A tubeimu glycoside compound screened with PACT as a target and capable of exerting a broad-spectrum anti-respiratory virus effect and its application

Abstract

The present invention relates to the field of biological control technology, and in particular to a thunbergii glycoside compound screened with PACT as a target and capable of exerting a broad-spectrum anti-respiratory virus effect and its application. The thunbergii glycoside II (TBM II) described in the present invention can reduce viral load and lung index, alleviate lung tissue lesions, reduce inflammatory cell infiltration and red blood cell exudation, thereby achieving the effect of improving respiratory viral infection. TBM II is a traditional Chinese medicine compound with PACT as a target and has a broad-spectrum anti-respiratory virus effect. It has been verified by experiments that it has a good anti-respiratory virus effect. It can be seen that the TBM II provided by the present invention provides a new therapeutic drug for respiratory viruses.

Description

Technical Field

[0001] The present invention relates to the technical field of biological control, and in particular to a tubei glycoside compound screened with PACT as a target and capable of exerting a broad-spectrum anti-respiratory virus effect and an application thereof. Background Art

[0002] Respiratory viruses are a class of pathogens that are primarily airborne and infect the respiratory systems of humans and animals. Respiratory viruses can cause the common cold or more serious illnesses, such as influenza viruses (H1N1, H3N2, etc.) and coronaviruses (HCoV-229E, HCoV-OC43, SARS-CoV-2, MERS-CoV, etc.). These viruses are highly variable and transmissible and can quickly cause epidemics around the world. Studying the epidemiology, transmission mechanisms, host immune responses, and vaccine and treatment strategies of respiratory viruses is crucial to preventing and controlling the spread of these diseases.

[0003] PACT (PKR Activating Protein), or protein kinase R activating protein, is an intracellular protein found in eukaryotes that plays a key role in antiviral responses. PACT exerts its antiviral effects in cells by binding to protein kinase R (PKR) and promoting the dimerization and activation of PKR. Activated PKR can phosphorylate the translation initiation factor eIF2α of eukaryotic cells, leading to extensive translation inhibition, which limits the synthesis of viral proteins and prevents viral replication. In addition, PACT is also involved in regulating other intracellular signaling pathways, affecting cell stress responses and immune regulation. The antiviral mechanism of PACT provides a new perspective for understanding how host cells limit pathogens through innate immune responses, and can also serve as a potential target for new antiviral treatment strategies.

[0004] Chinese medicinal compounds are derived from natural herbs and are the essence of the treasure house of traditional Chinese medicine. They usually have complex chemical structures and multi-target mechanisms of action, and can intervene in the life cycle of viruses from multiple angles, including inhibiting the adsorption, replication, assembly and release of viruses. Compared with single compounds, the multi-component characteristics of Chinese medicinal compounds help reduce the development of viral resistance, while their mild side effects make them more suitable for long-term treatment and adjuvant therapy. The antiviral effects of Chinese medicinal compounds are not limited to directly fighting viruses, but also include regulating the host's immune response and enhancing the body's defense capabilities. For example, some Chinese medicinal compounds can activate the body's immune cells and increase the production of interferon, thereby enhancing the ability to clear viruses. In addition, Chinese medicinal compounds also have anti-inflammatory effects, which can reduce the inflammatory response caused by viral infection and reduce the risk of complications. Although Chinese medicinal compounds have shown great potential in the field of antiviral drugs, their research and application still face some challenges, including a deep understanding of the mechanism of action of Chinese medicinal compounds, accurate identification of active ingredients, and standardized quality control. In order to fully utilize the role of traditional Chinese medicine compounds in the prevention and control of respiratory viruses, it is necessary to strengthen interdisciplinary research cooperation and combine modern pharmacology, chemical analysis technology and systems biology methods to systematically study and develop traditional Chinese medicine compounds. Through these efforts, traditional Chinese medicine compounds are expected to provide new strategies for the prevention and treatment of respiratory viruses and contribute to global public health.

