A dna fragment related to slash pine resin yield, its closely linked molecular marker and application thereof

Abstract

The application discloses a DNA fragment related to slash pine pitch yield, a closely linked molecular marker thereof and application of the DNA fragment. The base sequence of the DNA fragment is shown in SEQ ID NO.1, and the DNA fragment is a full-length transcriptome sequence of a slash pine pitch yield regulation gene PeERF. The SNP molecular marker is located at the 529th position of the DNA fragment related to the slash pine pitch yield, the reference base of the SNP molecular marker is T, and the base after mutation is C. The application is used for identifying a pitch yield phenotype of the slash pine, or used for predicting the pitch yield of the slash pine, or used for improving the pitch yield of the slash pine, or used for molecular marker assisted breeding of the slash pine. The SNP molecular marker provided by the application can be used for identifying the slash pine with high pitch yield, and is helpful to improving the selection efficiency of slash pine breeding and accelerating the breeding process of the slash pine.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular markers and genetic breeding of Pinus elliottii. In particular, it relates to a DNA fragment related to the turpentine yield of Pinus elliottii, a molecular marker closely linked thereto, and application thereof. BACKGROUND

[0002] Pinus elliottii Engelm. var. elliottii, which is native to the southeastern United States, has been introduced and cultivated in China for more than 100 years. It is an important fast-growing timber tree species and a green chemical raw material turpentine production tree species in southern China, and is also an excellent pine wood nematode resistant tree species. Turpentine is a self-defense substance secreted in the secondary xylem and phloem vessels of pine trees, and is also one of the most important natural products used by humans on a large scale, which can be used to produce important industrial chemicals such as rosin and turpentine oil.

[0003] Breeding of Pinus elliottii with high yield and good quality is the basis and guarantee for the healthy development of the world turpentine industry. For a long time, the breeding of Pinus elliottii mainly relies on selection and hybridization breeding, and great progress has been made in the breeding of Pinus elliottii. However, the huge and conservative genome and long life cycle of Pinus elliottii seriously hinder the efficiency of conventional breeding, and the breeding of excellent families and individual trees is slow, which cannot meet the needs of the development of the turpentine industry, and has become one of the important factors restricting the development of the turpentine industry.

[0004] Compared with traditional breeding techniques, molecular marker-assisted breeding can be used for early selection at the seedling stage, greatly shortening the breeding cycle, and the advantage is particularly obvious for pine breeding aimed at wood and turpentine. Molecular marker-assisted breeding relies on effective molecular markers, therefore, developing molecular markers related to the turpentine yield of Pinus elliottii, especially identifying molecular markers and candidate genes controlling the turpentine synthesis pathway of Pinus elliottii, and improving the turpentine yield of Pinus elliottii according to the identification results of these molecular markers and candidate genes, can reduce the production cost of turpentine, and has great significance for the promotion and healthy development of the turpentine industry of Pinus elliottii. SUMMARY

[0005] Therefore, the technical problem to be solved by the present application is to provide a DNA fragment related to the turpentine yield of Pinus elliottii, a molecular marker closely linked thereto, and application thereof. The SNP molecular marker provided by the present application can be used to identify Pinus elliottii with high turpentine yield, which helps to improve the selection efficiency of Pinus elliottii breeding and accelerate the breeding process of Pinus elliottii.

[0006] To solve the above technical problems, the present application provides the following technical solutions:

[0007] A DNA fragment related to the turpentine yield of Pinus elliottii, wherein the base sequence of the DNA fragment is shown as SEQ ID NO. 1, and the DNA fragment is a full-length transcriptome sequence of a turpentine yield regulation gene PeERF of Pinus elliottii.

[0008] A SNP molecular marker, wherein the SNP molecular marker is located at position 529 of the DNA fragment related to the turpentine yield of Pinus elliottii, and the reference base of the SNP molecular marker is T and the mutated base is C.

[0009] An application of the SNP molecular marker, wherein the SNP molecular marker is the SNP molecular marker described above, and the application is used for identifying the turpentine yield phenotype of Pinus elliottii, or predicting the turpentine yield of Pinus elliottii, or improving the turpentine yield of Pinus elliottii, or molecular marker assisted breeding of Pinus elliottii.

