Application of PsWOX11 gene in regulating lateral root growth and development of poplar

Abstract

The present invention discloses the application of the PsWOX11 gene in regulating the growth and development of poplar lateral roots, belonging to the technical field of genetic engineering. Regulating the growth and development of poplar lateral roots is to promote the growth and development of poplar lateral roots by overexpressing the PsWOX11 gene, or to inhibit the growth and development of poplar lateral roots by inhibiting the expression of the PsWOX11 gene. The PsWOX11 gene plays an important regulatory role in the growth and development of poplar lateral roots, and has important application value in forest tree molecular design breeding and the selection of excellent varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to the application of a PsWOX11 gene in regulating the growth and development of poplar lateral roots. Background Art

[0002] The root system is an important vegetative organ of higher plants, and adventitious roots are an important part of the root system. The branched roots produced by lateral roots or adventitious roots are collectively referred to as lateral roots. The formation of adventitious roots and lateral roots can expand the plant root system, which is of great significance for plant asexual reproduction and in vitro regeneration of explants. Moreover, the formation of lateral roots is an important strategy for plants to cope with environmental stresses. Studying the formation of poplar adventitious roots and their lateral roots can also provide help for the study of plant root plasticity under stress.

[0003] The occurrence of lateral roots is a complex biological process, which is regulated by multiple endogenous hormones and environmental factors. For many years, due to the limitations of research techniques, means, and genetic materials, the research and understanding of the molecular regulatory mechanism of plant lateral root growth and development have mainly focused on herbaceous model plants (such as rice and Arabidopsis). At present, multiple transcription factor families have been identified to participate in the regulation of lateral root occurrence and growth and development, such as ARF (Auxin Response Factor), Lateral organ Boundaries Domain (LBD), ERF (Ethylene Responsive Factor), etc. In addition, the WOX (WUSCHEL related-homeobox) transcription factor also participates in the growth and development of lateral roots. WOX is a plant-specific sub-branch in the eukaryotic homeobox protein family, containing a conserved DNA-binding domain composed of 65 amino acid residues, and plays an important regulatory role in key developmental processes such as plant embryogenesis, stem cell maintenance, and organogenesis. Due to the complexity of the growth and development of tree adventitious roots and lateral roots, and the obvious differences in physiology, morphological structure, and growth and development, there may be a molecular mechanism of lateral root growth and development in trees that is different from that of herbaceous plants.

[0004] Therefore, it is very meaningful to study the molecular mechanism of the regulation of poplar lateral root growth and development by the poplar WOX gene using the model woody plant poplar. Although it has been reported in the prior art that overexpressing the PtoWOX11 / 12a gene can increase the length of Populus tomentosa lateral roots, the prior art has not reported the effect of the PsWOX11 gene on the diameter and density of lateral roots. Summary of the Invention

[0005] In order to solve the above-mentioned deficiencies existing in the prior art, the purpose of the present invention is to provide the application of a PsWOX11 gene in regulating the growth and development of poplar lateral roots, and this gene can regulate the density and diameter of poplar lateral roots.

[0006] The technical solution of the present invention for solving the above technical problems is as follows: Provide an application of the PsWOX11 gene in regulating the growth and development of poplar lateral roots, wherein the nucleotide sequence of the PsWOX11 gene is as shown in SEQ ID NO.1.

[0007] Further, regulating the growth and development of poplar lateral roots is to promote the growth and development of poplar lateral roots by overexpressing the PsWOX11 gene.

[0008] Further, promoting the growth and development of poplar lateral roots is to increase the density and diameter of poplar lateral roots.

[0009] Further, regulating the growth and development of poplar lateral roots is to inhibit the growth and development of poplar lateral roots by inhibiting the expression of the PsWOX11 gene.

[0010] Further, inhibiting the growth and development of poplar lateral roots is to reduce the density and diameter of poplar lateral roots.

[0011] A preparation for regulating the growth and development of poplar lateral roots, which contains the PsWOX11 gene.

[0012] A method for promoting the growth and development of poplar lateral roots, comprising the following steps:

[0013] Promote the growth and development of poplar lateral roots by overexpressing the PsWOX11 gene.