[0005] At present, the prevention and treatment of respiratory viruses mainly uses antibiotics, but the use of antibiotics often causes respiratory viruses to develop resistance to antibiotics, making their efficacy very limited. Therefore, it is necessary to find a drug that can effectively target respiratory viruses. Summary of the invention

[0006] The purpose of the present invention is to provide a thiamin glycoside compound screened with PACT as a target that can exert a broad-spectrum anti-respiratory virus effect and its application to solve the problems existing in the above-mentioned prior art. The present invention first discovered that thiamin glycoside II (TBM II) can resist the infection of influenza A H1N1 virus (FM1 strain), coronavirus SARS-CoV-2, and HCoV-OC43.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides the use of tubeimoside B in the preparation of anti-respiratory virus drugs, and the structural formula of the tubeimoside B is shown in Formula III:

[0009] , formula III.

[0010] Preferably, the respiratory virus includes any one or more of the novel coronavirus SARS-cOV-2 strain, the coronavirus HCoV-OC43 strain and the influenza A virus H1N1 influenza FM1 strain, but is not limited to the novel coronavirus SARS-cOV-2 strain, the coronavirus HCoV-OC43 strain and the influenza A virus H1N1 influenza FM1 strain.

[0011] Preferably, the drug achieves an anti-respiratory virus effect by inhibiting the replication of respiratory viruses.

[0012] Preferably, the drug achieves an anti-respiratory viral effect by reducing the respiratory viral load.

[0013] Preferably, the drug achieves the effect of resisting respiratory viruses by lowering the lung index, alleviating lung tissue lesions, and reducing lung inflammatory cell infiltration and red blood cell exudation.

[0014] The present invention provides an anti-respiratory virus drug, wherein the active ingredient of the drug is tubeimoside B; the structural formula of the tubeimoside B is shown in Formula III:

[0015] , formula III.

[0016] Preferably, the respiratory virus includes any one or more of the novel coronavirus SARS-cOV-2 strain, the coronavirus HCoV-OC43 strain and the influenza A virus H1N1 influenza FM1 strain, but is not limited to the novel coronavirus SARS-cOV-2 strain, the coronavirus HCoV-OC43 strain and the influenza A virus H1N1 influenza FM1 strain.

[0017] Further preferably, the drug achieves an anti-respiratory virus effect by inhibiting the replication of respiratory viruses.

[0018] Further preferably, the drug achieves an anti-respiratory viral effect by reducing the respiratory viral load.

[0019] Further preferably, the drug achieves the effect of resisting respiratory viruses by lowering the lung index, alleviating lung tissue lesions, reducing lung inflammatory cell infiltration and red blood cell exudation.

[0020] The present invention discloses the following technical effects:

[0021] The present invention uses PACT as a target and obtains the top four known Chinese medicinal compounds with the highest binding energy with PACT through virtual screening, namely, punicalagin, turmeric glycoside C, turmeric glycoside B and parsley saponin E. Then, a high-content imaging system is used to perform high-throughput screening on the four compounds, and a compound with significant antiviral effect, namely, turmeric glycoside B (TBMII), is obtained. Surface plasmon resonance (SPR) technology and cellular thermal shift assay (CETSA) are used to confirm that the compound has a good affinity with PACT, proving that PACT is the target of turmeric glycoside B. Finally, the present invention treats infected cells and animals with TBM II, and detects the following indicators: viral load, lung index, lung lesions in vivo, and pathological changes in the lung lobes. The results show that the Tubeimu glycoside compound TBM II can inhibit the replication of SARS-CoV-2 virus and reduce the viral load in Caco-2-N cells infected by it; it can reduce the viral load in A549 cells infected by influenza A virus H1N1 influenza FM1 strain; it can reduce the lung index of mice infected by influenza A virus H1N1 influenza FM1 strain and coronavirus HCoV-OC43; it can reduce the lung tissue lesions of mice infected by influenza A virus H1N1 influenza FM1 strain and coronavirus HCoV-OC43; it can reduce the inflammatory cell infiltration and red blood cell exudation in the lungs of mice infected by influenza A virus H1N1 influenza FM1 strain and coronavirus HCoV-OC43. It can be seen that the Tubeimu glycoside B described in the present invention can reduce the viral load and lung index, reduce lung tissue lesions, reduce inflammatory cell infiltration and red blood cell exudation, thereby achieving the effect of improving respiratory viral infection. Tubeimu glycoside compound TBM II is a traditional Chinese medicine compound with PACT as the target and a broad-spectrum anti-respiratory virus effect. It has been verified by experiments that it has a good anti-respiratory virus effect and the traditional Chinese medicine compound also has a broad spectrum. It can be seen that the TBM II provided by the present invention provides a new therapeutic drug for respiratory viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 This is the virtual screening result diagram;

