Method, reagent and application for identifying genus-level plants of Paris polyphylla

Abstract

The invention discloses a method, reagent and application for identifying genus-level plants of the genus Paris, and relates to the technical field of plant identification, comprising the following steps: using the genomic DNA of the sample to be identified as a template, using primers Paris-F, Paris-R and probe Paris-probe to perform real-time fluorescence quantitative PCR amplification reaction, and detecting that the CT value is less than 40, then identifying it as a genus-level plant of the genus Paris; the sequence of the primer Paris-F is shown in SEQ ID No.1, the sequence of the primer Paris-R is shown in SEQ ID No.2, and the sequence of the probe Paris-probe is shown in SEQ ID No.3. The invention has excellent specificity and sensitivity, and can quickly and reliably identify genus-level plants of the genus Paris.

Description

Technical Field

[0001] The invention belongs to the technical field of plant identification, and particularly relates to a method, a reagent and an application for identifying genus-level plants of the genus Paris. Background Art

[0002] Paris L. is a genus of the family Melanophoraceae, with about 28 species. It is a perennial herb with slender or thick rhizomes with segments. The rhizomes of many species of this genus can be used for medicinal purposes, and are effective for snake bites, traumatic injuries, and unexplained swellings. It has broad market prospects and high market value. In order not to affect the safety and effectiveness of the use of traditional Chinese medicine, accurate identification of medicinal materials is crucial for traditional Chinese medicines belonging to the genus Paris and products containing them.

[0003] The traditional identification methods of Paris polyphylla medicinal plants are origin identification, trait identification, microscopic identification and physical and chemical identification. The theoretical basis of traditional identification methods is based on the analysis of trait characteristics of taxa, which are phenotypes closely related to the environment. From the perspective of molecular genetics, the differences in species phenotypes should ultimately be traced back to differences in genotypes, that is, differences in DNA sequences. Therefore, comparative studies on genome sequence differences undoubtedly provide an essential basis for plant classification and identification. With the continuous breakthroughs in life sciences, molecular biological identification methods have emerged. Such methods have achieved rapid development by using DNA molecular marker technology to identify Chinese medicinal raw plants and their medicinal materials and decoction pieces. There have been many reports on the application of DNA molecular marker identification in the identification of ginseng medicinal materials. RFLP, SSR, RAPD, AP-PCR, AFLP, ISSR, SNP and other technologies have been successively applied to the identification of medicinal plants. However, in addition to PCR amplification, these technologies also require electrophoresis or sequencing technology to present identification results. They have the disadvantages of cumbersome operation steps, heavy workload, large human interference, low detection sensitivity, poor specificity and poor repeatability of experimental results. Especially in the identification of industrially processed and high-temperature dried medicinal materials, they are difficult to be applied in practice and gradually withdraw from the stage. With the development of molecular biology and the advent of the genomic era, new methods have been provided for the identification of some new medicinal plants.

[0004] Real-time fluorescence PCR technology is already a very mature and successful technology in species identification. It uses one or more sets of specific primer probes to achieve the purpose of identification by monitoring changes in fluorescence intensity. This method has the advantages of strong specificity, high sensitivity, simple operation, and high detection efficiency. It has good market application prospects and promotion and application value. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the identification methods in the prior art, such as poor reliability, complex operation, large workload, poor repeatability of experimental results, etc., and to provide a method, reagent and application for identifying genus-level plants of the genus Paris.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] A method for identifying genus-level plants of the genus Paris, comprising the following steps: using genomic DNA of a sample to be identified as a template, using primers Paris-F, Paris-R and a probe Paris-probe to perform a real-time fluorescence quantitative PCR amplification reaction, and detecting that the CT value is less than 40, then identifying the plant as a genus-level plant of the genus Paris; the sequence of the primer Paris-F is shown in SEQ ID No.1, the sequence of the primer Paris-R is shown in SEQ ID No.2, and the sequence of the probe Paris-probe is shown in SEQ ID No.3.

