White-headed bulbul coronavirus detection kit and detection method based on CRISPR / Cas12a

Abstract

The present invention discloses a kit and method for detecting white-headed bulbul coronavirus based on CRISPR / Cas12a. Specifically disclosed is a white-headed bulbul coronavirus detection system based on CRISPR / Cas12a, in which a specific gRNA is designed for the S gene encoding the white-headed bulbul coronavirus spike glycoprotein protein, and after fluorescent labeling and cutting the target sequence, fluorescent quantitative detection or immunochromatographic test strips are used to detect whether the sample to be tested contains white-headed bulbul coronavirus. The white-headed bulbul coronavirus detection method of the present invention has a detection limit of 3.43 copy / μL, has no cross-reaction with other common bird viruses, and is specific. The detection system of the present invention has the advantages of high sensitivity, strong specificity, short time consumption, and no dependence on large-scale experimental equipment.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a CRISPR / Cas12a-based white-headed bulbul coronavirus detection kit and a detection method thereof. Background Art

[0002] White-headed Bulbul (Pycnonotus sinensis) is a bird of the family Pycnonotidae, order Passeriformes. Its aliases include white-headed old man, white-headed woman, pale-rumped bulbul, Chinese bulbul, etc. It is a common bird in the Yangtze River Basin and the vast areas to the south of it. It feeds almost entirely on insects during the breeding season. It is of great significance in plant protection. It can eat a large number of agricultural and forestry pests and is one of the beneficial birds of agriculture and forestry. In 2000, it was listed in the "List of Terrestrial Wildlife with Important Economic and Scientific Research Value under State Protection" by the State Forestry Administration of China.

[0003] However, coronaviruses can continue to spread among mammals and birds. Coronaviruses originating from birds are collectively referred to as avian coronaviruses, involving at least two coronavirus genera, type C and type D, which have a significant impact on bird health. Among them, white-crowned bulbul coronavirus disease is a coronavirus originating from birds, belonging to the type D coronavirus genus of avian coronavirus. It can cause a variety of diseases of the respiratory tract, digestive tract, and central nervous system, endangering the life and health of white-crowned bulbuls, thereby affecting the development of agriculture and forestry. Therefore, the investigation, diagnosis, and prevention of white-crowned bulbul coronaviruses deserve the attention of researchers.

[0004] CRISPR-Cas (Clustered regularly interspaced short palindromic repeats, CRISPRs) is an adaptive immune system in bacteria. Cas proteins target and degrade foreign nucleic acids through RNA-guided nucleases. Based on this characteristic, researchers have developed a variety of nucleic acid detection systems such as CRISPR-Cas9, CRISPR-Cas12, and CRISPR-Cas13. The nucleic acid detection system of CRISPR-Cas12a extracts plasmids from clinical samples to be tested and performs recombinase polymerase amplification (RPA) under constant temperature conditions. The CRISPR / Cas12a-gRNA complex binds to and cuts the target DNA, which activates the trans-cutting of ssDNA, and the fluorescent reporter molecule coupled to the ssDNA produces a fluorescent signal during cutting.

[0005] Immunochromatographic strip testing is an efficient technical solution for rapid clinical or on-site testing. Short reaction time, long-term stable storage and relatively low cost make immunochromatographic strip testing widely used in clinical and on-site testing of avian virus nucleic acids.

[0006] However, the detection method of DNA endonuclease targeting CRISPR trans-reporter gene has not yet established a system for detecting white-headed bulbul coronavirus nucleic acid. Summary of the invention

[0007] In order to overcome the defects of the prior art, the present invention provides a white-headed bulbul coronavirus detection kit based on CRISPR / Cas12a and a detection method thereof.