[0014] The present invention has the following beneficial effects:

[0015] Based on the analysis of the quantitative trait QTL (quantitative trait gene) mapping results of poplar hybrid offspring, the present invention identifies a gene WOX11 related to the growth and development traits of lateral roots, that is, the gene PsWOX11 that regulates the growth and development of Populus simonii Carr. lateral roots. The nucleotide sequence length of the coding region of this gene is 768bp, and it can encode 255 amino acid residues.

[0016] The present invention fuses the coding region sequence of the PsWOX11 gene with the strong promoter CaMV 35S, clones it into a plant overexpression vector, and constructs an overexpression vector of the PsWOX11 gene.

[0017] Fuse the coding region sequence of the PsWOX11 gene with the EAR repression domain (SRDX sequence), clone it into a plant overexpression vector, and construct a dominant repression expression vector of the PsWOX11 gene.

[0018] Using the above two vectors, Populus alba×P. glandulosa, ‘84K’ was transformed by Agrobacterium-mediated method to obtain PsWOX11 overexpression plants (PsWOX11-OE-1, PsWOX11-OE-2, PsWOX11-OE-3, PsWOX11-OE-4, PsWOX11-OE-5, PsWOX11-OE-6 and PsWOX11-OE-7) and dominant repression plants (PsWOX11-SRDX-1, PsWOX11-SRDX-2, PsWOX11-SRDX-3, PsWOX11-SRDX-4, PsWOX11-SRDX-5, PsWOX11-SRDX-6, PsWOX11-SRDX-7 and PsWOX11-SRDX-8).

[0019] Phenotypic and microscopic morphological observations were carried out on the above obtained transgenic lines. It was found that compared with non-transgenic plants, the overexpression transgenic plants had a higher lateral root density and thicker diameter, which were significantly higher than those of non-transgenic plants, while the dominant repression transgenic plants had a lower lateral root density and thinner diameter, which were significantly lower than those of non-transgenic plants.

[0020] The above research results indicate that the PsWOX11 gene plays an important regulatory role in the growth and development of poplar lateral roots, and it has important application value in forest tree molecular design breeding and the selection of fine varieties. Description of the Drawings

[0021] Figure 1 It is the cloning electrophoresis map of the poplar PsWOX11 gene; among them, M: DNA Marker DL2000; CK: using water as a template; 1-7: PCR identification of positive clone bacteria.

[0022] Figure 2 It is the detection map of PsWOX11 transgenic poplars; among them, Figure A is the detection map of the DNA level of overexpressed PsWOX11 transgenic poplars. In the electrophoresis map, from left to right are Marker, CK, OE1, OE2, OE3, OE4, OE5, OE6 and OE7; Figure B is the detection map of the DNA level of dominant repression PsWOX11 transgenic poplars. In the electrophoresis map, from left to right are Marker, CK, SRDX1, SRDX2, SRDX3, SRDX4, SRDX5, SRDX6, SRDX7, SRDX8; Figure C is the detection map of the RNA level of PsWOX11 transgenic poplars.

[0023] Figure 3Figure showing the comparison of lateral root growth of PsWOX11 transgenic and non-transgenic poplars in culture medium; among them, Figures A and B show the lateral root phenotypes of PsWOX11 transgenic and non-transgenic 84K poplars; Figure C shows the results of lateral root density of PsWOX11 transgenic and non-transgenic 84K poplars.

[0024] Figure 4 Figure showing the comparison of lateral root diameters of PsWOX11 transgenic and non-transgenic poplars. Detailed implementation mode

[0025] The following examples are only used to explain the present invention and are not used to limit the scope of the present invention. For those not specified in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0026] Example 1

[0027] I. Cloning of Poplar PsWOX11 Gene

[0028] The cloning process of the poplar PsWOX11 gene is as follows:

[0029] (1) Using Populus simonii as the material, extract the total RNA of the roots of Populus simonii using a plant total RNA extraction kit (Tiangen). After removing genomic DNA contamination, use the PrimeScript TM RT reagent Kit (TaKaRa) reverse transcription kit to synthesize the first strand of cDNA. The specific reaction system is: 1 μg total RNA, 4 μL 5×Primescript Buffer, 1 μL Prime Script RT Enzyme, 1 μL Oligo dT Primer, 1 μL Random6mers, supplemented with RNase-free water to 20 μL; the reaction program is 37 °C, 15 min; 85 °C, 5 s.

