A molecular marker related to backfat thickness trait located on chromosome 17 of pig and its application

Abstract

The present invention belongs to the field of molecular biotechnology and molecular marker technology, and specifically relates to a molecular marker related to the backfat thickness trait on chromosome 17 of pigs and its application. The SNP site of the molecular marker related to the backfat thickness trait on chromosome 17 of pigs corresponds to the G>A mutation at 36543568bp on chromosome 17 of the international pig reference genome version 11.1. The molecular marker is detected by whole genome association analysis and found to significantly affect the pig backfat thickness trait. The present invention also provides a primer pair and a kit for detecting the molecular marker. The molecular marker and the primer pair can be used to establish an efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of the backfat thickness trait of breeding pigs, thereby reducing the backfat thickness of pigs, increasing the lean meat rate of pigs, increasing corporate profits, and increasing core competitiveness.

Description

Technical Field

[0001] The invention belongs to the technical fields of molecular biotechnology and molecular markers, and in particular relates to a molecular marker located on chromosome 17 of pigs and associated with a backfat thickness trait and an application thereof. Background Art

[0002] Backfat thickness refers to the thickness of subcutaneous fat on the back of pigs, and is one of the important indicators for measuring the lean meat rate of pigs. Many studies have shown that backfat thickness and lean meat rate are significantly negatively correlated. Given that the lean meat rate phenotype is difficult to measure, the backfat thickness phenotype is easier to obtain. Therefore, breeders genetically improve pig backfat thickness to increase the lean meat rate of pigs. However, backfat thickness is a typical quantitative trait and is regulated by multiple genes. Therefore, genetic improvement of pig backfat thickness through conventional breeding methods is time-consuming and costly, with little effect. With the development of molecular biology, molecular marker-assisted selection (MAS) technology has been widely used in the genetic improvement of important economic traits in pigs. MAS technology uses the characteristics of molecular markers that are significantly associated with genes that affect the target traits. By detecting molecular markers, the presence of the target gene can be detected to achieve the purpose of selecting the target trait. It is a new breeding method with the advantages of being fast, accurate, and not affected by environmental conditions. Therefore, if molecular marker-assisted selection technology can be used to genetically improve pig back fat thickness and early selection and breeding of pigs can be carried out at the molecular level, the genetic improvement process of back fat thickness will be further accelerated, bringing huge economic benefits to pig breeding companies.

[0003] Genome-wide association study (GWAS) is an effective method for analyzing quantitative traits. GWAS refers to the search for molecular markers significantly associated with the target trait across the entire genome. The significant molecular markers detected by this method can be used for molecular marker-assisted selection breeding. However, sample size and marker density are important factors affecting the results of GWAS. Generally speaking, the larger the sample size and the higher the marker density, the stronger the statistical power of GWAS. However, the size of the sample size is mainly affected by objective factors such as experimental cost and experimental cycle. Whole-genome resequencing is the most effective method to increase marker density, but the cost of large-scale whole-genome resequencing is still very expensive. To solve the above problems, researchers have developed genotype filling technology, which can both increase marker density and reduce sequencing costs. Genotype filling technology refers to the fact that in populations with the same or similar genetic background, samples with low marker density can use the principle of linkage disequilibrium to refer to samples with high marker density to fill in the missing mutation sites. This technology is widely used in pig GWAS research and significantly improves the statistical power of GWAS.

[0004] Large White pigs are world-renowned lean meat pigs with excellent characteristics such as high lean meat rate, fast growth rate, and strong reproductive capacity. They are one of the parents of my country's main commercial pig "Duroc × (Landrace × Large White)". Therefore, improving the back fat thickness trait of the core group Large White pigs can pass on the advantages of the improvement to a large number of commercial pig offspring to a large extent. This will reduce the back fat thickness of commercial pigs, improve the competitiveness of commercial pig production, and bring economic benefits to pig breeding companies. Summary of the invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a molecular marker located on chromosome 17 of pigs and associated with the backfat thickness trait, which is obtained through whole genome association analysis and can significantly affect the trait of pig backfat thickness.

[0006] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular marker.

[0007] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers, wherein the kit comprises the above-mentioned primer pair.

[0008] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.

[0009] A fifth object of the present invention is to provide a method for screening pig breeds with low backfat thickness traits.