[0008] The sequences of the above primers and probes are shown in Table 1.

[0009] Specifically, the 5' end of the probe Paris-probe is modified with CY5, and the 3' end of the probe Paris-probe is modified with MGB.

[0010] Specifically, the minimum detection limit of the above template is 0.001 ng / μL.

[0011] Specifically, the reaction system of the real-time fluorescence quantitative PCR amplification is: 10 μL of 2xT5 Fast qPCR Mix, 0.7 μL of 10 uM upstream primer, 0.7 μL of 10 uM downstream primer, 0.6 μL of 10 uM probe, 1 μL of test template, and ddH2O is used to make up to 20 μL reaction system.

[0012] Specifically, the real-time fluorescence quantitative PCR amplification program is: 95°C for 1 min, one cycle; 95°C for 15 s, 60°C for 1 min, 40 cycles; and collecting the corresponding fluorescence at 60°C for 1 min during the annealing and extension stage.

[0013] The second aspect of the present invention provides a reagent for identifying genus-level plants of the genus Paris, including a primer pair and a probe, the primer pair consisting of primers Paris-F and Paris-R, the sequence of primer Paris-F is shown in SEQ ID No.1, the sequence of primer Paris-R is shown in SEQ ID No.2, and the sequence of probe Paris-probe is shown in SEQ ID No.3.

[0014] The third aspect of the present invention provides use of the above reagent in identifying genus-level plants of the genus Paris.

[0015] Table 1 Primer and probe sequences of genus-level plants of Paris polyphylla

[0016]

[0017] The beneficial effects of the present invention are:

[0018] The identification method and reagent of the present invention have excellent specificity and sensitivity, and can accurately identify or detect genus-level plants of the genus Paris by judging the detection CT value, thereby realizing rapid identification of genus-level plants of the genus Paris. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the standard curve of Example 2 of the present invention;

[0020] Figure 2 This is the amplification map of Example 2 of the present invention;

[0021] Figure 3 This is the amplification map of Example 3 of the present invention;

[0022] Figure 4 This is the amplification map of Example 4 of the present invention;

[0023] Figure 5 Amplification profile for the first batch of enzyme verification;

[0024] Figure 6 This is the amplification profile for the second batch of enzyme verification;

[0025] Figure 7 This is the amplification map verified by experimenter A;

[0026] Figure 8 This is the amplification map of the operation verification performed by experimenter B. DETAILED DESCRIPTION

[0027] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0028] Example 1 PCR amplification and identification of target plant samples

[0029] The genomic DNA of the genus-level plants of the genus Paris was extracted as a template, and primers Paris-F and Paris-R were used for PCR amplification. The probe Paris-probe was used for real-time fluorescence quantitative PCR detection. The sequence of primer Paris-F was CATCTCACATCAATAACGCGACC, the sequence of primer Paris-R was GTATCCACGGCAAAAGAAACTTC, the sequence of probe Paris-probe was TTCCACCTACAYTTATAG, the 5' end of probe Paris-probe was modified with CY5, and the 3' end of probe Paris-probe was modified with MGB. Among them, the reaction system of amplification is shown in Table 1.1, the amplification procedure is shown in Table 1.2, and the identification results and PCR products are obtained after amplification.

[0030] Table 1.1 Reaction system

[0031]

[0032] Table 1.2 Amplification procedures

[0033]

[0034] Example 2 Preparation of standard plasmids of Paris polyphylla and creation of probe standard curves

[0035] Positive clone samples were prepared according to the PCR products obtained in Example 1, and then sequenced. Positive clone samples with completely correct sequences in the sequencing results were selected, and plasmids were extracted using a plasmid extraction kit.

[0036] Calculate the plasmid concentration copy number as follows:

[0037] C=A•B -1 ×6.02×10 14 ,

[0038] In the formula, A is the plasmid concentration (ng / μL), B is the molecular weight of the plasmid DNA, and C is copies•μL -1 . Calculate the mother solution concentration: Paris polyphylla plant standard plasmid (2.60*10 10 copies•μL -1 ), used as experimental plasmid standard.

