Application of wheat TaHAKAI gene in regulating resistance to wheat yellow mosaic virus

Abstract

The present invention discloses the application of wheat TaHAKAI gene in regulating wheat yellow mosaic disease resistance, belongs to the technical field of plant genetic engineering, provides the application of wheat TaHAKAI gene in regulating wheat yellow mosaic disease resistance, and the nucleotide sequence of the wheat TaHA KAI gene is shown in SEQ ID NO.1. The application of the wheat TaHAKAI gene provided in regulating wheat resistance to wheat yellow mosaic virus, the regulation of wheat resistance to wheat yellow mosaic virus is through overexpression of wheat TaHAK AI gene, inhibiting the reproduction of wheat yellow mosaic virus. The present invention finds that overexpression of wheat TaHAKAI gene is by inhibiting the reproduction of wheat yellow mosaic virus, thereby improving wheat resistance to yellow mosaic disease, and indicates that TaHAKAI may increase the yield by increasing the length of wheat spikes and the number of spikelets, which is expected to open up a new path for wheat disease prevention and control and agricultural production efficiency improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the application of wheat TaHAKAI gene in regulating wheat yellow mosaic disease resistance. Background Art

[0002] Wheat yellow mosaic disease occurs in winter wheat areas across the country and causes serious damage. This disease usually shows symptoms after wheat turns green in spring. When the disease first occurs, chlorotic spindle-shaped spots appear on wheat leaves, and old diseased leaves gradually turn yellow and dry up. Severely diseased plants are obviously dwarfed, shrunken, and have fewer tillers, and rarely form ears, resulting in serious reductions in production and income. According to recent surveys, the disease rate in diseased fields is an average of 8%, and the disease in most diseased plots shows spot symptoms, and in some plots, the disease has spread throughout the entire field.

[0003] The incidence of wheat yellow mosaic is affected by many factors, including meteorological factors, sowing period, host resistance, continuous cropping, and fertilizer and water conditions. The temperature suitable for virus infection is about 15°C. After the early-sown wheat seedlings emerge, if the soil temperature is above 10°C for more than 10 days, it is conducive to the reproduction and infection of the virus vector and accelerates the spread of the disease. There are significant differences in resistance and susceptibility to wheat yellow mosaic between varieties. Planting disease-resistant varieties is the most effective measure to control wheat yellow mosaic. Crop rotation is also an effective way to reduce the disease, because the pathogen has a single host, and changing to non-host crops such as rapeseed or broad beans can significantly reduce the disease.

[0004] In addition, wheat yellow mosaic disease is mainly spread through diseased soil, diseased root residues and water flowing through diseased fields, not through seeds or insects. The transmission medium is a cereal polymyxozoite that lives in the soil. Now is the period when wheat is turning green and starting to grow, which is the period when the symptoms of wheat yellow mosaic disease are obvious. Many people lack knowledge about this disease and blindly carry out prevention and control, which increases costs and fails to achieve the prevention and control effect. Countermeasures include promoting disease-resistant and disease-tolerant high-yield varieties, strengthening comprehensive agricultural cultivation management, and timely topdressing and supplementing nutrition for diseased fields.

[0005] In summary, wheat yellow mosaic disease is common in winter wheat areas across the country, causing serious impact on wheat production. Screening of better disease-resistant wheat varieties is an effective prevention and control strategy. Summary of the invention

[0006] In order to solve the above technical problems, the present invention proposes the application of wheat TaHAKAI gene in regulating wheat yellow mosaic virus resistance. By overexpressing wheat TaHAKAI gene, the reproduction of wheat yellow mosaic virus is inhibited and the resistance to wheat yellow mosaic virus is improved.

[0007] To achieve the above object, the present invention provides the use of wheat TaHAKAI gene in regulating wheat yellow mosaic disease resistance, the nucleotide sequence of the wheat TaHAKAI gene is shown in SEQ ID NO.1.

[0008] Preferably, the regulation of wheat yellow mosaic disease resistance is carried out by overexpressing the wheat TaHAKAI gene, thereby inhibiting the reproduction of wheat yellow mosaic virus and improving wheat yellow mosaic disease resistance.

[0009] The present invention also provides a recombinant expression vector, which overexpresses the wheat TaHAKAI gene.

[0010] The present invention also provides an application of the recombinant expression vector in regulating wheat yellow mosaic disease resistance. The regulation of wheat yellow mosaic disease resistance inhibits the reproduction of wheat yellow mosaic virus and improves wheat yellow mosaic disease resistance by overexpressing the wheat TaHAKAI gene.

