A gRNA for constructing an osteopetrosis mouse model, a construction method and an application

Abstract

The present invention relates to a gRNA for constructing an osteopetrosis mouse model, a construction method and an application thereof. The nucleotide sequence of the gRNA is shown as SEQ ID NO: 1. The human CLCN7 (NM_001287.5: c.856C>T) mutation involved in the present invention can cause changes in the function of chloride channels, abnormal development of bone tissue, and thus lead to the occurrence of osteopetrosis. By designing a gRNA sequence specifically targeting CLCN7 (R286W) and using the CRISPR / Cas9 gene editing technology, the present invention successfully constructs the first homozygous mouse model of Clcn7 (r284w) carrying a mutation corresponding to human CLCN7 (R286W), filling the research gap in the related field.

Description

Technical Field

[0001] The present invention relates to the technical field of animal genetic engineering, and particularly relates to a gRNA for constructing an osteopetrosis mouse model, a construction method and an application thereof. Background Art

[0002] Osteopetrosis is a group of rare, hereditary bone diseases characterized by abnormal bone mass and impaired bone development. The occurrence of this disease involves abnormalities in multiple genes, including the CLCN7 gene. The CLCN7 gene encodes a chloride channel protein and is an important regulatory factor in osteocyte development and function. In previous studies, a pathogenic CLCN7 (R286W) mutation has been successfully screened out, which is related to the onset of some osteopetrosis families. This mutation causes a change in the function of the chloride channel, which in turn leads to abnormal development of bone tissue. Therefore, in-depth understanding of the impact of CLCN7 gene mutations on bone health, especially the establishment of corresponding animal models, is crucial for revealing the pathophysiological mechanisms of osteopetrosis and developing potential treatment methods. There is no homozygous mouse model corresponding to the human CLCN7 (R286W) mutation globally. In view of this, the present invention provides a gRNA for constructing an osteopetrosis mouse model, a construction method and an application thereof. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a gRNA for constructing an osteopetrosis mouse model, a construction method and an application thereof. The aim is to overcome the blank of the existing homozygous animal model caused by the human CLCN7 (R286W) mutation leading to osteopetrosis and the technical deficiencies.

[0004] The technical solution of the present invention to solve the above technical problems is as follows:

[0005] In the first aspect, a gRNA for constructing an osteopetrosis mouse model, wherein the nucleotide sequence of the gRNA is as shown in SEQ ID NO: 1.

[0006] The occurrence of osteopetrosis is caused by the human CLCN7 (NM_001287.5: c.856C>T) mutation. The corresponding mouse gene is Clcn7, and Clcn7 (GenBank accession number: NM_011930.4; Ensembl: ENSMUSG00000036636) is located on mouse chromosome 17. The r284w mutation is located in exon 10. Therefore, the present invention selects exon 10 as the target site and designs and synthesizes guide RNA (gRNA, small guide RNA, sgRNA).

[0007] The present invention uses http: / / crispor.tefor.net / to design gRNAs targeting the target mutation sites, selects high-score gRNAs, and then synthesizes the gRNAs at Nanjing Genscript Biotech Co., Ltd.

[0008] Based on the above technical solutions, the present invention can also be improved as follows.

[0009] In a second aspect, a method for constructing an osteopetrosis mouse model includes the following steps: forming a ribonucleoprotein complex with the gRNA and Cas9 protein, injecting the ribonucleoprotein complex together with a donor oligomer with a target mutation into a mouse fertilized egg, then transplanting the fertilized egg into a pseudopregnant female mouse to produce the F0 generation, performing PCR identification on the F0 generation, mating the positive F0 generation with wild-type mice to obtain F1 generation heterozygotes, hybridizing the F1 generation heterozygotes, and screening for homozygous offspring with osteopetrosis as the osteopetrosis mouse model;

[0010] The donor oligomer with a target mutation carries the p.R284W (CGG to TGG) point mutation.

[0011] The target mutation donor oligomer (Donor oligo) carrying the p.R284W (CGG to TGG) point mutation is designed by repairing DNA through homologous recombination to introduce the mutation site. At the same time, the present invention also introduces two silent mutations p.R278=(CGC to AGG) and p.K283=(AAG to AAA) to prevent the gRNA from binding and cleaving the sequence again after homologous directed repair.