[0008] The first object of the present invention is to provide a method for detecting white-headed bulbul coronavirus, comprising the following steps:

[0009] S1: Extract RNA from the sample to be tested and reverse transcribe it into cDNA;

[0010] S2: using the cDNA obtained in step S1 as a template, performing RPA amplification reaction using primers with nucleotide sequences such as SEQ ID NO.3 and SEQ ID NO.4 to obtain a specific amplification product;

[0011] S3: The specific amplification product obtained in step S2 is added to the CRISPR / Cas12a detection system to perform a cleavage reaction to obtain a cleavage product;

[0012] The CRISPR / Cas12a reaction system includes a specific gRNA for the S gene of white-headed bulbul coronavirus, a Cas12a protein, and a ssDNA reporter system; the gRNA is a gRNA with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2; and the sequence modified by the ssDNA reporter system is TTATTATT.

[0013] S4: Use fluorescent quantitative detection method or immunochromatographic test strips to detect white-crowned bulbul coronavirus in the sample to be tested.

[0014] Preferably, the gRNA is a gRNA whose nucleotide sequence is shown in SEQ ID NO.2.

[0015] Preferably, the ssDNA reporter system is ssDNA FQ reporter or ssDNA FB reporter; when using fluorescent quantitative detection method, the ssDNA reporter system is ssDNA FQ reporter, and its labeled product is: 5'-FAM-TTATTATT-BHQ-3'; when using immunochromatographic test strips for detection, the ssDNA reporter system is ssDNA FB reporter, and the labeled product is: 5'-FAM-TTATTATT-Biotin-3'.

[0016] Preferably, the procedure of the RPA amplification reaction is: 39° C. for 30 min.

[0017] Preferably, the CRISPR / Cas12a detection system is 2 μL of 10×NEBuffer, 1 μL of 500 nM Cas12a, 1 μL of 500 nM ssDNA reporter system, 1 μL of 300 nM gRNA, 2 μL of the specific amplification product obtained in step S2, and 1 μL of H 2 O 13μL.

[0018] Preferably, when step S4 uses a fluorescent quantitative detection method to detect the white-crowned bulbul coronavirus in the sample to be tested, the cleavage reaction in step S3 is performed at 37° C. for 30 min, with detection every 30 s, reading the fluorescence signal, and obtaining a fluorescence curve.

[0019] Preferably, when step S4 uses an immunochromatographic test strip to detect white-headed bulbul coronavirus in the sample to be tested, the cleavage reaction in step S3 is performed at 37° C. for 10-30 min.

[0020] The second object of the present invention is to provide a kit for detecting white-headed bulbul coronavirus, comprising RPA amplification primers having nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, gRNA having a nucleotide sequence as shown in SEQ ID NO.2, Cas12a protein, and a ssDNA reporter system.

[0021] Preferably, the ssDNA reporter system is ssDNA FQ reporter or ssDNA FB reporter; when the fluorescence quantitative detection method is used, the ssDNA reporter system is ssDNA FQ reporter, and its labeled product is: 5'-FAM-TTATTATT-BHQ-3'; when the immunochromatographic test strip is used for detection, the ssDNA reporter system is ssDNA FB reporter, and its labeled product is: 5'-FAM-TTATTATT-Biotin-3'.

[0022] Beneficial effects of the present invention:

[0023] 1. The present invention realizes high sensitivity, high specificity and rapid visual detection of white-headed bulbul coronavirus by using CRISPR / Cas12a specific recognition nucleic acid combined with immunochromatography technology. The minimum detectable white-headed bulbul coronavirus nucleic acid is 3.43 copy / μL, and it has strong specificity for white-headed bulbul coronavirus.

[0024] 2. The present invention is a CRISPR / Cas12a-based white-headed bulbul coronavirus detection tool, which may include immunochromatographic strip detection and can achieve convenient and quick result interpretation.

[0025] 3. The rapid detection method for white-crowned bulbul coronavirus established by the present invention provides an accurate, rapid and simple detection method for clinical and field investigations.

[0026] 4. The present invention discloses a series of CRISPR / Cas12a reaction systems, gRNA and RPA amplification primers for detecting coronavirus in white-headed bulbul. The combination of CRISPR / Cas12a reaction system, gRNA and RPA amplification primer can be used for detecting coronavirus in white-headed bulbul.