[0039] Use solvent to dilute the Paris polyphylla-grade plant plasmid standard to 2.60*10 10 copies•μL -1, and then diluted it into 5 gradients at 10 times the concentration, and then used the diluted gradient plasmid standards as templates to perform real-time fluorescence quantitative PCR detection under the reaction conditions of Example 1. Each group of experiments was repeated 3 times to develop a standard curve. The detection results of the Paris polyphylla-level plant plasmid standards are shown in Table 2, and the standard curve is shown in Table 2. Figure 1 The relevant amplification patterns are shown in Figure 2 shown.

[0040] The standard curve equation of Paris polyphylla at the genus level is: y = -3.8721x + 47.119; R²=0.9997; R² is greater than 0.98, which meets the standard requirements of real-time fluorescence quantitative PCR.

[0041] Table 2 Detection results of genus-level plant plasmid standards of Paris polyphylla

[0042]

[0043] Example 3 Specificity verification of identifying genus-level plants of the genus Paris

[0044] The present embodiment provides a method for identifying genus-level plants of the genus Paris, comprising the following steps: using genomic DNA of Trillium of the genus Paris of the family Melanophoraceae and 20 closely related species of genus-level plants of the genus Paris, such as Paris polyphylla, Paris polyphylla multiflora, Paris polyphylla gaopingensis, and Paris polyphylla hainanensis, as templates, respectively, and setting up a negative control group (ddH2O), using the primer pairs, probes, reaction systems, and amplification procedures of the first embodiment to amplify the templates, repeating each sample 3 times, and the detection results are shown in Table 3, and the amplification patterns are shown in Table 3. Figure 3 shown.

[0045] Table 3 Specificity test results

[0046]

[0047] Table 3

[0048]

[0049] Table 3

[0050]

[0051] As can be seen from Table 3, the primer pairs and probes provided by the present invention have amplification reactions and fluorescence phenomena with genus-level plants of the genus Paris, with good specificity, and the CT values ​​of every three repetitions are similar, with good repeatability.

[0052] Example 4: Sensitivity Verification of Primer Probes

[0053] The DNA concentrations of the Paris polyphylla plant samples used in Example 3 were set to seven concentration gradients of 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL, 0.00001 ng / μL, and 0.000001 ng / μL, respectively. The samples were amplified using the primer pairs, probes, reaction systems, and amplification procedures of Example 1 to test the sensitivity of the primer pairs and probes. Each sample was repeated three times and measured using a real-time fluorescence quantitative PCR instrument. The test results are shown in Tables 4 and 5. Figure 4 shown.

[0054] Table 4 Primer probe sensitivity test results

[0055]

[0056] As can be seen from Table 4, the primer pairs and probe pairs of the present invention have high sensitivity in identifying genus-level plants of the genus Paris, with a minimum detection limit of 0.001 ng / μL and an average CT value of 35.383.

[0057] Example 5 Repeatability Verification

[0058] 1. Repeatability verification between different batches of enzymes by the same experimenter and the same real-time fluorescence quantitative PCR instrument (QuantStudio Dx);

[0059] 2. Repeatability verification between different operators using the same batch of enzyme and the same real-time fluorescence quantitative PCR instrument (QuantStudio Dx).

[0060] Twenty closely related species of Paris polyphylla collected in the field and confirmed as Paris polyphylla plants by morphology and chloroplast genome comparison were used as known samples. The primer pairs, probes, reaction systems and amplification procedures of Example 1 were used. Each sample was repeated 3 times, and the coefficient of variation (CV%) value was calculated to evaluate the repeatability. The calculation formula of the coefficient of variation value is:

[0061] CV=SD (standard deviation) / Mean (mean) × 100%.