[0024] Figure 2 GFP signal diagram (A) and average fluorescence intensity statistics diagram (B) in the high-content imaging system;

[0025] Figure 3The figure is the result of thermal shift; A is the Western blot band diagram of thermal shift at different temperatures, B is the melting curve of CETSA; DMSO is the control;

[0026] Figure 4 This is the SPR result diagram; the lines on the left side of the axis are 10μM, 5μM, 1.25μM, 0.625μM, 0.3125μM and 0.078125μM from top to bottom, and the lines on the right side of the axis are 10μM, 5μM, 1.25μM, 0.625μM, 0.3125μM and 0.078125μM from top to bottom;

[0027] Figure 5 The figure is a statistical chart of the viral load of SARS-cOV-2; among them, Tubeimuside B (high) is the TBM II high-dose group, Tubeimuside B (medium) is the TBM II medium-dose group, and Tubeimuside B (low) is the TBM II low-dose group;

[0028] Figure 6 This is a statistical chart of the viral load of influenza A virus H1N1 influenza FM1 strain; among them, tubeimu glycoside B (high) is the TBM II high-dose group, tubeimu glycoside B (medium) is the TBM II medium-dose group, and tubeimu glycoside B (low) is the TBM II low-dose group;

[0029] Figure 7 The results of the lung index investigation of mice infected with HCoV-OC43 virus after TBM II treatment; among them, Tubeimuside B (high) is the TBM II high-dose group, Tubeimuside B (medium) is the TBM II medium-dose group, and Tubeimuside B (low) is the TBM II low-dose group;

[0030] Figure 8 Micro-CT results; Model group (OC43) is the HCoV-OC43 model group, Tubeimuside B (high) is the TBM II high-dose group, Tubeimuside B (medium) is the TBM II medium-dose group, Tubeimuside B (low) is the TBM II low-dose group;

[0031] Fig. 9 HE staining results, among which, the model group (OC43) is the HCoV-OC43 model group, tubeimu glycoside B (high) is the TBM II high-dose group, tubeimu glycoside B (medium) is the TBM II medium-dose group, and tubeimu glycoside B (low) is the TBM II low-dose group; the microscope magnification is 200 times, the black box is mild thickening of the alveolar wall with mild inflammatory cell infiltration, and the black arrow is necrosis and shedding of bronchiolar epithelial cells;

[0032] Fig.10The results of the lung index investigation of mice infected with influenza A (H1N1) virus FM1 strain after TBM II treatment; the model group (FM1) was the model control group, tubeimu glycoside B (high) was the TBM II high-dose group, tubeimu glycoside B (medium) was the TBM II medium-dose group, and tubeimu glycoside B (low) was the TBM II low-dose group;

[0033] Fig.11 Micro-CT results; the model group (FM1) is the model control group, tubeimu glycoside B (high) is the TBMII high-dose group, tubeimu glycoside B (medium) is the TBM II medium-dose group, and tubeimu glycoside B (low) is the TBM II low-dose group;

[0034] Fig.12 HE staining results, among which, the model group (FM1) is the model control group, trobeside B (high) is the TBM II high-dose group, trobeside B (medium) is the TBM II medium-dose group, and trobeside B (low) is the TBM II low-dose group; the microscope magnification is 200 times, the black box represents mild thickening of the alveolar wall with mild inflammatory cell infiltration, and the black arrows represent necrosis and shedding of bronchiolar epithelial cells. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] Example 1

[0041] (I) Virtual screening of molecular docking to discover traditional Chinese medicine compounds that can be bound by PACT

[0042] 1. Import the protein structure. Upload the structure of the target protein in pdb format. Perform a structural check after uploading. If the check fails, protein prepare must be performed first to repair the protein structure.

[0043] 2. Input the ligand file and upload the target ligand (mol or sdf format file is required), or select the software's built-in database to upload the ligand.

[0044] 3. Definition of the docking box: by selecting the amino acid sequence of the target protein, or determining the position and size of the docking box based on the spatial position and size of the docking box, the search range of the docking site during docking is determined.

