A carbonyl reductase mutant, immobilized carbonyl reductase and its application

Abstract

The invention discloses a carbonyl reductase mutant, an immobilized carbonyl reductase and its application, and relates to the field of genetic engineering and enzyme engineering technology. A carbonyl reductase mutant, whose amino acid sequence is shown in SEQ ID NO.1; a carbonyl reductase mutant crude enzyme solution is mixed with chitosan microspheres, a glutaraldehyde solution is added dropwise, oscillation cross-linked, and washed with water to obtain an immobilized carbonyl reductase. The enzyme activity of the immobilized carbonyl reductase prepared in the present application is increased by 5-10 times compared with that of the wild type. When eslicarbazepine is prepared by asymmetric reduction catalyzed by immobilized carbonyl reductase, the substrate concentration reaches 80-150 g / L, the chiral purity value is greater than 99%, and the conversion rate is greater than 99%. The immobilized enzyme of the present invention can be recovered by simple filtration, can be repeatedly used more than 5 times after recovery, and the chiral purity and conversion rate of the reaction used for the first time are substantially the same when reused, and has a high potential for industrial application.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering and enzyme engineering, and in particular to a carbonyl reductase mutant, immobilized carbonyl reductase and applications thereof. Background Art

[0002] Eslicarbazepine acetate (Formula I), also known as eslicarbazepine acetate, is a new type of anti-epileptic drug that can block the activity of voltage-gated sodium channels and inhibit abnormal discharges of brain nerves. Its English name is Eslicarbazepine acetate, its chemical name is [(S)-(–)-10-acetic acid-10,11-dihydro-5H-dibenzo[b,f]azepine-5-carboxamide, and its molecular formula is C 17 H 16 N2O3, molecular weight 296.32, CAS number 236395-14-5, structural formula as Ⅰ.

[0003] The key to the synthesis of eslicarbazepine acetate is to obtain eslicarbazepine (Formula II) containing a chiral hydroxyl group. The preparation methods of eslicarbazepine reported in existing literature are mainly divided into two categories. One is the chemical catalytic method, which uses various catalysts and hydrogen donors to reduce oxcarbazepine to generate eslicarbazepine. However, some expensive catalytic reagents are often required in the reaction process, the overall cost is high, the reaction route is long, and it is difficult to ensure a high yield of the final product.

[0004] .

[0005] The other is biocatalysis, which uses whole cells or intracellular enzymes to reduce oxcarbazepine to obtain eslicarbazepine. In existing literature reports, the processes are all free enzymes, which cannot be recycled during the catalytic process, and are affected by factors such as temperature, pH, and organic solvents, resulting in a decrease in enzyme activity or even loss of activity, making the catalyst costly, and easily bringing impurities such as enzyme proteins into the system, and the separation steps are cumbersome. In order to improve the stability of the enzyme, promote its reuse, and facilitate post-processing and continuous industrial production, immobilized enzyme technology is widely used, but there is still no report on the use of immobilized enzymes in the preparation of eslicarbazepine. Summary of the invention

[0006] In view of the above problems existing in the prior art, the present application provides a carbonyl reductase mutant, an immobilized carbonyl reductase and applications thereof.

[0007] To solve the above problems, the present invention provides the following technical solutions:

[0008] In a first aspect, the present application provides a carbonyl reductase mutant, whose amino acid sequence is shown in SEQ ID NO.1, wherein the types of amino acid mutations include G44C, E105V and / or R209G.

[0009] In one embodiment of the present application, the carbonyl reductase and / or carbonyl reductase mutant is derived from Bacillus hilgardii ( Lentilactobacillus hilgardii).

[0010] In a second aspect, the present application provides a gene encoding a carbonyl reductase mutant, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0011] In a third aspect, the present application provides a recombinant plasmid comprising a gene encoding a carbonyl reductase mutant.

[0012] In one embodiment of the present application, the recombinant plasmid is a pET series vector.

[0013] In a fourth aspect, the present application provides a recombinant strain comprising the above-mentioned recombinant plasmid.

[0014] In one embodiment of the present application, the recombinant strain is Escherichia coli.