[0010] The sixth object of the present invention is to provide a method for genetic improvement of pigs.

[0011] The purpose of the present invention is achieved through the following technical solutions:

[0012] A molecular marker located on chromosome 17 of a pig and associated with a backfat thickness trait, wherein the SNP site of the SNP molecular marker corresponds to the G>A mutation at 36543568bp on chromosome 17 of the international pig reference genome version 11.1, and the polymorphism of the base at this site leads to different backfat thickness traits, wherein when the single nucleotide at the SNP site is G, the pig has a thin backfat thickness; when the single nucleotide at the SNP site is A, the pig has a thick backfat thickness.

[0013] Preferably, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein M in the sequence is G or A.

[0014] Preferably, the SNP site of the SNP molecular marker is the nucleotide mutation G305-A305 at position 305 of the sequence annotation of SEQ ID NO: 1 (a single base mutation of nucleic acid at position 305 of the sequence fragment, named: g.305 G>A).

[0015] Preferably, the pigs include French Large White pigs and their synthetic strains.

[0016] A primer pair for detecting the above-mentioned SNP molecular marker comprises primers primer-F and primer-R, and the nucleic acid sequences thereof are as follows:

[0017] Upstream primer primer-F: 5′-GGGCTTGCACTTGCAGTATG-3′;

[0018] Downstream primer primer-R: 5'-GAGGATTGTGGACTCGGAGC-3'.

[0019] A kit for detecting the above-mentioned SNP molecular marker comprises the above-mentioned primer pair.

[0020] The SNP molecular marker, primer pair or kit is used in identifying pig backfat thickness or lean meat rate traits, screening pig breeds with low backfat thickness or high lean meat rate, or pig genetic breeding.

[0021] Preferably, the pigs include French Large White pigs and their synthetic strains.

[0022] A method for identifying pig backfat thickness or lean meat rate traits comprises the following steps:

[0023] The SNP site of the above-mentioned SNP molecular marker on chromosome 17 of the pig is detected, and the pig back fat thickness or lean meat rate trait is judged according to whether the single nucleotide of the SNP site is G or A; when the single nucleotide of the SNP site is G, the pig back fat thickness or lean meat rate is high; when the single nucleotide of the SNP site is A, the pig back fat thickness or lean meat rate is low.

[0024] A method for screening pig breeds with low backfat thickness or high lean meat percentage traits comprises the following steps:

[0025] The SNP sites of the above-mentioned SNP molecular markers on chromosome 17 of pigs are detected, individuals whose single nucleotide at the SNP site is A are eliminated, and individuals whose single nucleotide at the SNP site is G are retained as breeding pigs.

[0026] The detection method comprises the following steps:

[0027] (1) Extracting genomic DNA from the pig to be tested;

[0028] (2) using the above primer pair or the primer pair in the above kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product;

[0029] (3) Sequencing the PCR amplification product to obtain sequencing results;

[0030] (4) Determine the genotype based on the sequencing results.

[0031] A method for genetic improvement of pigs, comprising the following steps:

[0032] Determine the above-mentioned SNP molecular markers of the breeding pigs in the breeding core group, and make corresponding selections based on the molecular markers: for the sub-breeding of breeding pigs, select breeding pigs with AG genotype or GG genotype at 36543568bp on chromosome 17 of the international pig reference genome version 11.1, and eliminate breeding pigs with AA genotype at this point to increase the frequency of allele G at this site from generation to generation, thereby reducing the back fat thickness of offspring pigs or increasing the lean meat rate of offspring pigs.

[0033] Preferably, the breeding pigs include French Large White pigs and their synthetic lines.

[0034] Compared with the prior art, the present invention has the following advantages and effects:

[0035] (1) The present invention studies and determines that the molecular markers that affect pig back fat thickness are located on the nucleotide sequence of chromosome 17 of the pig, verifies its effect on the pig back fat thickness trait, and ultimately establishes a molecular marker-assisted selection breeding technology for rapid improvement of the pig back fat thickness trait, which greatly improves the breeding process of Large White pigs and their synthetic lines, adapts to the needs of the live pig market, increases the price of meat pigs, increases sales profits for enterprises, and improves core competitiveness.