[0045] 4. Setting of docking parameters: confirm protein, ligand and docking box: set scoring function, search mode, number of retained results, whether to generate multiple conformations for each ligand. Among them, scoring functions include Vina, Vinardo, AutoDock4; search modes include Fast, Balanced, Detailed.

[0046] Virtual screening databases include Targetmol, Chemdiv, Specs, IBS, HTS_Biochemie_Innovationen, Princeton, VitasM, Alinda, Enamine, Bionet, Otava, Asinex, UkrOrgSynthesis, IBScreen, and Lifechemicals.

[0047] A total of 23,000 compounds with binding affinity to PACT were initially screened, and the top 10,000 were finely screened to obtain the top 1,000 compounds in affinity, which were then screened again using a high-content imaging system.

[0048] (II) High-content imaging system to detect the anti-SARS-CoV-2 ability of four traditional Chinese medicine compounds

[0049] Caco-2-N cells (provided by Tsinghua University and published in the literature “A novel cell culture system modeling the SARS-CoV-2 life cycle”) were cultured at 3×10 4 / well were inoculated in a 96-well 3603 black board, and a normal control group, a model control group, a high-dose group of each monomer drug (2.63 mg / kg), a medium-dose group of each monomer drug (1.05 mg / kg), a low-dose group of each monomer drug (0.418 mg / kg) and an azithromycin-positive drug group (2 mg / kg) were set up; wherein each monomer was one of punicalagin, tangerineside C, tangerineside B and parsnip saponin E.

[0050] The normal control group was as follows: after the Caco-2-N cells were cultured to 70-80%, they were incubated at 37°C and 5% CO2 without adding any substances;

[0051] The model control group is as follows: After the Caco-2-N cells are cultured to 70-80%, they are infected with the SARS-CoV-2 GFP / ΔN trVLP (provided by Tsinghua University, the cells are disclosed in the document "A novel cell culture system modeling the SARS-CoV-2 life cycle"), and incubated at 37°C and 5% CO2;

[0052] The specific high-dose groups of each monomer drug are as follows: After the Caco-2-N cells are cultured to 70-80%, they are infected with the new coronavirus N gene-deficient pseudovirus SARS-CoV-2 GFP / ΔN trVLP, incubated at 37°C and 5% CO2 for 12 hours (GFP signal appears), and then each monomer drug is given and incubated at 37°C and 5% CO2 for 24 hours;

[0053] The specific dosage groups of each monomer drug are as follows: After the Caco-2-N cells are cultured to 70-80%, they are infected with the novel coronavirus N gene-deficient pseudovirus SARS-CoV-2 GFP / ΔN trVLP, and incubated at 37°C and 5% CO2 for 12 hours (GFP signal appears), and then each monomer drug is administered and incubated at 37°C and 5% CO2 for 24 hours;

[0054] The specific low-dose groups of each monomer drug are as follows: After the Caco-2-N cells are cultured to 70-80%, they are infected with the new coronavirus N gene-deficient pseudovirus SARS-CoV-2 GFP / ΔN trVLP, incubated at 37°C and 5% CO2 for 12 hours (GFP signal appears), and then each monomer drug is given and incubated at 37°C and 5% CO2 for 24 hours;

[0055] The specific conditions of the azvudine-positive drug group were as follows: after the Caco-2-N cells were cultured to 70-80%, they were infected with the SARS-CoV-2 GFP / ΔN trVLP pseudovirus with a missing N gene of the new coronavirus. After incubation at 37°C and 5% CO2 for 12 hours (GFP signal appeared), azvudine was given and incubated at 37°C and 5% CO2 for 24 hours.

[0056] Three replicate wells were set up for each group.

[0057] Afterwards, the high-content imaging system ImageXpress® Micro XLS was used to detect the expression of the virus (GFP signal) after administration to determine whether the administered drug had an anti-SARS-cOV-2 virus effect.

[0058] 3. Surface plasmon resonance experiment (SPR)

[0059] The PACT protein is fixed on the surface of the chip, and TBM II flows through the surface of the chip in a flowing manner. When the molecules bind and dissociate, the change in the mass of the chip surface causes the resonance angle to change, and the sensor graph records the signal value under the interaction in real time. According to the change curve of the resonance angle, the binding rate constant, dissociation rate constant and equilibrium dissociation constant / affinity constant of the intermolecular interaction can be fitted. These kinetic constants reflect the speed of binding / dissociation and the strength of binding; DMSO is used as a control.