[0010] The application of the SNP molecular marker described above, wherein when identifying the turpentine yield phenotype of Pinus elliottii or predicting the turpentine yield of Pinus elliottii, the genotype of the test Pinus elliottii at position 529 of the sequence shown as SEQ ID NO. 1 is obtained from the genomic DNA of the test Pinus elliottii, and when the genotype is CT, the test Pinus elliottii is a high-yield individual, and when the genotype is TT, the test Pinus elliottii is a low-yield individual.

[0011] The application of the SNP molecular marker described above, wherein when obtaining the genotype of the test Pinus elliottii at position 529 of the sequence shown as SEQ ID NO. 1 from the genomic DNA of the test Pinus elliottii, PCR is performed on the genomic DNA of the test Pinus elliottii as the template DNA to obtain a PCR product, and the PCR product is sequenced after purification to obtain the genotype of the test Pinus elliottii at position 529 of the sequence shown as SEQ ID NO. 1.

[0012] The application of the SNP molecular marker described above, wherein when performing PCR on the genomic DNA of the test Pinus elliottii, the volume of the PCR reaction system is 50 μL, and the PCR reaction system contains 0.25 μL of Taq enzyme, 5 μL of 10×PCR Buffer, 4 μL of dNTP mixture, 200 ng of template DNA, F primer and R primer; in the PCR reaction system, the concentrations of the F primer and the R primer are both 0.2-1.0 μmol / L.

[0013] The application of the SNP molecular marker described above, wherein the sequences of the F primer and the R primer are shown as SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

[0014] The SNP molecular marker is applied, and the reaction procedure in PCR is as follows: pre-denaturation at 94-95 DEG C for 3-5 min; denaturation at 94-95 DEG C for 15-30 s, annealing and extension at 60-65 DEG C for 40-60 s, 30-35 cycles; and complete extension at 65-70 DEG C for 4-6 min.

[0015] The SNP molecular marker is applied, and the reaction procedure in PCR is as follows: pre-denaturation at 94 DEG C for 3 min; denaturation at 94 DEG C for 15 s, annealing and extension at 60 DEG C for 50 s, 30 cycles; and complete extension at 60 DEG C for 4 min.

[0016] The SNP molecular marker is applied, and when the PCR product is purified, agarose gel electrophoresis and gel cutting purification are sequentially performed; when the agarose gel electrophoresis is performed, the agarose gel with a concentration of 1.2 wt% of agarose is used.

[0017] The resin yield of the present application is the mass of the resin collected within 24 hours of resin collection, and the unit is gram.

[0018] The development of the gene locus of the slash pine resin yield and the molecular marker closely linked to the gene locus is based on the established slash pine half-sib family population, and is identified by performing whole genome association analysis of the resin yield phenotype. The full-length transcript of the slash pine xylem is the region for developing the SNP molecular marker.

[0019] The two-step method PCR amplification of the slash pine gene fragment has the advantages of high efficiency in time, adaptability to high melting point primers and relatively simplified reaction process. Although the three-step method can better control the reaction conditions of each step, it is time-consuming, complex and has high requirements for temperature control, and the efficiency is relatively low in actual operation.

[0020] According to the genotype of the SNP site in the genome of the slash pine, the resin yield phenotype of the slash pine can be accurately identified, that is, whether the individual of the slash pine is a high resin yield individual or a low resin yield individual, early selection of the high resin yield slash pine is realized, and the breeding efficiency is improved.

[0021] The genotype of the slash pine at the 529th position in the sequence shown in SEQ ID NO. 1 is obtained from the genomic DNA of the to-be-tested slash pine, that is, the genotype of the SNP molecular marker at the site of the 529th position in the sequence shown in SEQ ID NO. 1 is detected. When detecting, common SNP detection methods such as mutation amplification blocking system PCR (ARMS PCR), TaqMan probe, molecular beacon and sequencing method can be used.

[0022] The technical scheme of the present application has the following beneficial technical effects:

[0023] The present application has made a significant breakthrough in the field of genetic improvement of Pinus elliottii, and its core contribution is to accurately locate a major gene locus that has a significant impact on lipid production traits. The contribution rate of this locus to the lipid production phenotype of Pinus elliottii reaches 14.1%, which lays a solid genetic foundation for high-yield breeding of Pinus elliottii. Further, the present application innovatively develops a SNP (single nucleotide polymorphism) marker closely linked to the major gene locus. The emergence of this technical tool greatly improves the precision and efficiency of high-yield breeding of Pinus elliottii.

