs overexpressing FOLR3 gene and negative control human BMSCs were constructed for subsequent experiments. The specific transfection process was carried out according to the instructions of Lipofectamine 2000 reagent.
[0055] (2) Proliferation capacity assay: Human BMSCs overexpressing FOLR3 and negative control human BMSCs were cultured at 5×10 3 The cells were inoculated at a density of 100 μg / mL in a 96-well plate and cultured with DMEM (Hyclone, USA). 10 μL of CCK-8 solution was added to each well and incubated at 37°C for 1 h. The absorbance (OD) value at a wavelength of 450 nm was detected using an ELISA reader (TECAN, Switzerland). The results are shown in Table 1. Figure 3 As shown in A;
[0056] (3) Determination of osteogenic capacity: The human BMSCs overexpressing the FOLR3 gene and the negative control human BMSCs were rinsed with PBS buffer for three times, and the cells were fixed with 4% paraformaldehyde for 10 min at room temperature. The human BMSCs overexpressing the FOLR3 gene and the negative control human BMSCs were rinsed with PBS buffer for three times, and then stained with 2% Alizarin red staining solution for 15 min. Finally, the human BMSCs overexpressing the FOLR3 gene and the negative control human BMSCs were rinsed with PBS buffer for three times, and the cells were observed under an optical microscope and photographed. The results are shown in the figure. Figure 3 As shown in B.
[0057] Depend on Figure 3 The CCK8 experimental results in A show that compared with the negative control, overexpression of the FOLR3 gene can significantly reduce the proliferation ability of human BMSCs.
[0058] Depend on Figure 3The Alizarin red staining results of B in Figure 3 show that compared with the negative control, overexpression of the FOLR3 gene can significantly inhibit the osteogenic ability of human BMSCs.
[0059] Example 4
[0060] Validation of knocking down the expression level of FOLR3 gene to improve the proliferation and osteogenic ability of human BMSCs, wherein the FOLR3 gene knockdown virus (sh-FOLR3#1 and sh-FOLR3#2) and the negative control (sh-NC) are both double-stranded, the sh-FOLR3#1 sequence is shown in SEQ ID NO.6~7, the sh-FOLR3#2 sequence is shown in SEQ ID NO.8~9, and sh-NC is an existing publicly available sequence.
[0061] The specific implementation process is as follows:
[0062] (1) Using Lipofectamine 2000 (Invitrogen, USA) reagent, FOLR3 knockdown lentivirus (sh-FOLR3#1 and sh-FOLR3#2) and negative control (sh-NC) were transfected into human BMSCs, respectively. 48 hours after transfection, human BMSCs with knockdown of FOLR3 gene expression and negative control human BMSCs were constructed for subsequent experiments. The specific transfection process was carried out according to the instructions of Lipofectamine 2000 reagent;
[0063] (2) Proliferation capacity assay: Human BMSCs with knockdown of FOLR3 gene expression and negative control human BMSCs were cultured at 5×10 3 The cells were inoculated at a density of 100 μg / mL in a 96-well plate and cultured with DMEM (Hyclone, USA). 10 μL of CCK-8 solution was added to each well and incubated at 37°C for 1 h. The absorbance (OD) value at a wavelength of 450 nm was detected using an ELISA reader (TECAN, Switzerland). The results are shown in Table 1. Figure 4 As shown in A;
[0064] (3) Osteogenic capacity determination: The human BMSCs with knockdown FOLR3 gene expression and the negative control human BMSCs were rinsed with PBS buffer for 3 times, fixed with 4% paraformaldehyde at room temperature for 10 min, rinsed with PBS buffer for 3 times, stained with 2% Alizarin red staining solution for 15 min, and finally rinsed with PBS buffer for 3 times. The cells were observed under an optical microscope and photographed. The results are shown in Table 2. Figure 4 As shown in B.
[0065] Depend on Figure 4 The CCK8 experimental results in Figure A show that compared with the negative control, knocking down the expression level of the FOLR3 gene can significantly improve the proliferation ability of human BMSCs.
[0066] Depend on Figure 4 The Alizarin red staining results of B in Figure 3 show that, compared with the negative control, knocking down the expression level of FOLR3 gene can significantly improve the osteogenic ability of human BMSCs.
[0067] The above-described embodiments are only preferred specific implementation schemes of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.
Claims
1. Use of an inhibitor of the FOLR3 gene in the preparation of a drug for treating osteoporosis, characterized in that: The nucleotide sequence of the FOLR3 gene is shown in SEQ ID NO.1; the inhibitor of the FOLR3 gene is the FOLR3 gene knockout virus sh-FOLR3, the FOLR3 gene knockout virus sh-FOLR3 is double-stranded, and the nucleotide sequence is shown in SEQ ID NO.6~7 or SEQ ID NO.8~9.