[0060] 4. Cellular thermal shift assay (CETSA)

[0061] The CETSA experimental process based on Western blotting is as follows:

[0062] Cell culture: Caco-2-N cells are cultured to an appropriate density, usually at 37°C, 5% CO2.

[0063] Drug treatment: Caco-2-N cells were co-incubated with different concentrations of tubeimoside B to allow the drug to have a chance to bind to the target protein in the cells.

[0064] Cell collection and washing: After 24 h, cells were collected and washed with phosphate-buffered saline (PBS) containing protease inhibitors to remove culture medium and serum.

[0065] Cell lysis: Caco-2-N cells were heated for short periods of time at different temperatures to induce denaturation of unbound drug proteins.

[0066] Centrifugation: The Caco-2-N cell lysate was centrifuged to separate the denatured precipitated proteins from the soluble proteins.

[0067] Protein detection: Take the supernatant for Western blotting or mass spectrometry analysis to detect the amount of specific protein.

[0068] Data analysis: Use GraphPad Prism and other software to analyze thermal stability curves, determine the binding of drugs to target proteins, and obtain melting curves.

[0069] (V) Validation of TBM II's efficacy in vitro against SARS-CoV-2 and influenza A virus H1N1 FM1 infection models

[0070] 1. TBM II reduces the viral load of SARS-cOV-2 in Caco-2-N cells

[0071] A total of 6 groups were set up, including normal control group, SARS-cOV-2 infection group, azithromycin positive drug control group (2 mg / kg), TBM II high-dose group (dosage was 2.63 mg / kg), TBM II medium-dose group (1.05 mg / kg) and TBM II low-dose group (0.418 mg / kg).

[0072] Press 3×10 5 / well Caco-2-N cells were placed in a 12-well plate, and the old culture medium was discarded when the cells grew to 70%, and the virus solution of the SARS-CoV-2 GFP / ΔN trVLP pseudovirus with N gene deletion of the new coronavirus was inoculated. After incubation at 37°C, 5% CO2 for 2 hours, the virus solution was discarded, and the maximum cell-nontoxic concentration of azithromycin and different concentrations of TBM II prepared with maintenance solution (DMEM solution containing 2% FBS) were added according to the group, and incubation was continued at 37°C, 5% CO2 for 24 hours; the normal control group was not inoculated with the virus solution of the SARS-CoV-2 GFP / ΔN trVLP pseudovirus with N gene deletion of the new coronavirus, and no substances were added. The SARS-cOV-2 infection group was only inoculated with the SARS-CoV-2 GFP / ΔN trVLP pseudovirus with N gene deletion of the new coronavirus, without adding any substances.

[0073] Afterwards, RNA was extracted by Trizol method, and RT-qPCR technology was used to detect the level of SARS-CoV-2 N. RT-qPCR detection was performed using Evo M-MLV One-Step RT-qPCR Kit. After all components were mixed and centrifuged, PCR amplification was performed to obtain the target fragment. The primer sequences are as follows:

[0074] SARS-CoV-2 NF: AGCACAGTGGCGGCCGCTCGAGGCCACCATGAGTGGTTTTTAGAAAAATGGCATTC, SEQ ID NO.1;

[0075] SARS-CoV-2 NR: GTCATCCTTGTAATCTCTAGATTGGAAAGTAACACCTGAGCATT, SEQ ID NO.2.

[0076] 2. TBM II reduces the viral load of influenza A virus H1N1 FM1 strain in A549 cells

[0077] Six groups were set up: normal control group, influenza A virus H1N1 influenza FM1 (purchased from ATCC, USA, propagated by our laboratory, and stored in a -80℃ refrigerator) model group, oseltamivir phosphate positive drug group (27.5 mg / kg), TBM II high-dose group (2.63 mg / kg), TBM II medium-dose group (1.05 mg / kg), and TBM II low-dose group (0.418 mg / kg). 5 A549 cells were placed in a 12-well plate per well. When the cells grew to 70%, the old culture medium was discarded, and FM1 virus solution was inoculated. After incubation at 37°C, 5% CO2 for 2 hours, the virus solution was discarded. Azvudine with the maximum cell-free concentration prepared with maintenance solution (DMEM solution containing 2% FBS) and different concentrations of TBM II were added according to the groups. The cells were incubated at 37°C, 5% CO2 for 24 hours. The normal control group was not inoculated with FM1 virus solution, and no substances were added. The influenza A virus H1N1 influenza FM1 model group was only inoculated with FM1 virus, and no substances were added.