[0015] In a fifth aspect, the present application provides a method for preparing immobilized carbonyl reductase using a carbonyl reductase mutant, comprising the following steps:

[0016] The crude enzyme solution of the carbonyl reductase mutant was mixed with chitosan microspheres, glutaraldehyde solution was added dropwise, the mixture was shaken for cross-linking, and the mixture was washed with water to obtain immobilized carbonyl reductase;

[0017] The chitosan microspheres are obtained by dissolving chitosan in an acetic acid solution, injecting the solution into a sodium hydroxide solution, stirring the solution, and washing the solution with water until the solution is neutral.

[0018] In one embodiment of the present application, the enzyme activity of the crude enzyme solution of the carbonyl reductase mutant is 1-10 U / g.

[0019] In one embodiment of the present application, the usage ratio of chitosan to carbonyl reductase mutant crude enzyme solution is 1 g:80-120 mL.

[0020] In one embodiment of the present application, the usage ratio of chitosan to the crude enzyme solution of the carbonyl reductase mutant is 1 g:100 mL.

[0021] In one embodiment of the present application, the volume ratio of the acetic acid solution, the sodium hydroxide solution, the carbonyl reductase mutant crude enzyme solution, and the glutaraldehyde solution is 1:1:1:0.1.

[0022] In one embodiment of the present application, the concentration of the acetic acid solution is 0.5%-2%.

[0023] In one embodiment of the present application, the concentration of sodium hydroxide is 0.5%-2%.

[0024] In one embodiment of the present application, the concentration of glutaraldehyde is 4%-8%.

[0025] In one embodiment of the present application, the temperature of the oscillation cross-linking is 20-30° C., and the time of the oscillation cross-linking is 1-3 h.

[0026] In one embodiment of the present application, the stirring temperature is 20-30° C., and the stirring time is 0.5-3 h.

[0027] In a sixth aspect, the present application provides immobilized carbonyl reductase prepared by the above method.

[0028] In a seventh aspect, the present application provides the use of immobilized carbonyl reductase in catalyzing asymmetric reduction to prepare eslicarbazepine.

[0029] In one embodiment of the present application, a solution containing the substrate oxcarbazepine and a solution containing the immobilized carbonyl reductase are mixed, and the mixed solution is reacted to obtain eslicarbazepine.

[0030] In one embodiment of the present application, the solution containing the substrate oxcarbazepine contains a buffer solution, and the buffer solution is a PBS buffer.

[0031] In one embodiment of the present application, the concentration of the substrate is 80-150 g / L.

[0032] In one embodiment of the present application, the concentration of the substrate is 100 g / L.

[0033] In one embodiment of the present application, the concentration of PBS buffer is 50-300 mmol / L.

[0034] In one embodiment of the present application, the concentration of PBS buffer is 100 mmol / L.

[0035] In one embodiment of the present application, the pH value of the PBS buffer is 6.0-9.0.

[0036] In one embodiment of the present application, the pH value of the PBS buffer is 7.0.

[0037] In one embodiment of the present application, the mass ratio of the substrate oxcarbazepine to the immobilized carbonyl reductase is 1:8-12.

[0038] In one embodiment of the present application, the mass ratio of the substrate oxcarbazepine to the immobilized carbonyl reductase is 1:10.

[0039] In one embodiment of the present application, the mixed solution also contains glucose, coenzyme and GDH wet bacteria.

[0040] In one embodiment of the present application, the coenzyme is β-nicotinamide adenine dinucleotide phosphate.

[0041] In one embodiment of the present application, the concentration of β-nicotinamide adenine dinucleotide phosphate is 0.1-0.5 g / L.

[0042] In one embodiment of the present application, the usage ratio of the substrate oxcarbazepine, glucose, β-nicotinamide adenine dinucleotide phosphate and GDH wet bacteria is 2:2:2:1.

[0043] In one embodiment of the present application, the reaction temperature is 20-60°C.

[0044] In one embodiment of the present application, the reaction temperature is 20-40°C.

[0045] In one embodiment of the present application, the reaction temperature is 30°C.

[0046] In one embodiment of the present application, the reaction time is 1-30 hours.

[0047] In one embodiment of the present application, the pH of the reaction is 6.0-9.0.