[0062] The validation results of different batches of enzymes by the same experimenter and the same QPCR instrument are shown in Table 5.1 and Table 5.2; the amplification profile of the first batch of enzyme validation is shown in Figure 5 The amplification profile of the second batch of enzyme verification is as follows Figure 6 The verification results of the same batch of enzymes and the same QPCR instrument operated by different personnel are shown in Tables 5.3 and 5.4; the amplification map of the verification of the operation of experimenter A is shown in Figure 7 The amplification map verified by experimenter B is as follows: Figure 8 .

[0063] Table 5.1 Validation results of the first batch of enzymes by the same experimenter and QPCR instrument

[0064]

[0065] Table 5.1 continued

[0066]

[0067] Table 5.1 continued

[0068]

[0069] Table 5.2 Verification results of the second batch of enzymes by the same experimenter and QPCR instrument

[0070]

[0071] Table 5.2 continued

[0072]

[0073] Table 5.2 continued

[0074]

[0075] Table 5.3 Verification results of the same batch of enzyme and QPCR instrument operated by experimenter A

[0076]

[0077] Table 5.3 continued

[0078]

[0079] Table 5.3 continued

[0080]

[0081] Table 5.4 Verification results of the same batch of enzyme and QPCR instrument operated by experimenter B

[0082]

[0083] Table 5.4 continued

[0084]

[0085] Table 5.4 continued

[0086]

[0087] It can be seen from Tables 5.1, 5.2, 5.3 and 5.4 that the coefficient of variation of the repeatability verification results is less than 3% whether it is between different batches of enzymes of the same experimenter and the same QPCR instrument, or between different operators of the same batch of enzymes and the same QPCR instrument. The experimental repeatability is good, the stability of different batches of polymerase is excellent, and the reaction system is stable.

[0088] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0089] The above is only a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the form disclosed herein, and should not be regarded as excluding other embodiments, but can be used in various other combinations, modifications and environments, and can be modified within the scope of the concept described herein through the above teachings or the technology or knowledge of the relevant field. The changes and modifications made by those skilled in the art shall not deviate from the spirit and scope of the present invention, and shall be within the scope of protection of the claims attached to the present invention.

Claims

1. A method for identifying genus-level plants of the genus Paris, characterized in that: The method comprises the following steps: using the genomic DNA of the sample to be identified as a template, adopting primers Paris-F, Paris-R and probe Paris-probe to carry out real-time fluorescence quantitative PCR amplification reaction, and detecting that the CT value is less than 40, then identifying the plant as a genus-level plant of the genus Paris; the sequence of the primer Paris-F is shown in SEQ ID No.1, the sequence of the primer Paris-R is shown in SEQ ID No.2, and the sequence of the probe Paris-probe is shown in SEQ ID No.

3.

2. The method for identifying genus-level plants of the genus Paris according to claim 1, characterized in that: The 5' end of the Paris-probe is modified with CY5, and the 3' end of the Paris-probe is modified with MGB.

3. The method for identifying genus-level plants of the genus Paris according to claim 1, characterized in that: The minimum detection limit of the template is 0.001 ng / μL.

4. The method for identifying genus-level plants of the genus Paris according to claim 1, characterized in that: The reaction system of the real-time fluorescence quantitative PCR amplification is: 10 μL of 2×T5 Fast qPCR Mix, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 1 μL of test template, and ddH2O is used to make up to 20 μL reaction system.

5. The method for identifying genus-level plants of the genus Paris according to claim 1, characterized in that: The real-time fluorescence quantitative PCR amplification program is: 95°C for 1 min, one cycle; 95°C for 15 s, 60°C for 1 min, 40 cycles; and collecting the corresponding fluorescence at the 60°C annealing and extension stage for 1 min.

6. A reagent for identifying genus-level plants of the genus Paris, characterized in that: Containing a primer pair and a probe, the primer pair consists of primers Paris-F and Paris-R, the sequence of the primer Paris-F is shown in SEQ ID No.1, and the sequence of the primer Paris-R is shown in SEQ ID No.2; The sequence of the probe Paris-probe is shown as SEQ ID No.

3.

7. Use of the reagent according to claim 6 in identifying genus-level plants of the genus Paris.

Images