[0078] Afterwards, RNA was extracted by Trizol method, and FM1 level was detected by RT-qPCR. RT-qPCR detection was performed using Evo M-MLV One-step RT-qPCR Kit. After all components were mixed and centrifuged, PCR amplification was performed to obtain the target fragment. The primer sequences are as follows:

[0079] FM1-F: GACCAATCCTGTCACCTCTGAC, SEQ ID NO.3;

[0080] FM1-R: TGCACCAGCAGAATAACTGAG, SEQ ID NO.4;

[0081] (VI) Validation of TBM II efficacy in vivo against HCoV-OC43 virus and influenza A virus H1N1 influenza FM1 strain infection models

[0082] 1. The therapeutic effect of TBM II on HCoV-OC43 virus infection mouse model

[0083] (1) Animal grouping, modeling and drug administration

[0084] Balb / c mice (weight 13±15g) were divided into 6 groups, including normal control group, HCoV-OC43 (purchased from ATCC, USA, propagated by our laboratory, and stored in -80℃ refrigerator) model group, azvudine positive drug group (2mg / kg), TBM II high-dose group (2.63mg / kg), TBM II medium-dose group (1.05mg / kg) and TBM II low-dose group (dosage 0.418mg / kg), with 10 mice in each group. The mice in the HCoV-OC43 model group and drug-treated group were infected with 45μL of HCoV-OC43 original strain virus by intranasal drops. On the day of infection, different doses (2.63mg / kg, 1.05mg / kg and 0.418mg / kg) of TBM II solution or azvudine were given by intraperitoneal injection once a day for 4 consecutive days; the normal control group was not infected with the virus and no injection of any substance was given; the HCoV-OC43 model group was only infected with the virus and no injection of any substance was given.

[0085] (2) Observation of the general condition of mice and determination of lung index and lung index inhibition rate

[0086] The activity, hair condition, mental state, diet and body weight of each group of mice were observed every day. On the fifth day of infection, the mice were weighed and killed by cervical dislocation. The complete lung tissue was taken, and the excess connective tissue was removed and weighed. The lung index and lung index inhibition rate of each group were calculated. The calculation formula of lung index and lung index inhibition rate is as follows:

[0087]

[0088] (3) Micro-CT lung scanning and pathological examination of mice

[0089] On the 5th day of infection, mice in each group underwent Micro-CT lung scanning, and the parameters were set as follows: 90 kV, 88 mA and 36 mm, and the scanning time for each mouse was 2 min; after scanning, the mice were weighed and lung tissues were taken, the left lung was immersed in 4% paraformaldehyde fixative for hematoxylin-eosin (HE) staining, and the remaining lung tissues were frozen at -80 ° C. Panoramic tissue scanner was used to scan lung tissue sections of each group to observe the pathological changes of lung tissue.

[0090] 2. Therapeutic effect of TBM II on the mouse model infected with influenza A virus H1N1 influenza FM1 strain

[0091] (1) Animal grouping, modeling and drug administration

[0092] ICR mice (weight 13±15g) were divided into 6 groups, including normal control group, influenza A virus H1N1 influenza FM1 model group, oseltamivir phosphate positive drug group (27.5mg / kg), TBM II high-dose group (dose 2.63mg / kg), TBM II medium-dose group (dose 1.05mg / kg) and TBM II low-dose group (dose 0.418mg / kg), with 10 mice in each group. Mice in the influenza A virus H1N1 influenza FM1 model group and TBM II administration group were infected with 35μL FM1 virus liquid by nasal drops. On the day of infection, different doses (2.63mg / kg, 1.05mg / kg and 0.418mg / kg) of TBM II liquid oseltamivir phosphate positive were given once a day for 4 consecutive days; the normal control group was not infected with the virus and was not treated with any substance; the influenza A virus H1N1 influenza FM1 model group was only infected with the virus and no other substances were given.