[0036] (2) The present invention provides a primer pair and a kit for detecting a SNP molecular marker associated with backfat thickness located on chromosome 17 of pigs. The primer pair and the kit can be used to establish an efficient and accurate molecular marker-assisted breeding technology, and the trait can be selected and bred quickly and accurately. The application of the primer pair and the kit in the genetic improvement of the backfat thickness trait of breeding pigs can reduce the backfat thickness of pigs, improve the production performance of pigs, accelerate the breeding process, and thus increase corporate profits and core competitiveness.

[0037] (3) The present invention provides a method for pig breeding by optimizing the dominant allele of the molecular marker, which can accelerate the genetic progress of large white pigs and shorten the time for improving large white pigs, thereby effectively improving the economic benefits of breeding pigs. Among them, if the present invention replaces the AA type of the molecular marker that affects the pig back fat thickness trait with the GG type, the back fat thickness of a large white pig with a body weight of 100 kg is reduced by 1.13 mm, and the lean meat rate is increased by 0.49%. A large-scale pig farm with 10,000 heads can increase more than 4,900 kg of lean meat. It can be seen that low back fat thickness has great potential to provide benefits to the pig farming industry. Among the individuals of this SNP molecular marker, by optimizing the dominant allele (G) of the SNP of large white pigs, the economic benefits of commercial pigs can be ultimately improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a genome-wide association study (GWAS) analysis of the French Large White pig backfat thickness trait on chromosome 17; the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 (P).

[0039] Figure 2 This is an analysis chart of back fat thickness of pigs with different genotypes at a body weight of 100 kg. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0041] Experimental pig herd: 3167 purebred French Large White pigs were used in this experiment.

[0042] Example 1 Detailed explanation of the determination process of the factors affecting backfat thickness in the present invention

[0043] (1) Experimental animals

[0044] The experimental pig population used in the present invention is 3167 purebred French Large White pigs from a core breeding pig population of a certain country. The above pig breed is the core group of a breeding pig branch, and the herd genealogy is recorded in detail. In this experiment, a total of Large White pigs from the resource group were selected, and the pigs were free to eat and drink water. The entire feeding method, feeding conditions, etc. were always consistent, which is a conventional method.

[0045] (2) Phenotypic trait determination

[0046] The backfat thickness and eye muscle thickness between the 10th and 11th ribs of live pigs were measured by large European B-ultrasound. According to the correction formula provided by the South China Breeding Pig Evaluation Network (http: / / breeding.cn / Common / HomeNews / HomeNewsBreedingDetail.aspx?homeNewsID=fe54cd11-4089-4c81-9b8f-da0ed341155b), the backfat thickness of 100 kg body weight, the eye muscle area of ​​100 kg body weight and the lean meat rate of 100 kg body weight were corrected. The formula is as follows:

[0047] 1) 100 kg body weight corrected back fat thickness = measured back fat thickness * CF

[0048] in:

[0049] CF = A÷{A+[B×(actual weight-100)]};

[0050] Boar: A and B are 12.402 and 0.106530 respectively;

[0051] Sow: A and B are 13.706 and 0.119624 respectively.

[0052] 2) 100 kg body weight corrected eye muscle area = measured eye muscle area + [(100-measured body weight) × measured eye muscle area / (measured body weight + 70.308)].

[0053] 3) Lean meat rate per 100 kg body weight = 51.115 - 0.4611 × 100 kg body weight corrected back fat thickness + 0.518 × 100 kg body weight corrected eye muscle area.

[0054] (3) Sample collection

[0055] The ear sample tissues of the above-mentioned purebred French Large White pigs were collected, immersed in a 75% ethanol solution by volume, and stored in a -20°C refrigerator for later use.

[0056] Example 2 Detailed explanation of the invention process of obtaining the gene markers of the present invention

[0057] (1) The DNA extraction method of ear tissue of purebred French Large White pigs was based on the phenol-chloroform method for extracting whole genome DNA. The DNA of purebred French Large White pigs was tested for quality and concentration using a Nanodrop-ND1000 spectrophotometer. The samples were qualified when the A260 / 280 ratio was between 1.8 and 2.0 and the A260 / 230 ratio was between 1.7 and 1.9. Finally, the qualified DNA samples were uniformly diluted to 50 ng / μL.