[0030] (2) Refer to the gene sequence of the PsWOX11 gene in the Populus simonii genomic data and design primers (the amplified fragment contains the start codon and the stop codon). The specific primer sequences are as follows:

[0031] The forward primer PsWOX11-F sequence is: 5’-ATGGAAGATAATCAAGGCCAAG-3’ (SEQ ID NO.3);

[0032] The reverse primer PsWOX11-R sequence is 5’-TTATGCTCCAGAGATGATTACC-3’ (SEQ ID NO.4).

[0033] Using cDNA as a template, HSDNA Polymerase (TaKaRa) was used to amplify the full-length coding region sequence of the PsWOX11 gene. The specific reaction system was as follows: 1 μL of cDNA template, 1 μL each of forward and reverse primers (10 μM), 10 μL HSDNA Polymerase, and nuclease-free water was added to make up to 20 μL; the reaction program was pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 90 s, for 30 cycles; extension at 72 °C for 7 min.

[0034] (3) The amplified target fragment was purified using a PCR purification kit (OMEGA), and the purified product was ligated to the cloning vector pMD TM 19-T (TaKaRa). The ligation reaction system was 5 μL of Solution I, 1 μL of pMDTM 19-T (50 ng / μL), 0.5 μg of PCR purified product, and nuclease-free water was added to make up to 10 μL; the reaction condition was incubation at 16 °C overnight. Take 5 μL of the ligation product, and transfer it to competent Escherichia coli DH5α cells by heat shock transformation for blue-white screening. After selecting white colonies for large-scale culture, 2 μL of the bacterial solution was taken as a template for PCR detection. The specific reaction system and program were as in step (2). Take 5 μL of the amplified product for agarose gel electrophoresis detection. The result showed that the single band detected was exactly the same size as the full-length PsWOX11 gene, and it was initially considered that the PsWOX11 gene had been successfully cloned (see the specific results in Figure 1 ). The positive transformant was sent to Sangon Biotech Co., Ltd. for Sanger sequencing. Finally, the nucleotide sequence length of the coding region of the PsWOX11 gene was 768 bp, encoding 255 amino acid residues. Its nucleotide sequence and amino acid sequence are as follows:

[0035] ATGGAAGATAATCAAGGCCAAGACCCTAATAGTCCAAGCAACCATGCCACCGAAAGAAGCGAACCGGTGAGGTCACGGTGGACTCCAAAGCCAGAGCAAATATTGATACTTGAGTCCATCTTTAACAGTGGAATGGTAAACCCACCAAAGGATGAAACTGTGAGAATAAGGAAACTTCTAGAAAAATTTGGTTCTGTTGGTGATGCAAATGTCTTCTACTGGTTTCAAAACCGACGATCAAGATCTCGCCGCCGGCAACGCCAGATGCAGGCTAGTCTGGTTGCAGCAGAGCAAACAAATAATCAACAGGCACAAGCTAGTGGTGGTGCAATTCAATATAAAGGTTGTAACACTTCTATTGGGTTTGCAAATTCTCCTTCTTTTGTTCAATCCCCGTCTTCTTATCTTGTTGGTTCCTCTTCTTCTTATGGAGTTGTTGATGAAGATCATGGTGGAGAGAGTCTGTATTCTTTCTCTAATCAAATGGCCTTTCAAGAAGTGGAGCAAACCTCTGGTGTAACTTCAATTTTATACCCATCGGAGACTTCTAATTTGCATTACCAAACTGCTGGATTCATCACAGTTTTCATCAACGGGATTCCCACAGAAGTTCCAAGGGGGCCACTTGACATGAAAGCAATGTTTGGTCAAGATGTAGTGTTGGTCCATTCTTCTGGAGTGCCGGTACCCACTAATGAATTTGGGTTTCTAATGCAGAGCTTGCATCATGGTGAAAGCTATTTCCTGGTAATCATCTCTGGAGCATAA(SEQ ID NO.1).