[0093] (2) Observation of the general condition of mice and determination of lung index and lung index inhibition rate

[0094] The activity, hair condition, mental state, diet and body weight of each group of mice were observed every day. On the fifth day of infection, the mice were weighed and killed by cervical dislocation. The complete lung tissue was taken and the excess connective tissue was removed and weighed. The lung index and lung index inhibition rate of each group were calculated as follows:

[0095] The activity, hair condition, mental state, diet and body weight of each group of mice were observed every day. On the fifth day of infection, the mice were weighed and killed by cervical dislocation. The complete lung tissue was taken, and the excess connective tissue was removed and weighed. The lung index and lung index inhibition rate of each group were calculated. The calculation formula of lung index and lung index inhibition rate was the same as above.

[0096] (3) Micro-CT lung scanning and pathological examination of mice

[0097] On the 5th day of infection, mice in each group underwent Micro-CT lung scanning, and the parameters were set as follows: 90 kV, 88 mA and 36 mm, and the scanning time for each mouse was 2 min; after scanning, the mice were weighed and lung tissues were taken, the left lung was immersed in 4% paraformaldehyde fixative for hematoxylin-eosin (HE) staining, and the remaining lung tissues were frozen at -80 ° C. Panoramic tissue scanner was used to scan lung tissue sections of each group to observe the pathological changes of lung tissue.

[0098] 7. Statistical analysis

[0099] The experimental data were statistically analyzed using SPSS17.0 software, and the T-test method was used to analyze the statistical differences between the groups. P < 0.05 indicated a statistical difference, and P < 0.01 indicated a significant statistical difference. Graphpad Prism9.4.1 software was used to draw statistical graphs.

[0100] 8. Results

[0101] 1. Virtual screening of molecular docking to discover traditional Chinese medicine compounds that can be bound by PACT

[0102] After virtual screening and molecular docking, four Chinese medicine compounds with strong affinity to PACT were finally obtained. Their affinity to PACT was between -7 and -9 (85-95%), namely, punicalagin (PubChem CID 44584733, chemical formula as shown in Formula Ⅰ), scutellaria baicalensis glycoside C (PubChem CID 5489425, chemical formula as shown in Formula Ⅱ), scutellaria baicalensis glycoside B (PubChem CID 14037387, chemical formula as shown in Formula Ⅲ) and parisosaponin E (PubChem CID 11061578, chemical formula as shown in Formula Ⅳ). Formula Ⅰ to Formula Ⅳ are shown below. Among them, the affinity of scutellaria baicalensis glycoside B to PACT is -8.911 ( Figure 1 ).

[0103] , Formula Ⅰ;

[0104] , formula II;

[0105] , Formula III;

[0106] , formula IV.

[0107] 2. High-content imaging system detects the anti-SARS-CoV-2 ability of four traditional Chinese medicine compounds

[0108] The anti-SARS-CoV-2 virus ability of four traditional Chinese medicine compounds was detected using a high-content imaging system. The results are as follows Figure 2 As shown. Figure 2 It can be seen that the GFP signal in the high-content imaging system is the green fluorescent area, representing the SARS-CoV-2 virus infection area. Compared with the model control group, the four traditional Chinese medicine compounds, punicalagin, turmericaside C, turmericaside B and parsnip E, can inhibit the expression of SARS-cOV-2 GFP signal to varying degrees, among which turmericaside B (TBM II) has the most significant effect.

[0109] 3. Surface Plasmon Resonance Experiment

[0110] The surface plasmon resonance experimental results are as follows Figure 4 As shown in Table 1. Figure 4 As shown in Table 1, the SPR results show that after TBM II and PACT acted, K D The dissociation constant is 5.37×10 -6 , reflecting that TBM II has a strong affinity for PACT.

[0111] Table 1 Surface plasmon resonance experimental investigation results

[0112]

[0113] 4. Cell thermal shift experiment

[0114] The results of the cell thermal shift experiment are as follows Figure 3 As shown. Figure 3 It can be seen that the PACT apparent melting curve shifted significantly to the right after TBM II treatment, indicating that the stability of this protein was enhanced under the action of TBM II and the amount of soluble protein increased under the same temperature conditions.

[0115] The results of combined plasma resonance experiments and cell thermal shift experiments indicated that PACT is a substantial target of TBM II.