[0058] (2) 50K SNP genotyping of the whole genome of pigs: DNA samples were sent to Beijing Compson Biotechnology Co., Ltd., and chip hybridization and result scanning (i.e. genotype determination) were performed based on the SMIC-1 50K SNP typing platform using the instructions and standard procedures of Illumina Infinium. Finally, the genotype data were read using GenomeStudio software. PLINKv1.90 was used to perform quality control on the obtained genotype data, and the detection rate <95%, the mimor allel frequency (MAF) <1% or the deviation from Hardy-Weinberg Equilibrium (HWE) P≤10 -6 SNP markers with a detection rate of <95% were excluded.

[0059] (3) Filling missing genotypes in pigs: Using the public data of 947 individuals (https: / / doi.org / 10.1038 / s41467-023-40434-3) as the filling reference population, the above-mentioned purebred French Large White pig 50K SNPs chip data were filled into whole genome sequencing data based on the reference haplotype library using Beagle v5.1 software. The genotype filling data was then quality controlled, and the specific quality control method was the same as step (2).

[0060] (4) Genome-wide association (GWAS) analysis: This study used the univariate mixed model of GEMMA software to conduct GWAS analysis on the original backfat thickness trait of purebred French Large White pigs. Among them, the first three principal components, sex, weight, age, and farm-year season were added to the model as covariates for association analysis. The first three principal components were obtained by principal component analysis (PCA) of the experimental population using GCTA software.

[0061] In addition, given the assumption that the number of independent haplotype boxes in pigs and humans is basically the same, the genomic significance threshold set for human GWAS analysis was 5.00×10 -8 The present invention refers to the significant threshold of the human genome, and the significant level threshold of the genome is 5.00×10 -8 ; The significant threshold at the chromosome level was 1.00×10 -6 .

[0062] GWAS analysis results Figure 1 As shown. Figure 1 It can be seen that in Large White pigs, there is a locus on chromosome 17 that significantly affects the back fat thickness at 100 kg body weight, and the strongest associated SNP is g.305 G>A (corresponding to the G>A mutation at 36543568 bp on chromosome 17 of the International Pig Reference Genome 11.1 version) (P=5.46×10 -10 ).

[0063] (5) Analysis of the association between different genotypes and the backfat thickness phenotype of French Large White pigs:

[0064] according to Figure 1 It can be seen that the molecular marker SNP site g.305 G>A is extremely significantly correlated with the backfat thickness trait (P=5.46×10 -10), indicating that this molecular marker significantly affects the back fat thickness trait of purebred French Large White pigs. Through auxiliary selection of this SNP locus in pigs, the back fat thickness of the population can be reduced, thereby accelerating the breeding process of pig back fat thickness trait. In addition, this study used SPSS software to conduct a one-way between-group analysis of variance on the back fat thickness of individuals with different genotypes at the g.305 G>A locus. The results showed that the back fat thickness of the AA type was higher than that of the AG and GG types (P < 0.0001), indicating that homozygous AA is the most unfavorable to the back fat thickness trait of French Large White pigs (Table 1 and Figure 2 ).

[0065] Table 1 Correlation between molecular marker SNP locus g.305 G>A and backfat thickness trait

[0066]

[0067] Note: Back fat thickness results are expressed as mean ± standard deviation (SD). Data in the same column with different lowercase letters indicate extremely significant differences (P<0.0001). The total number of individuals was 3167, of which 23 had no genotype.

[0068] (6) Analysis of the differences in lean meat percentage phenotype between different genotypes and French Large White pigs:

[0069] In order to analyze the relationship between the g.305 G>A locus and the lean meat rate, this study further used SPSS software to conduct a one-way between-group variance analysis on the lean meat rate of individuals with different genotypes of the g.305 G>A locus. According to Table 2, the lean meat rate of GG-type individuals is higher than that of AG and GG-type individuals (P<0.001), indicating that homozygous AA is the most unfavorable to the lean meat rate trait of French Large White pigs. Therefore, in the process of breeding, it is necessary to gradually eliminate AA-type breeding pigs and retain GG-type breeding pigs to increase the frequency of the allele G at this locus generation by generation, reduce the back fat thickness of pigs, and thus increase the lean meat rate of pigs.