[0012] Furthermore, the nucleotide sequence of the donor oligomer with a target mutation is as shown in SEQ ID NO: 2. SEQ ID NO: 2: 5'-AGCCCTGCAGAGCCTCCCACAACACCCTGCATCTTTCTCTTTCAGATCTTTGAA TATTTCAGGAGAGATACAGAGAAATGGGATTTGTCTCAGCTGGAGCTGCAGCTGG TGTATCTGCTGCATTTGGAGCCCCTGTGGG-3'.

[0013] Furthermore, the construction method includes the following specific steps:

[0014] 1) Form a ribonucleoprotein complex with the gRNA and Cas9 protein, and mix the ribonucleoprotein complex with a donor oligomer with a target mutation to obtain an injection solution;

[0015] 2) Inject the injection solution into the cytoplasm of mouse fertilized eggs by microinjection to obtain fertilized eggs after injection;

[0016] 3) Transplant the fertilized eggs after injection into the oviduct of pseudopregnant female mice. After development is completed, F0 generation is produced. Perform PCR identification on the F0 generation. Mate the positive F0 generation with wild-type mice to obtain F1 generation heterozygotes. Hybridize the F1 generation heterozygotes to screen for homozygous offspring of osteopetrosis as an osteopetrosis mouse model.

[0017] Furthermore, the mass ratio of the gRNA, the Cas9 protein, and the donor oligomer with the target mutation described in step 1) is 100-110:160-170. Specifically, the final concentration of gRNA is 104 ng / μL, and the final concentration of Cas9 protein is 166.7 ng / μL.

[0018] Furthermore, the donor of the mouse fertilized eggs described in step 2) is C57BL / 6J mice; the pseudopregnant female mice are ICR mice.

[0019] Furthermore, the specific primers for PCR identification in step 3) include a forward primer and a reverse primer; the nucleotide sequence of the forward primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.4.

[0020] In the third aspect, a kit for constructing the osteopetrosis mouse model as described above, the kit includes gRNA, Cas9 protein, and a donor oligomer with a target mutation.

[0021] In the fourth aspect, the application of the constructed osteopetrosis mouse model in the development and / or screening of osteopetrosis substances.

[0022] Furthermore, the substance is a drug.

[0023] The beneficial effects of the present invention are:

[0024] (1) The gRNA designed by the present invention can specifically guide Cas9 to localize to the target Clcn7 (r284w) sequence.

[0025] (2) The CLCN7 (NM_001287.5:c.856C>T) mutation involved in the present invention can cause changes in the function of chloride channels, abnormal development of bone tissue, and thus lead to the occurrence of osteopetrosis. After literature search, there is currently no osteopetrosis homozygous mouse model reflecting the CLCN7 (R286W) mutation. The present invention successfully constructed the first homozygous mouse model of Clcn7 (r284w) carrying the mutation corresponding to human CLCN7 (R286W) by designing a gRNA sequence specific for CLCN7 (R286W) and using the CRISPR / Cas9 gene editing technology, filling the research gap in the relevant field.

[0026] (3) The present invention repairs DNA by homologous recombination to introduce mutation sites, and designs a Donor oligo carrying the p.R284W (CGG to TGG) point mutation; and also introduces two silent mutations p.R278=(CGC to AGG), p.K283=(AAG to AAA) to prevent the gRNA from binding and cleaving the sequence again after homologous directed repair.

[0027] (4) After microinjection of the fertilized egg pronucleus, the treated fertilized eggs were transferred to M16 medium (Sigma) and cultured in an incubator at 37°C and 5% CO2 for 1.5 hours. The success rate of fertilized egg transplantation was relatively increased compared with that of culturing for 1 hour in the existing transplantation technology. Brief Description of the Drawings

[0028] Figure 1 It is a genomic region map of the mouse Clcn7 locus of the present invention. The gene orientation is from left to right, and the total size is 28.714 kb; the solid bar represents the open reading frame; the hollow bar represents the untranslated region, and exon 10 is the target site;

[0029] Figure 2 It is an electrophoresis diagram of the PCR amplification product of the DNA targeting region of the mouse tail tissue of the F2 generation of the present invention;

[0030] Figure 3 It is a Sanger sequencing diagram of the PCR amplification product of the DNA targeting region of the mouse tail tissue of the wild-type mouse of the present invention;