[0116] 5. The efficacy of TBM II in vitro against SARS-CoV-2 and influenza A virus H1N1 FM1 strain infection models is as follows: Figure 5 and Figure 6 As shown. Figure 5 and Figure 6 It can be seen that all three dose groups of TBM II can inhibit the expression of the N gene in SARS-CoV-2 and the FM1 gene of the influenza A (H1N1) virus FM1 strain. This shows that TBM II can effectively inhibit the proliferation of SARS-CoV-2 and influenza A (H1N1) virus FM1 strain.

[0117] 6. The efficacy of TBM II in vivo against HCoV-OC43 virus and influenza A virus H1N1 influenza FM1 strain infection models is as follows Figure 7-Figure 12 As shown. Figure 7 It can be seen that mice infected with HCoV-OC43 virus were given TBM II treatment on the same day. After 4 days, the lung index of the three dose groups of TBM II was significantly reduced, and the lung index inhibition rates of the three dose groups were 68.19%, 52.60% and 43.81%, respectively. Figure 8 It can be seen that the air density in the lungs of mice in the normal control group was uniform, without spot-like shadows; the air density in the lungs of mice in the HCoV-OC43 model group was reduced, and flake-like white shadows were observed in some areas, indicating pathological changes; compared with the HCoV-OC43 model group, the air density in the lungs of mice in the azithromycin-positive drug group, the TBM II high-dose group, and the TBM II medium-dose group was lower, with fewer spot-like shadows. TBM II can inhibit the lung lesions caused by the HCoV-OC43 virus to a certain extent. Fig. 9 It can be seen that the lung tissue structure of normal mice is clear, the alveoli are not ruptured or deformed, and the alveolar wall is not thickened. In the HCoV-OC43 model group, mice showed alveolar congestion and edema, and some alveoli were necrotic, fused, deformed and distorted. There were more mixed inflammatory cell infiltrations in the alveoli and interstitium, which were significantly different from those in the normal control group. The oseltamivir phosphate group, the TBM II high-dose group and the TBM II medium-dose group had a significant protective effect on the lung tissue damage of mice; while the TBM II low-dose group had no significant effect on the lung tissue damage. Fig.10 It can be seen that mice infected with influenza A (H1N1) virus FM1 strain were given TBM II treatment on the same day. After 4 days, the lung index of the three dose groups of TBM II was significantly reduced, and the lung index inhibition rates of the three dose groups were 62.18%, 32.71% and 29.7%, respectively. Fig.11 It can be seen that the lung air density of mice in the normal control group is uniform, without spot-like shadows; the lung air density of mice in the model group is reduced, and flake-like white shadows can be observed in some areas, indicating pathological changes; compared with the influenza A (H1N1) virus FM1 model group, the lung air density of mice in the oseltamivir phosphate positive drug group and the TBM II high-dose group is lower, and there are fewer spot-like shadows. TBM II can inhibit the lung lesions caused by the influenza A (H1N1) virus FM1 strain to a certain extent. Fig.12It can be seen that the lung tissue structure of normal mice is clear, the alveoli are not ruptured or deformed, and the alveolar wall is not thickened. In the FM1 model group of influenza A (H1N1) virus, mice showed alveolar congestion and edema, some alveolar necrosis and fusion, deformation and distortion, and more mixed inflammatory cell infiltration in the alveoli and interstitium. There was a significant difference compared with the normal control group. High-dose administration of oseltamivir phosphate and TBM II had a significant protective effect on lung tissue damage in mice; medium-dose administration of TBM II had a slight protective effect on lung tissue damage in mice; and low-dose administration of TBM II had no significant effect on lung tissue damage.

[0118] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The use of tubeimoside B in the preparation of anti-respiratory virus drugs, characterized in that: The structural formula of the tubeimoside B is shown in Formula III: , Formula III; The respiratory viruses are coronavirus HCoV-OC43 strain and influenza A virus H1N1 influenza FM1 strain.

2. The use according to claim 1, characterized in that: The drug achieves the effect of resisting respiratory viruses by inhibiting the replication of respiratory viruses.

3. The use according to claim 1, characterized in that: The drug achieves the effect of resisting respiratory viruses by reducing the viral load in the respiratory tract.

4. The use according to claim 1, characterized in that: The drug achieves the effect of resisting respiratory viruses by lowering the lung index, alleviating lung tissue lesions, and reducing lung inflammatory cell infiltration and red blood cell exudation.

Images