[0036] MEDNQGQDPNSPSNHATERSEPVRSRWTPKPEQILILESIFNSGMVNPPKDETVRIRKLLEKFGSVGDANVFYWFQNRRSRSRRRQRQMQASLVAAEQTNNQQAQASGGAIQYKGCNTSIGFANSPSFVQSPSSYLVGSSSSYGVVDEDHGGESLYSFSNQMAFQEVEQTSGVTSILYPSETSNLHYQTAGFITVFINGIPTEVPRGPLDMKAMFGQDVVLVHSSGVPVPTNEFGFLMQSLHHGESYFLVIISGA*(SEQ ID NO.2).

[0037] II. Construction of Plant Expression Vector of Poplar PsWOX11 Gene

[0038] 1. Construction of Overexpression Vector of PsWOX11 Gene

[0039] After expanding and culturing the correctly sequenced clone, use a plasmid extraction kit (OMEGA) to extract the pMD TM 19-T vector plasmid containing the PsWOX11 gene; using GATEWAY technology, design primers, and the specific primer sequences are as follows:

[0040] The forward primer sequence is:

[0041] 5’- GGGGACAACTTTGTACAAAAAAGTTGGA ATGGAAGATAATCAA GGCCAAG-3’(SEQ IDNO.5);

[0042] The reverse primer sequence is:

[0043] 5’- GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTA TTATGCTC CAGAGATGATTACC-3’(SEQID NO.6).

[0044] Using the plasmid as a template, amplify the full-length coding sequence of the PsWOX11 gene. The specific reaction system and reaction program are the same as those for constructing the pMD TM 19-T recombinant vector.

[0045] After purifying the amplified target fragment, connect the purified product with the intermediate vector pDNOR207 through the BP reaction, transfer it to Escherichia coli DH5α competent cells by heat shock transformation for gentamicin resistance screening. After expanding and culturing the positive monoclonal with resistance, take 2 μL of the bacterial liquid as a template for PCR detection. The specific reaction system and reaction program are the same as those for constructing the pMD TMIt was the same as the pMD19-T recombinant vector. The positive transformants were sent to Sangon Biotech Co., Ltd. for Sanger sequencing verification.

[0046] After the positive clones were expanded and cultured, the plasmids were extracted and then subjected to LR reaction with the plant expression vector pMDC32. After the reaction, the full-length coding sequence of the PsWOX11 gene was introduced into the plant expression vector pMDC32, fused with the strong promoter CaMV 35S (Cauliflower mosaic virus 35S), and transferred to Escherichia coli DH5α competent cells by heat shock transformation for gentamicin resistance screening. After the resistant positive monoclonal clones were expanded and cultured, 2 μL of the bacterial solution was taken as a template for PCR detection. The specific reaction system and reaction program were the same as those for constructing the pMD TM 19-T recombinant vector. The positive transformants were sent to Sangon Biotech Co., Ltd. for Sanger sequencing verification, and the plant overexpression vector pMDC32-PsWOX11 carrying the full-length coding sequence of the PsWOX11 gene was obtained.

[0047] 2. Construction of the dominant repression expression vector of the PsWOX11 gene

[0048] The reverse primer sequence designed with an EAR (ERF-associated amphiphilic repression) repression domain (SRDX sequence) was 5’- GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTA ttaCAAACGGAGTTCTAGATCTGCTCCAGAGATGATTACC-3’ (SEQ ID NO.7). Combining with the forward primer in step 1, using the plasmid as a template, the full-length coding sequence of the PsWOX11 gene with SRDX was amplified; then it was ligated to the intermediate vector pDNOR207 by the method in step 1, and then introduced into the plant expression vector pMDC32, fused with the strong promoter CaMV 35S, and the recombinant vector carrying the full-length coding sequence of the PsWOX11 gene with SRDX was the dominant repression plant expression vector pMDC32-PsWOX11-SRDX.