[0011] The present invention also provides a recombinant strain, which comprises the recombinant expression vector.

[0012] The present invention also provides an application of the recombinant strain in regulating wheat yellow mosaic disease resistance, wherein the regulation of wheat yellow mosaic disease resistance is through overexpression of wheat TaHAKAI gene, thereby inhibiting the reproduction of wheat yellow mosaic virus and improving wheat yellow mosaic disease resistance.

[0013] The present invention also provides an application of the wheat TaHAKAI gene in regulating wheat resistance to wheat yellow mosaic virus (Wheat Yellow Mosaic Virus). The regulation of wheat resistance to wheat yellow mosaic virus is achieved by overexpressing the wheat TaHAKAI gene to inhibit the reproduction of wheat yellow mosaic virus.

[0014] The present invention also provides a method for improving resistance to wheat yellow mosaic disease, and the resistance to wheat yellow mosaic disease is improved by overexpressing the wheat TaHAKAI gene.

[0015] The present invention also provides application of the wheat TaHAKAI gene in improving wheat yield.

[0016] Preferably, the wheat yield is increased by overexpressing the wheat TaHAKAI gene, thereby increasing the wheat spike length and the number of spikelets, thereby increasing the wheat yield.

[0017] Compared with the prior art, the present invention has the following advantages and technical effects:

[0018] The present invention overexpresses the TaHAKAI gene in wheat, thereby improving the resistance of wheat to wheat yellow mosaic disease. Wheat yellow mosaic virus, as one of the important pathogens affecting wheat growth and yield, can invade wheat cells, replicate and spread using the host's metabolic mechanism, and ultimately lead to yellowing of wheat leaves, growth stunting, and even death. By overexpressing the TaHAKAI gene, the proliferation of wheat yellow mosaic virus (WYMV) is inhibited, thereby effectively slowing down or preventing the further spread and harm of the virus. Yellow mosaic disease, caused by pathogens such as wheat yellow mosaic virus, is an important factor restricting wheat yield and quality. Through the aforementioned gene overexpression strategy, wheat plants can show stronger tolerance and resilience when facing virus attacks, which is specifically manifested in reduced symptoms, shortened course of disease, and stable or increased final yield. This not only helps to improve the agricultural value of wheat, but also provides strong technical support for ensuring global food security.

[0019] In summary, overexpression of wheat TaHAKAI gene is an innovative research to improve wheat resistance to wheat yellow mosaic virus by inhibiting the reproduction of wheat yellow mosaic virus, which is expected to open up a new path for wheat disease prevention and control and improving agricultural production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 Figure 1 is a diagram of field phenotypic observation and virus accumulation detection results, where A is the field whole plant phenotypic observation diagram, in which J411 represents the JING411 control group, and tahakai represents the mutant group, B is the JING411 control group and mutant group virus accumulation detection result diagram, in which J411 represents the JING411 control group, and tahakai represents the mutant group, C is a leaf phenotypic observation diagram, in which MOCK represents the control group not inoculated with the virus, BSMV:PDS represents the positive control group, BSMV:00 and BSMV:TaHAKAI+WYMV represent TaHAKAI silencing and then inoculating with WYMV, BSMV:00 represents the control group inoculated with BSMV, and WYMV represents the symptom reference group after inoculation with WYMV, D is the control group represented by BSMV:00 and the treatment group represented by BSMV:TaHAKAI after inoculation with WYMV, and E is the field T of TaHAKAI overexpressing genetic materials. 2Phenotypic observation of the whole plant of the same generation. In the figure, YM158 represents the control group, L1-T 2 Representative overexpression strains L1 group, L7-T 2 represents the overexpression strain L7 group, F represents YM158 represents the control group, L1-T 2 Representative overexpression strains L1 group, L7-T 2 The figure represents the results of the virus accumulation test in the L7 group of overexpression strains;

[0022] Figure 2 For TaHAKAI T 3 Figure 1. Observation results of agronomic traits of the diseased nursery of the first generation of overexpressed transgenic wheat, among which A is a comparison of plant height traits, B is a comparison of tillering traits, C is a comparison of ear length traits, D is a statistical comparison of plant height traits, E is a statistical comparison of tillering number traits, F is a statistical comparison of ear length traits, G is a statistical comparison of spikelet number traits, H is a statistical comparison of 1000-grain weight traits, YM158 represents the control group, L1-T 3 Representative overexpression strains L1 group, L7-T 3 Representative overexpression strain L7 group. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] Sources of materials used in the present invention: Yangmai 158 was obtained from the State Key Laboratory of Hazard Factors and Risk Prevention and Control of Agricultural Product Quality and Safety; JING411 was purchased from the wheat JING411 mutant website (https: / / jing411.molbreeding.com); TaHAKAI mutant was purchased from the wheat JING411 mutant website (https: / / jing411.molbreeding.com).