[0070] Table 2 Correlation between molecular marker locus g.305 G>A and lean meat percentage of pigs

[0071]

[0072] Note: The lean meat percentage results are expressed as mean ± standard deviation (SD). Data in the same column with different lowercase letters on the shoulders indicate extremely significant differences (P<0.001), and data in the same column with the same lowercase letters on the shoulders indicate no significant differences (P>0.05). The total number of individuals was 3167, of which 23 had no genotype.

[0073] Example 3 Detailed explanation of the invention process of detecting SNP markers

[0074] (1) The target fragment containing the SNP site significantly associated with the back fat thickness of Large White pigs is a nucleotide sequence of 873 bp in chromosome 17. The upstream and downstream primers for sequence amplification are primer-F and primer-R. The nucleic acid sequence is as follows:

[0075] Upstream primer primer-F: 5′-GGGCTTGCACTTGCAGTATG-3′;

[0076] Downstream primer primer-R: 5'-GAGGATTGTGGACTCGGAGC-3'.

[0077] (2) PCR amplification system and condition settings

[0078] Prepare a 10 μL system, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, ddH 2 O 3.4 μL, PCR reaction program was: 95°C 3min; 94°C 30s, 60°C 30s, 72°C 55s, 30 cycles; 72°C 10 min.

[0079] (3) DNA sequencing and identification: Sequencing was performed at Shenzhen BGI Genomics Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are shown below:

[0080] GGGCTTGCACTTGCAGTATGGACCCCAAAGCTATAAAAGTAGGTCAGCTTCATCTTTTGAGTGGTATTTATCAATATTGAAGAACTACCCTGGCAATTACCCACCCATCTCCAGACTGATCAAAGAAGAGACTCATCCTCTGTTGATTTGGG GCAGGGTAATATTTTCTCAGAGAGCCCTGAGTATGTTACCTGGGGCTTCCTCCGTTTTTTTCACAACGCTGTTTGGAAGCTGCTCCTGTTTGAAGTGCACCTTCTCCTACCTGACAGCTTTGCCTGGGATTGCAGTGTTTCTCCTCTGTTGC M(G / A)ACATTGACTTTGTGAAATCTGTTGGCCATCGGTGGGCTTTGCCTTTGAGTCAGGGGCTTCATCTAACTCTCACATAGCCTGGGACAGGCGCTCAGGGACAGGTGTGCGGGGCTGCGTAGTGCTGTCAAAACAGGAGGGATGT CTGGCAGGGCCCACGTTTATCCGCGGTGGCTTCCTCAGGGAATATTTTCTTTTCTTTTTTGTCTTTTTGGGCCCTCACCGGCGGCATATGGAGGTTCCCAGGTTAGGAGTCCAATCAGAGCTGTAGCTGCTGGTCTACCCCA CAGTCACAGCAATAGTAGATCCGAGCCGTGTCTGCGACCTGCACCACAGCTCACAGCAACACTGGATCCTTAACCCACTGGGCGAGGCTAGGGATTGAACCCATGTCCTCATGGATACTCGTCAGATTTGTTTCTGCTGAGC CACGACAGAAACTCCAGGGAAGGTTTTCATGTCAAAGTAGCTCTGGCTGTCTTGTGCAAACTTTTAATAACAGTCCTATGAGTTGATGTCGTTATCCCCAATTTATAGATGGGAAATCAGAGGCTCCGAGTCCACAATCCTC

[0081] Note: The M marked in the sequence is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation), and the bold at the beginning and end of the sequence is the primer sequence binding position.

[0082] Example 4 Analysis of the SNP site g. 305 G>A effect of molecular markers

[0083] The present invention provides a SNP molecular marker that can significantly reduce the back fat thickness of Large White pigs. Using the SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of Large White pigs with thick back fat. If the present invention selects all AA-type individuals into GG-type individuals, the back fat thickness of 100 kg of Large White pigs will be reduced by 1.13 mm, and the lean meat rate will be increased by 0.49%. A large-scale pig farm with 10,000 heads can increase more than 4,900 kg of lean meat. It can be seen that the potential for low back fat thickness to provide benefits to the pig farming industry is huge. Among the individuals of this SNP molecular marker, by optimizing the dominant allele (G) of the SNP in Large White, it can ultimately achieve the improvement of the economic benefits of commercial pigs, thereby increasing the profits of the enterprise.