[0031] Figure 4 It is a Sanger sequencing diagram of the PCR amplification product of the DNA targeting region of the mouse tail tissue of the mutant mouse of the present invention;

[0032] Figure 5 It is the X-ray examination result of the bones of the 3-week-old wild-type mouse and homozygous mouse of the present invention; (A) wild-type mouse, (B) homozygous mutant mouse;

[0033] Figure 6 HE staining results of the femurs of 3-week-old homozygous and wild-type mice of the present invention; (A) Homozygous mice; (B) Wild-type mice; Asterisks indicate the bone cortex, and triangles indicate the trabecular bone;

[0034] Figure 7 Comparison of the body sizes of 3-week-old homozygous mutant and wild-type mice of the present invention. From left to right are homozygous and wild-type mice;

[0035] Figure 8 Tooth comparison of 3-week-old homozygous mutant, heterozygous mutant and wild-type mice of the present invention. From left to right are homozygous mice and wild-type mice. Detailed implementation mode

[0036] The principles and features of the present invention are described below. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention. For those without specific technical or conditions indicated in the examples, the techniques or conditions described in the literature in this field or according to the product specifications are followed. For reagents or instruments without the manufacturer indicated, they are all conventional products that can be purchased through regular channels.

[0037] Example

[0038] A method for constructing a homozygous mouse model that can reflect osteopetrosis caused by human CLCN7 (R286W) mutation, comprising the following steps:

[0039] Step 1: Design and synthesize guide RNA (guide RNA, gRNA, small guide RNA, sgRNA)

[0040] The mutation of human CLCN7 (NM_001287.5:c.856C>T) causes osteopetrosis. The corresponding mouse gene is Clcn7. Clcn7 (GenBank accession number: NM_011930.4; Ensembl: ENSMUSG00000036636) is located on mouse chromosome 17, and the r284w mutation is located in exon 10. Therefore, the present invention selects exon 10 as the target site ( Figure 1 ).

[0041] The present invention uses http: / / crispor.tefor.net / to design gRNA targeting the target mutation site, selects high-score gRNA, and then synthesizes gRNA at Nanjing Genscript Biotech Co., Ltd.

[0042] The gRNA designed by the present invention can guide Cas9 to localize to the target Clcn7 (r284w) sequence. gRNA: 5’-TCCGCAGAGATACAGAGAAGCGG-3’ (SEQ ID NO: 1).

[0043] Step 2: Design and synthesize a donor oligo with the target mutation

[0044] The present invention repairs DNA by homologous recombination to introduce a mutation site, thereby designing a donor oligo with the target mutation carrying the p.R284W (CGG to TGG) point mutation. At the same time, the present invention also introduces two silent mutations p.R278=(CGC to AGG), p.K283=(AAG to AAA) to prevent the gRNA from binding and cleaving the sequence again after homologous directed repair. The nucleotide sequence of the donor oligo with the target mutation is shown in SEQ ID NO: 2; SEQ ID NO: 2: 5’-AGCCCTGCAGAGCCTCCCACAACACCCTGCATCTTTCTCTTTCAGATCTTTGAATATTTCAGGAGAGATACAGAGAAATGGGATTTGTCTCAGCTGGAGCTGCAGCTGGTGTATCTGCTGCATTTGGAGCCCCTGTGGG-3’.

[0045] Step 3: Assemble gRNA and Cas9 protein

[0046] (1) Mix 2.5 μL of gRNA (final concentration of about 104 ng / μL) and 1 μL of Cas9 protein (final concentration of 166.7 ng / μL) solution, and pipette the mixed solution 4 - 5 times.

[0047] (2) Incubate the mixed solution at 37 °C for 5 minutes to form a ribonucleoprotein complex (Cas-gRNA).

[0048] Among them, the Cas-gRNA system can promote Cas9 to cleave the DNA double strand at this position to generate the target mutation point p.R284W (CGG to TGG).

[0049] Step 4: Preparation of fertilized eggs

[0050] Inject pregnant mare serum into female C57BL / 6J mice (purchased from Hunan Slack Jingda Experimental Animal Co., Ltd.) at 3 - 4 weeks of age. After 46 hours, inject chorionic gonadotropin into the above mice. The present invention places the female mice treated with chorionic gonadotropin and adult fertile male mice in the same cage for mating to fertilize the female mice. After successful fertilization, collect the fertilized eggs in the oviducts of female mice.