[0048] In one embodiment of the present application, the chiral purity of the prepared eslicarbazepine is greater than 99%.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] (1) The present application provides a carbonyl reductase mutant and a method for preparing an immobilized carbonyl reductase. The enzyme activity of the immobilized carbonyl reductase prepared by the method is increased by 5-10 times compared with the wild type. When eslicarbazepine is prepared by asymmetric reduction catalyzed by the immobilized carbonyl reductase, the substrate concentration reaches 80-150 g / L, the chiral purity value is greater than 99%, and the conversion rate is greater than 99%.

[0051] (2) The immobilized enzyme of the present invention can be recovered by simple filtration and can be reused more than 5 times after recovery. The chiral purity and conversion rate of the reaction during repeated use are basically the same as those of the initial use, and the enzyme has high potential for industrial application. DETAILED DESCRIPTION

[0052] The following is a clear and complete description of the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all of the embodiments.

[0053] The "range" disclosed in this application is defined in the form of a lower limit and an upper limit, and a given range is defined by selecting a lower limit and an upper limit, and the selected lower limit and upper limit define the boundaries of the particular range. The range defined in this way can be inclusive or exclusive of the end values, and can be arbitrarily combined, that is, any lower limit can be combined with any upper limit to form a range.

[0054] Unless otherwise specified, when the present invention relates to the percentage between liquids, the percentage is volume / volume percentage; when the present invention relates to the percentage between liquids and solids, the percentage is volume / weight percentage; when the present invention relates to the percentage between solids and liquids, the percentage is weight / volume percentage; the rest are weight / weight percentages.

[0055] The present invention is further described below in conjunction with specific examples. Molecular biology experimental methods not specifically described in the following examples can be performed with reference to the methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook or conventional methods in the art, or according to the kits and product instructions.

[0056] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0057] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores.

[0058] Example 1 Construction of carbonyl reductase KRED mutant gene

[0059] According to the Genbank included in the Hilgardia slow Lentilactobacillus hilgardii) carbonyl reductase gene sequence (Gene ID: WP_003557189.1) was obtained by full gene synthesis by Anhui General Biological Co., Ltd., and BamHI and XhoI restriction endonuclease sites were added at both ends of the coding region. The target gene fragment was digested with restriction endonucleases BamHI and XhoI, and then connected, transformed and screened with the pET28a(+) vector that had been digested with the same double enzymes. The positive plasmid was screened and named pET28a-RN024, which is RN024 carbonyl reductase.

[0060] The obtained full-length gene sequence of carbonyl reductase RN024 was subjected to site-directed base mutation, and the mutation positions of the mutant were that the 44th G of the carbonyl reductase gene coding sequence was mutated to C, the 105th E was mutated to V, and the 209th R was mutated to G, which was the RN024 mutant carbonyl reductase, and its amino acid sequence was shown in SEQ ID NO. 1. The gene encoding the mutant of carbonyl reductase, its nucleotide sequence is shown in SEQ ID NO. 2.

[0061] Design mutation primers, use positive plasmid as template for PCR amplification, use Takara Primestar max high-fidelity polymerase (purchased from Takara), and the PCR program is: 98℃ pre-denaturation for 3min, 30 amplification cycles (98℃ 30s, 55℃ 30s, 72℃ 360s), 72℃ 10min. DpnI enzyme digestion removes the template plasmid, and the enzyme digestion product is transformed into E. coli DH5a strain. Positive clones are selected for sequencing verification, and clones with correct mutations are expressed later.

[0062] The mutation primers are as follows:

[0063] G44C-F: 5'- GATGTGTGCGAAAAAGCAGCCAAAAGTATTG -3';

[0064] G44C-R: 5'-GCTTTTTCGCACACATCTGCATGACGACCGG-3'.

[0065] E105-F: 5'- CCACCGTAGAATGGCGTAAACTGCTGAGC -3';

[0066] E105-R: 5'-GCGCAGGAACCAAAACACCTATGGGCC-3'.

[0067] R209G-F: 5'- CCACCGTAGAATGGCGTAAACTGCTGAGC -3';

[0068] R209G-R: 5'-GTTTTGGTTCCTGCGCTCATGGCGGCTTCG-3'.