[0084] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A reagent for detecting a molecular marker on chromosome 17 of a pig related to backfat thickness, for use in identifying pig backfat thickness or lean meat percentage, screening pig breeds with low backfat thickness or high lean meat percentage, or genetic breeding of pig backfat thickness or lean meat percentage, characterized in that: The SNP site of the molecular marker corresponds to the G>A mutation at 36543568bp on chromosome 17 of the international pig reference genome version 11.

1. The polymorphism of the base at this site leads to different backfat thickness traits, wherein the backfat thickness of AA genotype pigs at the molecular marker is higher than that of AG and GG genotype pigs, and the lean meat rate of GG genotype pigs is higher than that of AA and AG genotype pigs; The pigs are French Large White pigs and their synthetic strains.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is G or A.

3. A primer pair for detecting a molecular marker on chromosome 17 of pigs related to backfat thickness in identifying pig backfat thickness or lean meat percentage traits, screening pig breeds with low backfat thickness or high lean meat percentage, or genetic breeding of pig backfat thickness or lean meat percentage traits, characterized in that The primer pair comprises primers primer-F and primer-R, and the nucleic acid sequences thereof are as follows: Upstream primer primer-F: 5′- GGGCTTGCACTTGCAGTATG -3′; Downstream primer primer-R: 5′-GAGGATTGTGGACTCGGAGC-3′; The molecular marker is the molecular marker described in claim 1; at the molecular marker, the back fat thickness of AA genotype pigs is higher than that of AG and GG genotype pigs, and the lean meat rate of GG genotype pigs is higher than that of AA and AG genotype pigs; The pigs are French Large White pigs and their synthetic strains.

4. A kit for detecting molecular markers on chromosome 17 of pigs related to backfat thickness traits for use in identifying pig backfat thickness or lean meat percentage traits, screening pig breeds with low backfat thickness or high lean meat percentage, or genetic breeding of pig backfat thickness or lean meat percentage traits, characterized in that The kit comprises the primer pair described in claim 3; The molecular marker is the molecular marker described in claim 1; at the molecular marker, the back fat thickness of AA genotype pigs is higher than that of AG and GG genotype pigs, and the lean meat rate of GG genotype pigs is higher than that of AA and AG genotype pigs; The pigs are French Large White pigs and their synthetic strains.

5. A method for identifying pig back fat thickness or lean meat rate, characterized in that The following steps are included: Detecting the SNP site of the molecular marker described in claim 1 or 2 on chromosome 17 of pigs, and judging the pig backfat thickness or lean meat rate trait according to whether the single nucleotide at the SNP site is G or A; The back fat thickness of AA genotype pigs at this molecular marker is higher than that of AG and GG genotype pigs, and the lean meat rate of GG genotype pigs is higher than that of AA and AG genotype pigs. The pigs are French Large White pigs and their synthetic strains.

6. A method for selecting pig breeds with low backfat thickness or high lean meat percentage, characterized in that The following steps are included: Detecting the SNP site of the molecular marker described in claim 1 or 2 on chromosome 17 of pigs, eliminating individuals with AA genotype at the SNP site, and retaining individuals with AG or GG genotype at the SNP site as breeding pigs; The pigs are French Large White pigs and their synthetic strains.

7. The method according to claim 6, characterized in that: The detection method comprises the following steps: (1) Extracting genomic DNA from the pig to be tested; (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product; (3) Sequencing the PCR amplification product to obtain sequencing results; (4) Determine the genotype based on the sequencing results.

8. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the molecular markers of claim 1 or 2 of the breeding pigs in the breeding pig core group, and make corresponding selections based on the molecular markers: select the breeding pigs with the AG genotype or the GG genotype at the 36543568bp position on chromosome 17 of the International Pig Reference Genome 11.1 version for the successive breeding of the breeding pigs, and eliminate the breeding pigs with the AA genotype at this point, so as to increase the frequency of the allele G at this site from generation to generation, thereby reducing the back fat thickness of the offspring pigs or increasing the lean meat rate of the offspring pigs; The pigs are French Large White pigs and their synthetic strains.

Images