[0024] The application of the SNP molecular marker to the 240 Pinus elliottii individuals in the F1 generation population obtained by free pollination of 240 female parents shows that in the high-lipid genotype individuals, up to 78.13% of the individuals have a lipid production significantly higher than the average level (19.71g), and in the low-lipid genotype individuals, 78.41% of the individuals have a lipid production significantly lower than the average value. This empirical data fully verifies the high effectiveness and reliability of the SNP molecular marker in assisting selection of high-lipid Pinus elliottii individuals, and provides a scientific basis for rapid screening of high-yield germplasm resources.

[0025] Especially worth mentioning is that compared with the traditional Pinus elliottii breeding which relies on the long lipid production identification process of 10 years after afforestation of seedlings, the SNP molecular marker detection method introduced by the present application shows incomparable advantages. This method is not only simple and fast to operate, but also has stable and reliable detection results, is not disturbed by external environmental factors, greatly shortens the breeding period and reduces the breeding cost. Specifically, by detecting the genotype of the locus where the SNP molecular marker is located, breeding workers can accurately evaluate and screen the lipid production performance of Pinus elliottii individuals at the seedling stage, thereby effectively avoiding resource waste and significantly improving breeding efficiency and success rate.

[0026] In summary, the implementation of the present application not only opens up a new molecular assisted selection path for high-yield breeding of Pinus elliottii, but also makes an important contribution to accelerating the genetic improvement process of Pinus elliottii and promoting the sustainable development of the forestry industry through its efficient and accurate SNP molecular marker detection method. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 The population structure diagram of the F1 generation population of Pinus elliottii in Example 2 of the present application. DETAILED DESCRIPTION

[0028] Example 1

[0029] In this example, the selection of the Pinus elliottii seedling population and the determination of the traits are carried out.

[0030] In this embodiment, 240 Pinus elliottii female parents are used to create a hybrid F1 population with widely separated economic traits by using free pollination technology. The F1 population contains 240 half-sib families, and each half-sib family contains individuals with the same female parent.

[0031] The F1 population is collected and evaluated by the Forest Tree Germplasm Research Group of the Subtropical Forestry Institute of Chinese Academy of Forestry, and is preserved in the Germplasm Garden of Changle Forest Farm, Yuhang District, Hangzhou City, Zhejiang Province.

[0032] The above-mentioned germplasm garden planted with the F1 population adopts a completely randomized block design, with 6 single-row plots and 6 repetitions, and is preserved in Changle Forest Farm, Yuhang District, Hangzhou City, Zhejiang Province. When the tree age reaches 26a, select 3 single plants with good growth vigor from each family for resin tapping, collect them in a resin tapping tube, weigh them, collect them for 24h, calculate the average value of the resin yield of the three trees to represent the resin yield phenotype of the family, and obtain 720 sample resin yield data, and calculate the average resin yield of 3 samples per family. The results show that the resin yield of the F1 population is significantly different, indicating that the resin yield trait is a quantitative trait.

[0033] Example 2

[0034] In this embodiment, the F1 population is analyzed for population structure. The analysis results will be used for SNP and resin yield phenotype data association analysis.

[0035] 1. RNA extraction from the population

[0036] In July 2019, 1 single plant with the best growth vigor was selected from each of the 240 half-sib families in Example 1 for fresh secondary xylem collection. RNA was extracted using DP441 polysaccharide and polyphenol RNA extraction kit (Tiangen Biological Products). Fresh secondary xylem of Pinus elliottii was used as a sample during RNA extraction, and the specific steps were the same as the kit instructions.

[0037] 2. Transcriptome sequencing

[0038] (1) The purity, concentration and integrity of the RNA sample were detected by Nanodrop, Qubit 2.0 and Aglient 2100 instruments (qualified standards: A260 / A280>2.0; A260 / A230>2.5; RNA integrity>8; 28S / 18S>1; RNA concentration>150ng / μL; total RNA quality>2.5ng).

[0039] (2) After the RNA sample was detected to be qualified, the eukaryotic mRNA was enriched by magnetic beads with Oligo(dT).

[0040] (3) To the enriched mRNA sample, add RNA Fragmentation Reagents (Thermo Fisher Scientific product, item number AM8740) to randomly fragment the mRNA to generate short fragments.