[0049] III. Genetic transformation and detection of the Populus PsWOX11 gene

[0050] 1. Genetic transformation of the Populus PsWOX11 gene

[0051] The PsWOX11 gene plant overexpression vector and the dominant repression plant expression obtained in step 2 were respectively transferred to the Agrobacterium competent cell GV3101 by electroporation transformation to obtain the recombinant bacteria GV3101-pMDC32-PsWOX11 and GV3101-pMDC32-PsWOX11-SRDX.

[0052] The recombinant bacteria GV3101-pMDC32-PsWOX11 and GV3101-pMDC32-PsWOX11-SRDX were transformed into Populus alba×P. glandulosa using the Agrobacterium-mediated genetic transformation method for poplar calli (this method can refer to the literature "Shuang-Shuang Wen, Xiao-Lan Ge, Rui Wang, et al. An efficient agrobacterium-mediated transformation method for hybrid poplar 84K (Populus alba×P. glandulosa) using calli as explants. International Journal of Molecular Sciences, 2022, 23(4):2216". The recombinant Agrobacterium was propagated at 28 °C, and the propagated bacterial solution was used for infection). After induction culture, the resistant adventitious buds were transferred to a rooting medium containing hygromycin and ticarcillin until induced rooting to form complete plants.

[0053] 2. Detection of Populus alba×P. glandulosa PsWOX11 transgenic plants

[0054] Genomic DNA was extracted from the leaves of resistant PsWOX11 transgenic plants and non-transgenic 84K plants. PCR amplification was performed using a sequence 5'-GACGCACAATCCCACTATCC-3' ((SEQ ID NO.8)) on the CaMV 35S promoter and PsWOX11-R as primers to detect PsWOX11 transgenic poplars at the DNA level. The results are shown in Figure 2 .

[0055] From Figure 2 the agarose gel electrophoresis results in, a total of 7 overexpression transgenic lines and 8 dominant repression transgenic lines were able to amplify clear bands, which were transgenic plants ( Figure 2 A and B).

[0056] Select the lateral roots of transgenic plants and non-transgenic plants (as controls), extract the total RNA of the samples and reverse transcribe it. Using PsWOX11-qPCR-F and PsWOX11-qPCR-R as quantitative primers, perform quantitative analysis of PsWOX11 transgenic poplars at the RNA level. Among them, the expression levels of the PsWOX11 gene in the overexpression transgenic lines PsWOX11-OE-1 and PsWOX11-OE-3 are 12.3 and 11.1 times that of non-transgenic plants respectively, and the expression levels in the dominant repression transgenic lines PsWOX11-SRDX-2 and PsWOX11-SRDX-6 are 9.2 and 11.9 times that of non-transgenic plants respectively ( Figure 2 C).

[0057] IV. Phenotypic Observation of PsWOX11 Transgenic Poplar Plants

[0058] Cut the tips (~3 cm) of the tissue culture seedlings of PsWOX11 overexpression transgenic plants, dominant repression transgenic plants and non-transgenic plants with the same size and insert them into 1 / 2MS solid medium to observe the effect of PsWOX11 on the growth and development of lateral roots. Each experiment is set with at least 3 biological replicates, and each genotype of plants contains at least 10 individuals. After 3 weeks of culture, compared with non-transgenic plants, the overexpression transgenic plants have a higher lateral root density, significantly higher than that of non-transgenic plants, while the dominant repression transgenic plants are relatively smaller, significantly lower than that of non-transgenic plants (see details in Figure 3 ). In addition, select the lateral roots at the same distance from the root tip for transverse dissection and find that the lateral root diameter of the overexpression transgenic plants is significantly larger than that of non-transgenic plants, while the dominant repression transgenic plants are the opposite, significantly lower than that of non-transgenic plants (see details in Figure 4 ).

[0059] The above are only the preferred embodiments of the present invention, and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. PsWOX11 Application of genes in increasing lateral root density and diameter of poplar trees, the PsWOX11 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the application is to overexpress PsWOX11 Genes to increase lateral root density and diameter in poplar trees.

2. Through inhibition PsWOX11 Use of gene expression in reducing lateral root density and diameter in poplar trees, the PsWOX11 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. A method for promoting the growth and development of poplar lateral roots, characterized in that: The following steps are involved: Through overexpression PsWOX11 Gene to increase poplar lateral root density and diameter, the PsWOX11 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images