[0051] Step 5: Microinjection of pronuclei of fertilized eggs

[0052] Under an inverted microscope at 200 - 400 times magnification, the prepared ribonucleoprotein complex and Donor oligo were injected into the nucleus of fertilized eggs using a microinjection needle. The treated fertilized eggs were transferred to M16 medium (Sigma) and cultured in an incubator at 37°C and 5% CO2 for 1.5 hours. Subsequently, fertilized egg transplantation was performed.

[0053] Step 6: For fertilized egg transplantation, fertile female mice at 8 weeks of age were mated with male mice after vasectomy to obtain pseudopregnant female mice (purchased from Hunan Slack Jingda Experimental Animal Co., Ltd.). The fertilized eggs carrying the foreign gene were implanted into the oviducts of surrogate pregnant female mice with vaginal plugs observed on the same day, and then waited for the birth of F0 mice.

[0054] Step 7: The F0 mice obtained in Step 6 were identified by PCR and DNA sequencing, and thus the mouse Clcn7(r284w) mice carrying the foreign gene corresponding to the human CLCN7(R286W) mutation were obtained. The mutant mice carrying the foreign gene were mated with wild-type mice of the same species and passed on. The F1 mice born were sequenced to identify whether they had the target mutation site. The F1 mice with the target mutation site were sib-mated, and the genotype of the F2 mice born was identified using the same identification method as that of the F0 generation. Among the F2 mice born, there was a 25% probability of being homozygous.

[0055] For DNA extraction in the PCR identification described in Step 7, the Thermo Scientific GeneJET Genomic DNA Purification Kit (#K0721) was used and the tissue was lysed and DNA was extracted according to its instruction manual. The specific steps are as follows:

[0056] (1) After anesthetizing 1 - 2 week-old young mice with isoflurane gas, 0.5 cm tail tip tissue was collected. The mouse tail tissue was placed in a mortar, quickly frozen in liquid nitrogen, ground into powder and collected in a 1.5 mL centrifuge tube. 180 μL of digestion solution was added to the centrifuge tube containing the collected mouse tail tissue and mixed evenly. 20 μL of proteinase K solution was added and vortexed evenly.

[0057] (2) The sample was incubated in an oscillating thermostatic metal bath at 56°C for 6 hours. After incubation, 20 μL of RNase A solution was added to the sample, mixed thoroughly and incubated at room temperature for 10 minutes. After incubation, 200 μL of lysis buffer was added and vortexed evenly. The obtained sample was added to the purification column and centrifuged at 4°C with a centrifugal force of 6000×g for 1 minute. After centrifugation, the purification column was assembled with a new collection tube, and 500 μL of rinsing buffer was poured into Purification Column I. At 4°C, it was centrifuged at a centrifugal force of 8000×g for 1 minute.

[0058] (3) After centrifugation, discard the flow-through in the collection tube, and then reassemble the purification column and the collection tube. Next, add 500 μL of rinse buffer II to the purification column. Subsequently, centrifuge at 8000×g for 3 minutes at 4°C.

[0059] (4) After centrifugation, discard the collection tube containing the flow-through and place the purification column into a 1.5 mL sterile centrifuge tube. Then add 200 μL of elution buffer to the purification column.

[0060] (5) Let it stand at room temperature for 2 minutes, and then centrifuge at 8000×g for 3 minutes at 4°C. The liquid in the centrifuge tube is the DNA of the mouse tail tissue.

[0061] The primer sequences, amplification system, reaction system, and amplification conditions for the PCR identification described in step 7 are as follows (Tables 1 to 3):

[0062] Table 1 Primer sequences for PCR amplification of the targeting region

[0063]

[0064] Table 2 Reaction system for PCR amplification of the targeting region

[0065]

[0066] Table 3 Reaction conditions for PCR amplification of the targeting region

[0067]

[0068] The DNA tissue source for the sequencing described in step 7 is:

[0069] Take 5 μL of the PCR amplification product for agarose gel electrophoresis. Set the electrophoresis parameters as: 150 V voltage, 100 mA current, for 15 minutes. Then observe the band position on the gel imager ( Figure 2 ).