[0041] (4) Use the SuperScript TM IV First-Strand Synthesis System kit (Thermo Fisher Scientific product, item number 18091050) to synthesize the first cDNA strand using the fragmented mRNA fragments as templates with random hexamers (provided in the kit), then add buffer, dNTPs, RNase H and DNA polymerase I to the solution containing the synthesized first cDNA strand to synthesize the second cDNA strand to obtain double-stranded cDNA; use AMPure XP magnetic beads (Beckman Coulter product) to purify the obtained double-stranded cDNA.

[0042] (5) Perform end repair, A-tailing and sequencing adapter ligation on the purified double-stranded cDNA, then use AMPure XP magnetic beads (Beckman Coulter product) for fragment size selection. The selected fragment size is 200-500 bp.

[0043] (6) Use PCR method to amplify the selected cDNA fragments to obtain the final cDNA library. The primer used in PCR is P5.

[0044] (7) After the library construction is completed, use Qubit 2.0 and Agilent 2100 to detect the concentration and insert size of the library, and use Q-PCR method to accurately quantify the effective concentration of the library to ensure the quality of the library. The sequence of the primer used in Q-PCR is designed according to the sequence of the sequencing adapter. When the effective concentration of the library reaches ≥2nM, the quality of the library is qualified.

[0045] (8) After the quality of the library is qualified, use Illumina HiSeqX platform for high-throughput sequencing, and the double-end sequencing read length is PE150. This step will obtain 240 raw sequencing results (Raw Reads) of Pinus elliottii second-generation transcriptome sequencing.

[0046] 3. SNP molecular marker identification and genotyping

[0047] (1) Using Trim_galore software to filter the raw sequencing results of 240 Pinus elliottii second-generation transcriptomes, removing sequencing adapter sequences to obtain processed sequencing results (Clean Reads).

[0048] (2) Using a library construction method suitable for third-generation sequencing, for the above 240 Pinus elliottii, a mixed tissue was used to construct a third-generation sequencing cDNA library, and then a PacBio [Pacific Biosciences, enabled using single molecule, real-time (SMRT) sequencing technology] was used to perform long-read sequencing on the third-generation sequencing cDNA library. The obtained sequencing results are the Pinus elliottii third-generation full-length transcript sequencing results. STAR software was used to construct an index file of Pinus elliottii third-generation full-length transcripts as a reference sequence.

[0049] (3) Using STAR software to align the processed sequencing results of 240 Pinus elliottii second-generation transcriptomes with the reference sequence obtained in step (2), and removing sequences that do not align.

[0050] (4) Using GATK software to identify and filter SNPs from the above processed sequencing results (Clean Reads). The specific criteria are: QualByDepth (QD) > 2.0, FisherStrand (FS) > 30.0, RMSMappingQuality (MQ) > 40.0, MQRankSum > -12.5, ReadPosRankSum > -8.0, SOR > 3.0. After filtering, high-quality SNP site genotype data is obtained. The software used above is publicly available and free.

[0051] 4. Genetic variation analysis

[0052] Plink v1.9 was used to filter the SNP site genotype data of 240 Pinus elliottii, retaining SNP sites with a minor allele frequency (MAF) greater than 0.05, a site integrity greater than 0.8, and a correlation below 0.2 for genetic variation and population structure analysis.

[0053] The average inbreeding coefficient of 240 Pinus elliottii on sc311225.graph_c0_seq1_529 calculated by Vcftools v0.0.13 was 0.137, the average expected heterozygosity was 0.225, the average observed heterozygosity was 0.283, and the average effective allele number was 1.291.

[0054] 5. Population structure and kinship analysis

[0055] The PLINK v1.9 software was used to calculate the genetic diversity parameters Ho, He, Fst, Fis and Nei's genetic distance of the Pinus elliottii population (F1 population), and principal component analysis (PCA) was performed, and the visualized phylogenetic tree was constructed by online ITOL (https: / / itol.embl.de); the ADMIXTURE v1.3.0 software was used to construct the genetic structure of the Pinus elliottii population, and the preset number of clusters K was 1-10, and the optimal number of clusters K was 3.