[0029] Example

[0030] 1. Cloning of TaHAKAI gene

[0031] Total RNA was extracted from wheat variety Yangmai 158, reverse transcribed into cDNA using random primers, and primer sequences F: 5'-ATGCTCCAGATACGCCTGA-3' (SEQ ID NO. 2); R: 5'-TCAAGTTCTGTTGAAAGA-3' (SEQ ID NO. 3) were designed based on the TaHAKAI reference genome sequence provided by the Ensembl Plants website. The TaHAKAI gene was amplified from the cDNA of Yangmai 158.

[0032]

[0033] 2. Determination of TaHAKAI gene resistance to wheat yellow mosaic virus

[0034] TaHAKAI mutant, through sequence analysis (https: / / solgenomics.net / organism / ), the coding region sequence of TaHAKAI gene (SEQ ID NO.1) was found, as shown in SEQ ID NO.4, with high specificity. Based on the coding region sequence of TaHAKAI gene (SEQ ID NO.4), a silencing vector of TaHAKAI was constructed for subsequent BSMV-mediated silencing method to study the role of TaHAKAI in WYMV infection, which is more suitable. BSMV-mediated gene silencing technology was used to construct a silencing vector of TaHAKAI, silence TaHAKAI, study the role of TaHAKAI gene in wheat yellow mosaic virus (WYMV) infection, and study the resistance to wheat yellow mosaic disease.

[0035] SEQ ID NO.4: TGCTCCAGATACGCCTGAGCAAGATCGGCTCGTCGGACTCTGGGGC CGCGGCCTCTGGCGCGGCGGCTGGGGCGTCCGGTGGCGCCCCGGCGAAGTCCGCCGCCGCGGCGGCTGGCGGTGCCCCGGAGTCGGTGACTGTGGCTTGCCCGACCACCTGGTCATCGCGGACCTC GCCGTGGCGAAGAGCCTCGGCGCCGTTACAAACTCCGCCATCGCCGCGACGCGCCATCGGCCGTCGCTCTCGCCGGCCCCTCGGCGAACGCGTCCACATCTGCTCCCGCTGCGAGTTCCCCATC.

[0036] According to the TaHAKAI gene coding region sequence (SEQ ID NO.4), homology arm sequences (CGACTCTAGAGGATCC / GAGCTCTCTAGACTAGT) were added to the front ends of the primers of the designed sequences to obtain forward primer 2-F: 5'-CGACTCTAGAGGATCCATGCTCCAGATACGCCTGA-3' (SEQ ID NO.5); reverse primer 2-R: 5'-GAGCTCTCTAGACTAGTTCAAGTTCTGTTGAAAGA-3' (SEQ ID NO.6), which were constructed into the expression vector pWMB190 by homologous recombination connection to obtain the pWMB190-GGP recombinant plasmid.

[0037] The pWMB190-GGP vector was transformed into wheat embryos using a gene gun-mediated wheat genetic transformation method. The gold powder-wrapped plasmid was bombarded into the callus embryos pretreated with osmotic pressure using a PDS1000 / He gene gun (purchased from BIA-RAD). The bombardment conditions were Psi 1100, Hg 27.5. The bombarded callus was cultured on the osmotic pressure medium for 16 to 18 hours. The treated callus was transferred to a 1 / 2MS differentiation screening medium containing 1 mg / L NAA and 1 mg / L KT.

[0038] After the callus differentiates into seedlings, they are transferred to 1 / 2MS hormone-free growth screening medium, the concentration of the screening agent Bialaphos or PPT is 4-5ppm, and the light culture is carried out at 24-26℃. After 2-3 times of screening, the seedlings obtained are transferred to 1 / 2MS medium (supplemented with 0.2mg / L IAA and 0.5mg / L paclobutrazol) for seedling treatment. When the seedlings grow to 7-8cm in height and the root system is well developed, they are transplanted to obtain T 0 Generation of transgenic seedlings.

[0039] T 0 The first generation of transgenic plants were self-pollinated to produce offspring, and two independent overexpression homozygous lines were selected for phenotypic identification of resistance to wheat yellow mosaic disease and observation of agronomic traits.