[0070] Figure 2 This is the electrophoresis diagram of the PCR amplification product of the targeting region of the F2 mouse tail tissue DNA of the present invention. The size of the amplification product is 632 bp; from left to right are the PCR amplification products of the targeting regions of the DNA of the mouse tail tissues of each F2 generation;

[0071] After the agarose gel electrophoresis is completed, cut the gel band containing the target PCR amplification product, and then use the SanPrep column DNA gel extraction kit to purify the gel band containing the target PCR amplification product, and then use a sequencer to sequence the purified PCR product ( Figure 2 and Figure 3 ). Figure 3Sanger sequencing of the PCR amplification product of the DNA targeting region in the tail tissue of mutant mice showed that it was a homozygous Clcn7(r284w) mutation.

[0072] In step 8: Use X-ray detection and hematoxylin-eosin (HE) staining experiments to analyze whether the homozygous Clcn7(r284w) mutant mice obtained in step 8 have the disease characteristics of osteopetrosis.

[0073] (1) The specific steps for using X-ray detection to analyze whether the homozygous Clcn7(r284w) mutant mice have the disease characteristics of osteopetrosis are as follows: Anesthetize the 3-week-old homozygous Clcn7(r284w) mutant mouse model with isoflurane gas, and the anesthesia parameters are: oxygen flow rate 0.5 L / min, induction concentration 2%. After the mouse is anesthetized, use the "X-ray" module of the Lumina XRMS III small animal in vivo imaging system to image the bones of the mouse ( Figure 5 ). From Figure 5 It was found that the cortical bone of the femur of 3-week-old homozygous mice was significantly thickened and the bone marrow cavity was narrowed and almost disappeared.

[0074] (2) The specific steps for using HE staining experiments to analyze whether the homozygous Clcn7(r284w) mutant mice have the disease characteristics of osteopetrosis are as follows:

[0075] ① Take 3-week-old wild-type mice and homozygous mice, and then dissect out the femurs. Fix the femurs with 4% paraformaldehyde for 48 hours. After fixation, rinse the femurs with running water, and then place the femurs in the decalcifying solution for 24 hours of decalcification.

[0076] ② After the decalcification of the femurs, dehydrate the femur tissue with ethanol of different concentrations. Dehydrate with 75% ethanol for 1 hour, use 85% ethanol for dehydration for 1 hour, then use 95% ethanol for dehydration for 1 hour, and repeat this step 2 times; then dehydrate with absolute ethanol for 1 hour and repeat this step 2 times; finally, perform xylene clearing for 45 minutes and repeat this step twice.

[0077] ③ Embed the dehydrated femurs in paraffin, and then section them with a thickness of 4-5 μm.

[0078] ④ Bake the paraffin sections at 65 °C for 2 hours, then dewax the paraffin sections with xylene for 10 minutes and repeat 2 times, then soak them in absolute ethanol for 2 minutes, soak them in 95% ethanol for 2 minutes and repeat 2 times, soak them in 75% ethanol for 2 minutes, and soak them in distilled water for 2 minutes.

[0079] ⑤ Stain with hematoxylin staining solution for 5 minutes, rinse with distilled water for 1 minute, and then soak in PBS buffer with pH 7.5 for bluing for 30 seconds.

[0080] ⑥ Place the femoral sections into eosin staining solution for staining for 3 minutes. Subsequently, dehydrate the femoral sections in 90% ethanol for 30 seconds, and dehydrate in 95% ethanol for 2 minutes, repeating this step twice. Then, dehydrate the femoral sections in absolute ethanol for 2 minutes, also repeating this step twice.

[0081] ⑦ After mounting with neutral balsam, observe and analyze the morphological structure and histological characteristics of the HE-stained sections of mouse femurs under a microscope.

[0082] Figure 6 This is the HE staining result of the femurs of 3-week-old homozygous and wild mice of the present invention; (A) Homozygous mice, the tubular bone structure of the femur is disordered, the bone marrow cavity is filled with thickened, thickened and intertwined trabecular bones connected to the bone cortex, and a small amount of fibrous connective tissue can be seen in the grid, but no obvious hematopoietic cells are seen; (B) Wild-type mice (asterisk indicates the bone cortex, triangle indicates the trabecular bone).