[0069] Example 2 Expression and preparation of carbonyl reductase KRED and its mutants

[0070] The constructed plasmid was transferred into the host bacterium Escherichia coli BL21 (DE3), and cultured at 37°C overnight. The recombinant strain was inoculated into 5 mL of LB medium (5 g yeast powder; 10 g peptone; 10 g NaCl, pH 7.0) containing kanamycin, and cultured at 37°C overnight with shaking. The inoculum was inoculated into a 500 mL Erlenmeyer flask containing 100 mL of LB medium at a rate of 1% (w / w), and cultured in a shaking incubator at 37°C and 200 rpm. When the OD of the culture solution reached 0. 600 =0.6-0.8, add IPTG with a final concentration of 0.5mmo1 / L as an inducer, after induction at 18°C ​​for 16h, centrifuge the culture medium, collect the cells, and wash them three times with PBS at 4°C; then mix the cell precipitate according to the ratio of cell precipitate to PBS buffer at a ratio of 1:9, and disrupt by ultrasonication (working time 30min, ultrasonication 3s, stop 7s, power 50%) to obtain the crude enzyme solution of carbonyl reductase KRED, and identify the expression by SDS-PAGE.

[0071] Example 3 Preparation of chitosan microspheres immobilized carbonyl reductase

[0072] Weigh 2g of chitosan and dissolve it in 200mL of 1% acetic acid solution, inject it into 200mL of 1% sodium hydroxide solution with a syringe, stir at 25°C for 1h, wash with water until neutral, and obtain chitosan microspheres. Then, mix 200mL of the crude carbonyl reductase solution obtained in Example 2 with the chitosan microspheres, and gradually add 20mL of 6% glutaraldehyde solution under stirring at 25°C. Crosslink at 25°C, 180rpm for 2h, filter with suction, and wash with water three times to obtain immobilized carbonyl reductase.

[0073] Example 4 Preparation of LXTE-705 amino resin immobilized carbonyl reductase

[0074] Weigh 2g of LXTE-705 amino resin and dissolve it in 200mL of 1% acetic acid solution, inject it into 200mL of 1% sodium hydroxide solution with a syringe, stir at 25°C for 1h, wash with water until neutral, and obtain activated LXTE-705 amino resin. Then, mix 200mL of the crude carbonyl reductase solution obtained in Example 2 with the activated LXTE-705 amino resin, and gradually add 20mL of 6% glutaraldehyde solution under stirring at 25°C. Crosslink at 25°C, 180rpm for 2h, filter with suction, and wash with water three times to obtain immobilized carbonyl reductase.

[0075] Example 5 Determination of enzyme activity of immobilized carbonyl reductase

[0076] Weigh 100 mg of substrate oxcarbazepine and 10 mg of NADPH and dissolve them in 40 mL of 100 mM pH 7.0 PBS buffer, then add 1 mg of crude enzyme solution or immobilized carbonyl reductase, mix quickly, and immediately put it into a UV spectrophotometer for absorbance detection at a wavelength of 340 nm. After three minutes, calculate the absorbance difference ΔA, and calculate the enzyme activity according to the formula, unit U / g, the calculation formula is [ΔA×3000 / (6.28×30)]×200. As shown in Table 1, chitosan microsphere immobilized carbonyl reductase has a high enzyme activity recovery rate, and chitosan microsphere immobilized carbonyl reductase mutant (i.e. RN024 mutant chitosan microsphere immobilized enzyme) will be used to prepare eslicarbazepine in the later stage.

[0077] Table 1 Enzyme activity determination results

[0078]

[0079] Example 6 Preparation of eslicarbazepine by asymmetric reduction using immobilized carbonyl reductase

[0080] Chitosan microspheres immobilized carbonyl reductase was used to catalyze the asymmetric reduction of substrates to prepare eslicarbazepine. 50.0g of substrate oxcarbazepine was dissolved in 40mL 100mM pH7.0 PBS buffer, followed by 50.0g glucose. After stirring and dissolving, 50.0mg NADP and 25.0g GDH wet bacteria were added, and 500.0mg chitosan microspheres immobilized carbonyl reductase mutant supernatant was added to make the volume 500mL. The reaction solution was placed in a 30℃ constant temperature water bath and stirred magnetically. After 1 hour of reaction, the sample was taken and HPLC was performed. The substrate conversion rate reached 30% and the product ee value was 99.98%; the reaction was continued for 24h, and the sample was taken for HPLC detection. The substrate conversion was 99.78% and the product ee value was 99.98%.