[0056] The Admixture v1.3.0 software was used to construct the population structure of the F1 population based on the filtered SNP site genotype data in "4. Genetic variation analysis", and the preset number of ancestral populations K was 1-10 for optimal clustering calculation. According to the calculation results, when K = 3, the cross-validation error rate was the lowest, that is, the F1 population can be divided into three genetic clusters, and the population structure (visualized phylogenetic tree) of the F1 population is shown in Figure 1 The GCTA v1.92.1 software was used to calculate the kinship (kinship strength) of the Pinus elliottii population (F1 population), and the kinship was between -0.2 and 0.2.

[0057] Example 3

[0058] In this embodiment, the key gene sites and linkage SNP sites of the Pinus elliottii turpentine yield (turpentine yield) trait were mined. The specific steps are as follows:

[0059] (1) Select Pinus elliottii with good growth from the F1 population described above, and collect tender leaves, old leaves, xylem, phloem and young roots as mixed tissues. RNA was extracted using the TIANGEN Biotech DP441 polysaccharide and polyphenol RNA extraction kit (produced by TIANGEN Biotech), and cDNA library was constructed using mRNA as template. The construction method of the cDNA library is the commonly used cDNA library construction method for three-generation sequencing. Long-read sequencing was performed on the cDNA library using PacBio [Pacific Biosciences, enabled using single molecule, real-time (SMRT) sequencing technology]. The sequencing results obtained are the full-length transcripts of Pinus elliottii.

[0060] (2) From each half-sib family, 1 plant with the best growth vigor was selected, and fresh secondary xylem tissues of 240 single plants were collected. RNA was extracted using the TIANGEN DP441 polysaccharide and polyphenol RNA extraction kit (TIANGEN Biotech Co., Ltd., Beijing, China), and a cDNA library was constructed using mRNA as a template (the method was the same as the cDNA library construction method in "2, transcriptome sequencing" in Example 2). Illumina NovaSeq 6000 platform sequencing was used.

[0061] (3) Using the full-length transcript of Pinus elliottii in step (1) as a reference sequence, the SNP sites of the 240 samples obtained in step (2) were analyzed. The SNP data was filtered according to the following standards:

[0062] a. Only di-allelic SNPs were retained;

[0063] b. SNP sites with a deletion rate of ≥95% and a minor allele frequency of ≤0.05 were removed;

[0064] c. Individuals with a genotype frequency of less than 50% were excluded.

[0065] The above three standards need to be met at the same time. The software STAR, GATK and VCFtools used to filter the SNP data are all publicly available and free. After filtering, a total of 53229 SNP sites were obtained.

[0066] (4) Population structure and kinship were calculated. The method was the same as "5. Population structure and kinship analysis" in Example 2.

[0067] (5) The mixed linear model of the TASSEL software was used for association analysis of the genotype data of the turpentine yield, and the population structure and kinship were used as covariates. The extremely significant threshold was set to P≤9.4e-07 (0.05 / 53229), and the significant threshold was set to P≤1.9e-06 (0.1 / 53229). This step obtained SNP sites significantly associated with the turpentine yield of Pinus elliottii. The genes linked to these SNP sites (or the genes where these SNP sites are located) are the candidate genes significantly associated with the turpentine yield of Pinus elliottii.

[0068] Using the above method, a candidate gene c311225.graph_c0 (PeERF) significantly associated with the turpentine yield of Pinus elliottii was isolated in this example, and the contribution rate of the gene to the phenotype (turpentine yield) was 14.1% (as shown in Table 1).

[0069] The SNP molecular marker closely linked to the locus is sc311225.graph_c0_seq1_529, which is located at 529 of the full-length transcriptome of the PeERF gene of Pinus elliottii, and the polymorphism is C / T, wherein C is the mutant base and T is the reference base. As shown in Table 1, the molecular marker information of the candidate gene PeERF and the closely linked SNP of the candidate gene PeERF is shown.

[0070] Table 1: Molecular marker information of candidate gene and linked SNP

[0071] candidate genes linkage SNPs polymorphism contribution rate significance c311225.graph_c0 sc311225.graph_c0_seq1_529 C / T 14.1％ 3.43E-07

[0072] The full-length transcriptome sequence of the PeERF gene is shown in SEQ ID NO. 1.