[0083] It can be seen that using X-ray to detect the femur of homozygous mice, the bone cortex is significantly thickened and the bone marrow cavity is narrow and almost disappears ( Figure 5 ); Hematoxylin-Eosin (HE) staining experiment analyzes that the tubular bone structure of the femur of Clcn7(r284w) mutant homozygous mice shows disorders, and the bone marrow cavity is filled with thickened, thickened and intertwined trabecular bones connected to the bone cortex and other osteopetrosis disease characteristics ( Figure 6 ).

[0084] Step 9: Analyze the body shape and tooth characteristics of the Clcn7(r284w) mutant homozygous mice obtained in Step 8.

[0085] It can be seen that by analyzing the body shape and tooth characteristics of Clcn7(r284w) mutant homozygous mice, it is found that 3-week-old homozygous mice are smaller in body shape compared to wild-type and heterozygous mice of the same age. In terms of teeth, no teeth erupt in homozygous mice ( Figure 7 and 8 ).

[0086] In summary, the CLCN7 (NM_001287.5:c.856C>T) mutation involved in the present invention can cause changes in the function of chloride channels, abnormal development of bone tissue, and thus lead to the occurrence of osteopetrosis; through literature search, there is currently no osteopetrosis homozygous mouse model reflecting the CLCN7 (R286W) mutation. The present invention successfully constructs the first homozygous mouse model of Clcn7 (r284w) carrying the mutation corresponding to human CLCN7 (R286W) by designing a specific guide RNA sequence targeting CLCN7 (R286W) and using the CRISPR / Cas9 gene editing technology, filling the research gap in the relevant field.

[0087] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. A method for constructing an osteopetrosis mouse model, characterized in that: The method comprises the following steps: forming a ribonucleoprotein complex with gRNA and Cas9 protein, wherein the nucleotide sequence of the gRNA is shown in SEQ ID NO: 1, injecting the ribonucleoprotein complex together with a donor oligomer having a target mutation into a mouse fertilized egg, then transplanting the fertilized egg into a pseudo-pregnant female mouse to produce an F0 generation, performing PCR identification on the F0 generation, mating the positive F0 generation with wild-type mice to obtain F1 generation heterozygotes, hybridizing the F1 generation heterozygotes, and screening homozygous offspring of osteopetrosis as an osteopetrosis mouse model; The donor oligomer with the target mutation carries a point mutation of p.R284W=CGG to TGG, and two silent mutations p.R278= CGC to AGG, p.K283= AAG to AAA; The nucleotide sequence of the donor oligomer having the target mutation is shown in SEQ ID NO:

2.

2. The method for constructing an osteopetrosis mouse model according to claim 1, characterized in that: The construction method comprises the following specific steps: 1) forming a ribonucleoprotein complex with the gRNA and Cas9 protein, and mixing the ribonucleoprotein complex with a donor oligomer having a target mutation to obtain an injection solution; 2) injecting the injection solution into the cytoplasm of a mouse fertilized egg by microinjection to obtain an injected fertilized egg; 3) The injected fertilized eggs are transplanted into the oviduct of a pseudo-pregnant mouse. After development is completed, the F0 generation is produced, and the F0 generation is identified by PCR. The positive F0 generation is mated with wild-type mice to obtain F1 generation heterozygotes, and the F1 generation heterozygotes are hybridized to screen homozygous offspring with osteopetrosis as an osteopetrosis mouse model.

3. The method for constructing an osteopetrosis mouse model according to claim 2, characterized in that: The mass ratio of the gRNA, the Cas9 protein and the donor oligomer with the target mutation described in step 1) is 100-110:160-170.

4. The method for constructing an osteopetrosis mouse model according to claim 2, characterized in that: The mouse fertilized eggs described in step 2) are obtained by mouse ovulation induction and in vitro fertilization.

5. The method for constructing an osteopetrosis mouse model according to claim 2, characterized in that: The specific primers for PCR identification in step 3) include a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

6. A kit for constructing an osteopetrosis mouse model as claimed in any one of claims 2 to 5, characterized in that: The kit comprises the gRNA as described in claim 1, the Cas9 protein and a donor oligomer having a target mutation.

7. Use of the osteopetrosis mouse model constructed as described in any one of claims 2 to 5 in developing and / or screening osteopetrosis drugs.

Images