[0040] For phenotypic identification, select T 2 The overexpression homozygous lines and tahakai mutant lines were planted in a wheat yellow mosaic disease nursery in Yangzhou, Jiangsu Province, with about 10-15 seeds per row, and field phenotype observations were carried out when the wheat was diseased, using wheat varieties Yangmai 158 and JING411 as controls, respectively.

[0041] TaHAKAI quantitative detection primers were designed, 3-F: 5'-TCCGCAGTACTTCAATGCCC-3' (SEQ ID NO. 7); 3-R: 5'-GTTGAAAGACTGCTGTCCGC-3' (SEQ ID NO. 8) to detect TaHAKAI positive plants.

[0042] like Figure 1 As shown in the figure, through phenotypic observation, molecular detection found that the yellow mosaic symptoms in the TaHAKAI mutant and TaHAKAI silenced wheat were significantly aggravated, and the results of western blot analysis of viral proteins showed that the viral accumulation of WYMV was significantly higher than that of the control group ( Figure 1 Middle A, Figure 1 Middle B, Figure 1 Middle C and Figure 1The mosaic symptoms in the wheat with TaHAKAI overexpression were significantly milder than those in the control wheat. Western blot results showed that the accumulation of WYMV virus was significantly weaker than that in the control group ( Figure 1 ZhongE and Figure 1 Middle F); The disease severity and viral protein accumulation of the TaHAKAI mutant strain were significantly higher than those of the control group, while the disease severity and protein accumulation in the overexpression strain were significantly alleviated, indicating that TaHAKAI is a candidate gene for resistance to wheat yellow mosaic disease.

[0043] For agronomic trait investigations, select T 3 The homozygous overexpression lines of the first generation were planted in a diseased field of wheat yellow mosaic disease in Yangzhou City, Jiangsu Province, with Yangmai 158 as the control. Each line was planted in three plots (1m×1m) for a total of 9 plots. Agronomic traits were counted at the maturity stage of wheat, including plant height, ear length, number of tillers, number of spikelets, and thousand-grain weight.

[0044] like Figure 2 As shown, two TaHAKAI T 3 The agronomic traits of the TaHAKAI overexpressing transgenic wheat were observed in the diseased field. It was found that the TaHAKAI overexpressing wheat had no significant difference in plant height, tillering and 1000-grain weight compared with the control group. Figure 2 Middle A, Figure 2 Middle B, Figure 2 Middle D, Figure 2 ZhongE and Figure 2 However, the spike lengths of the TaHAKAI overexpressing wheat were 11.32 cm and 11.59 cm, respectively, which were about 26% and 29% higher than the 8.96 cm of the control group (Fig. Figure 2 Middle C and Figure 2 Meanwhile, the average number of spikelets per ear was 19 and 20, which was 19% and 25% higher than the average number of spikelets in the control group (Fig. Figure 2 (G), indicating that TaHAKAI may improve wheat yield by increasing the length of wheat spikelets and the number of spikelets.

[0045] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of overexpressing wheat TaHAKAI gene in improving resistance to wheat yellow mosaic disease, characterized in that: The nucleotide sequence of the wheat TaHAKAI gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that: The method for improving the resistance to wheat yellow mosaic disease is to overexpress the wheat TaHAKAI gene, inhibit the reproduction of wheat yellow mosaic virus, and improve the resistance to wheat yellow mosaic disease.

3. Use of a recombinant expression vector overexpressing the wheat TaHAKAI gene in improving resistance to wheat yellow mosaic disease, characterized in that: By overexpressing the wheat TaHAKAI gene, the reproduction of wheat yellow mosaic virus is inhibited and the resistance to wheat yellow mosaic virus is improved; the nucleotide sequence of the wheat TaHAKAI gene is shown in SEQ ID NO.

1.

4. Use of overexpressing wheat TaHAKAI gene in improving wheat resistance to wheat yellow mosaic virus, characterized in that: The reproduction of wheat yellow mosaic virus in wheat is inhibited by overexpressing the wheat TaHAKAI gene; the nucleotide sequence of the wheat TaHAKAI gene is shown in SEQ ID NO.

1.

5. A method for improving resistance to wheat yellow mosaic disease, characterized in that: The wheat yellow mosaic disease resistance is improved by overexpressing the wheat TaHAKAI gene described in claim 1.

6. Use of overexpression of the wheat TaHAKAI gene as claimed in claim 1 in increasing wheat yield.

7. The use according to claim 6, characterized in that: The method for increasing wheat yield is to overexpress wheat TaHAKAI gene, increase wheat spike length, and increase spikelet number, thereby increasing wheat yield.

Images