[0073] SEQ ID NO. 1 (underlined base is the reference base at the SNP site):

[0074] ATGTTTCATTGTGAGTAATCACTATTTTCTCCCGAAGTTCCTCCTGTTTATATATAAGTTTTAGCGGAAAGCAGAGCGCATGTTTCATTGTGAGTAGTCACTATTTTCTTCATCACGCCATTGCTTTGTGTTCTGCGGAGGCAGCAACAGTTGTTTGAAAACAAAAGGATGTGTGAAGGTGCCATAACTGCGGATTTCATTGCCGCGAACCAATCCCGGCGTATTTCTGCCAGGGATTTTTGGCCGGATTTCGATACCTTCTATGACTTGTTCTTCAATGGCGGAGCCGTGTCTGAATCCATCAATAAATCGGGCAGCTTCGACGACGCATACAACCGGAAGAATAAGACGAGCAAGAATATTTTCAACTCCAAGCATGAATTTTCTTCAGGTGCTGGAAATGAGGCCATTCCTCCTTTGAAGGATTTCGAAAAGTCCTCGGCCAAGAGCACCAAGAGGAAGAGGAGGAATTTGTACAGAGGTATCAGGCAGCGTCCATGGGGAAAATGGGCTGCCGAGATTCGAGAT T

[0075] Example 4

[0076] This example mainly relates to the application of SNP molecular marker linked to PeERF gene in breeding of Pinus elliottii.

[0077] According to the SNP molecular marker mined in Example 2, the 240 Pinus elliottii individuals selected in Example 2 were typed. That is, the base composition of the 240 Pinus elliottii individuals at SNP site sc311225.graph_c0_seq1_529 was detected (by sequencing method), and according to the base composition of the SNP site of each Pinus elliottii individual, the genotype of the Pinus elliottii individual at SNP site sc311225.graph_c0_seq1_529 was determined. In addition, the individual turpentine yield of the 240 Pinus elliottii individuals was detected, and the detection method of the turpentine yield was the same as that in Example 1. The genotype and the turpentine yield are shown in Table 2, wherein the individual turpentine yield is the average value after multiple measurements. In the table, the genotype column indicates the base composition at the SNP site on the two homologous chromosomes of Pinus elliottii, TC indicates that the base at the SNP site on one chromosome of the Pinus elliottii individual is C and the base on the other chromosome is T; TT indicates that the base at the SNP site on the two chromosomes of the Pinus elliottii individual is T. Since C is the mutation type, and the 240 Pinus elliottii individuals are all from the F1 generation population, there is no individual with genotype CC in the 240 Pinus elliottii individuals.

[0078] Table 2 Average turpentine yield and genotype data of 240 Pinus elliottii half-sib families

[0079]

[0080]

[0081] From the results in the table, it can be seen that among the individuals with high turpentine yield genotype (CT) of SNP site sc311225.graph_c0_seq1_529, 78.13% of the individuals have a turpentine yield higher than the average value (19.71 g) of the population turpentine yield, and among the individuals with low turpentine yield genotype (TT), 78.41% of the individuals have a turpentine yield lower than the average value (19.71 g) of the population. This indicates that the SNP site as a SNP molecular marker for the assisted selection of high turpentine yield individuals of Pinus elliottii is effective.

[0082] Example 5 Identification of turpentine yield genotype of Pinus elliottii

[0083] The genomic DNA of the Pinus elliottii to be tested was extracted by using TaKaRa MiniBEST Plant Genomic DNA Extraction Kit (TaKaRa, Dalian, China), and the genomic DNA of the Pinus elliottii to be tested was used as the template DNA for PCR, and the following primers were used for PCR amplification:

[0084] SEQ ID NO. 2: 5'-ACAAAAGGATGTGTGAAGGT-3';

[0085] SEQ ID NO. 3: 5'-AGGGTTCCATTTGACTGTTT-3'.

[0086] The PCR reagent kit was TaKaRa Taq TM DNA Polymerase (product code R001A). The volume of the PCR reaction system was 50 μL, and the reaction system contained 0.25 μL of Taq enzyme, 5 μL of 10×PCR Buffer, 4 μL of dNTP mixture, 200 ng of template DNA (genomic DNA of Pinus elliottii), the primer shown in SEQ ID NO. 2 (F primer) and the primer shown in SEQ ID NO. 3 (R primer); the concentration of the two primers in the reaction system was 0.2-1.0 μmol / L. The PCR was performed by using a two-step method, and the specific reaction program was as follows: 94°C pre-denaturation for 3 min; 94°C denaturation for 15 s, 60°C annealing and extension for 50 s, 30 cycles; 60°C complete extension for 4 min.