[0081] Example 7 Study on the reusability of immobilized carbonyl reductase

[0082] After reacting Example 6 for 24 hours, suction filtration was performed to separate the immobilized enzyme from the conversion solution, and the filter cake was washed 3 times with 200 mL of clean water to obtain the recovered immobilized carbonyl reductase. The recovered immobilized carbonyl reductase was used to continue the catalytic conversion according to the conversion scheme of Example 6, that is, after each conversion was completed, the immobilized enzyme was obtained by suction filtration and continued to be used for the next catalytic reaction. The enzyme activity was stable as shown in Table 2, indicating that the immobilized carbonyl reductase can be recycled for multiple times and maintains good stability.

[0083] Table 2 Reusability of immobilized carbonyl reductase

[0084]

[0085] The present application is described in detail above in conjunction with specific implementation methods and exemplary embodiments, but these descriptions cannot be understood as limiting the present application. Those skilled in the art understand that, without departing from the spirit and scope of the present application, the technical solution of the present application and its implementation methods may be subjected to a variety of equivalent substitutions, modifications or improvements, all of which fall within the scope of the present application.

Claims

1. A method for preparing immobilized carbonyl reductase using a carbonyl reductase mutant, characterized in that: The following steps are involved: The crude enzyme solution of the carbonyl reductase mutant was mixed with chitosan microspheres, glutaraldehyde solution was added dropwise, the mixture was shaken for cross-linking, and the mixture was washed with water to obtain immobilized carbonyl reductase; The chitosan microspheres are obtained by dissolving chitosan in an acetic acid solution, injecting the solution into a sodium hydroxide solution, stirring, and washing with water until neutral; The amino acid sequence of the carbonyl reductase mutant is shown in SEQ ID NO.1; The nucleotide sequence of the gene encoding the carbonyl reductase mutant is shown in SEQ ID NO.

2.

2. The method for preparing immobilized carbonyl reductase according to claim 1, characterized in that: The enzyme activity of the carbonyl reductase mutant crude enzyme solution is 1-10U / g, the dosage ratio of the chitosan to the carbonyl reductase mutant crude enzyme solution is 1g:80-120mL, the volume ratio of the acetic acid solution, the sodium hydroxide solution, the carbonyl reductase mutant crude enzyme solution, and the glutaraldehyde solution is 1:1:1:0.1; the temperature of the oscillation cross-linking is 20-30°C, and the time of the oscillation cross-linking is 1-3h.

3. The immobilized carbonyl reductase prepared by the method according to any one of claims 1 to 2.

4. Use of the immobilized carbonyl reductase according to claim 3 in the asymmetric reduction preparation of eslicarbazepine, characterized in that: A solution containing substrate oxcarbazepine and a solution containing immobilized carbonyl reductase are mixed, and the mixed solution is reacted to prepare eslicarbazepine.

5. Use of the immobilized carbonyl reductase according to claim 4 in the asymmetric reduction preparation of eslicarbazepine, characterized in that: The solution containing the substrate oxcarbazepine contains a buffer solution, the buffer solution is a PBS buffer solution, the concentration of the substrate is 80-150 g / L; the mass ratio of the substrate oxcarbazepine to the immobilized carbonyl reductase is 1:8-12; the mixed solution also contains glucose, coenzyme and GDH wet bacteria; the coenzyme is β-nicotinamide adenine dinucleotide phosphate; the reaction temperature is 20-60°C; the reaction time is 1-30h; and the reaction pH is 6.0-9.

0.

6. Use of the immobilized carbonyl reductase according to claim 4 in catalytic asymmetric reduction to prepare eslicarbazepine, characterized in that: The chiral purity of the prepared eslicarbazepine is greater than 99%.

Images