[0087] In other embodiments, the reaction program of the PCR can also be appropriately adjusted as needed, but the temperature, time and cycle number of the reaction should be within the following ranges:

[0088] 94-95°C pre-denaturation for 3-5 min; 94-95°C denaturation for 15-30 s, 60-65°C annealing and extension for 40-60 s, 30-35 cycles; 65-70°C complete extension for 4-6 min.

[0089] After obtaining the PCR product, agarose gel electrophoresis was performed by using an agarose gel with a concentration of 1.2 wt%, and the AxyPrep DNA Gel Recovery Kit (AxyGEN product, product code AP-GX-50) was used to recover the band with correct length, to obtain the recovery product, which was further sequenced to determine the genotype of the Pinus elliottii to be tested at the SNP site sc311225.graph_c0_seq1_529. If the genotype is CT, the Pinus elliottii to be tested is a high-lipid Pinus elliottii; if the genotype is TT, the Pinus elliottii to be tested is a low-lipid Pinus elliottii.

[0090] The SNP site is universal for Pinus elliottii species and can be used to identify the lipid yield phenotype of different families of Pinus elliottii.

[0091] Obviously, the above embodiments are merely exemplary and not limiting. Based on the above description, one of ordinary skill in the art can make other different forms of changes or modifications. Here, it is not necessary and impossible to exhaust all the embodiments. The obvious changes or modifications derived therefrom are still within the protection scope of the patent application claims.

Claims

1. A SNP molecular marker characterized in that, The sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein the base at position 529 of the sequence is T or C.

2. Use of a SNP molecular marker, characterized in that, The SNP molecular marker is the SNP molecular marker of claim 1, and the application is for predicting the high or low of the lipid yield of Pinus elliottii, or for improving the lipid yield of Pinus elliottii, or for molecular marker assisted breeding of Pinus elliottii.

3. Use of a SNP molecular marker according to claim 2, characterized in that, When predicting the high or low of the lipid yield of Pinus elliottii, the genotype of the Pinus elliottii to be tested at position 529 of the sequence shown as SEQ ID NO. 1 is obtained from the genomic DNA of the Pinus elliottii to be tested, and when the genotype is CT, the Pinus elliottii to be tested is a high-lipid-yield individual, and when the genotype is TT, the Pinus elliottii to be tested is a low-lipid-yield individual.

4. The use of a SNP molecular marker according to claim 3, characterized in that, When the genotype of the Pinus elliottii to be tested at position 529 of the sequence shown as SEQ ID NO. 1 is obtained from the genomic DNA of the Pinus elliottii to be tested, PCR is performed using the genomic DNA of the Pinus elliottii to be tested as the template DNA to obtain a PCR product, and after purification of the PCR product, sequencing is performed to obtain the genotype of the Pinus elliottii to be tested at position 529 of the sequence shown as SEQ ID NO.

1.

5. Use of a SNP molecular marker according to claim 4, characterized in that, When the genomic DNA of the Pinus elliottii to be tested is subjected to PCR, the volume of the PCR reaction system used is 50 μL, and the PCR reaction system contains 0.25 μL of Taq enzyme, 5 μL of 10×PCR Buffer, 4 μL of dNTP mixture, 200 ng of template DNA, F primer and R primer.

6. The use of a SNP molecular marker according to claim 5, characterized in that, The sequences of the F primer and the R primer are shown as SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

7. Use of a SNP molecular marker according to claim 6, characterized in that, The reaction program during PCR is as follows: pre-denaturation at 94-95 ℃ for 3-5 min; denaturation at 94-95 ℃ for 15-30 s, annealing and elongation at 60-65 ℃ for 40-60 s, 30-35 cycles; and complete elongation at 65-70 ℃ for 4-6 min.

8. The use of a SNP molecular marker according to claim 7, characterized in that, The reaction program during PCR is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 15 s, annealing and elongation at 60 ℃ for 50 s, 30 cycles; and complete elongation at 60 ℃ for 4 min.

9. The use of the SNP molecular marker according to claim 4, characterized in that, When the PCR product is purified, agarose gel electrophoresis and gel cutting purification are performed in sequence, and when the agarose gel electrophoresis is performed, an agarose gel with a concentration of 1.2 wt% of agarose is used.

Images