[0027] In general, the present invention is the first to use CRISPR / Cas12a to detect white-headed bulbul coronavirus, which has the advantages of high sensitivity, strong specificity, short time consumption, high throughput, and no reliance on large-scale experimental equipment. These advantages make the CRISPR / Cas12a-based immunochromatographic test strip detection method developed by the present invention convenient for rapid detection and diagnosis of white-headed bulbul coronavirus in laboratories and field surveys. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Figure 44 shows the fluorescence detection results of gRNA-1 based on CRISPR / Cas12a for detecting white-headed bulbul coronavirus (44 min); g1 represents the fluorescence detection result of gRNA-1, and the negative control uses ddH 2 O replaces gRNA-1.

[0029] Figure 2 Figure 2 is the fluorescence detection result (44 min) of gRNA-2 based on CRISPR / Cas12a for detecting white-headed bulbul coronavirus; g2 represents the fluorescence detection result of gRNA-2, and the negative control uses ddH 2 O replaces gRNA-2.

[0030] Figure 3 This is a comparison of the fluorescence detection results of white-headed bulbul coronavirus using gRNA-1 and gRNA-2 based on CRISPR / Cas12a; g1 represents gRNA-1, and g2 represents gRNA-2.

[0031] Figure 4 The fluorescence quantitative detection results of gRNA-2 under different concentrations based on CRISPR / Cas12a; the concentrations of gRNA-2 were set to 300nM, 200nM, 100nM, 50nM, 25nM and negative control (i.e., ddH 2 O replaces gRNA).

[0032] Figure 5Figure 2 is a fluorescence quantitative detection result diagram based on CRISPR / Cas12a under the influence of different concentrations of single-stranded DNA probe ssDNA FQ reporter; the concentrations of ssDNA FQ reporter were set to 500nM, 250nM, 125nM, 50nM, 25nM and negative control (i.e., using ddH 2 O instead of ssDNA FQ reporter).

[0033] Figure 6 Figure 3 is a fluorescence quantitative detection result diagram of the effect of different concentrations of Cas12a enzyme based on CRISPR / Cas12a; the concentration of Cas12a enzyme was set to 1 μM, 750nM, 500nM, 400nM, 300nM, 200nM, 100nM, 50nM and negative control (ie, ddH 2 O replaces the Cas12a enzyme).

[0034] Figure 7 This is a result diagram of the sensitivity of the white-headed bulbul coronavirus detected by fluorescence quantitative method based on CRISPR / Cas12a; the nucleic acid concentrations of the white-headed bulbul coronavirus were 3.43×10 3 copies / μL, 3.43×10 2 copies / μL, 3.43×10 1 copies / μL, 3.43×10 0 copies / μL, 3.43×10 -1 copies / μL, negative control was added with ddH 2 O replaces the template.

[0035] Figure 8 This is a graph showing the sensitivity of the white-crowned bulbul coronavirus detected using an immunochromatographic test strip based on CRISPR / Cas12a. The nucleic acid concentration of the white-crowned bulbul coronavirus is 3.43×10 3 copies / μL, 3.43×10 2 copies / μL, 3.43×10 1 copies / μL, 3.43×10 0 copies / μL, 3.43×10 -1 copies / μL, negative control was added with ddH 2 O replaces the template.

[0036] Fig. 9 This is a graph showing the results of detecting different viruses using fluorescence quantitative method based on CRISPR / Cas12a.

[0037] Fig.10To investigate the effects of different concentrations of ssDNA FB reporter on the detection of white-headed bulbul coronavirus by immunochromatographic test strips based on CRISPR / Cas12a, the concentrations of ssDNA FB reporter were set to 50nM, 100nM, 200nM, 300nM, 400nM, and 500nM.

[0038] Fig.11 This is the result of detecting white-headed bulbul coronavirus using immunochromatographic test strips based on CRISPR / Cas12a when the ssDNA FB reporter concentration was 500nM.

[0039] Fig.12 To investigate the effect of different Cas12a reaction cleavage times on the detection of photovirus by immunochromatographic test strips based on CRISPR / Cas12a, the reaction time was set to 30min, 20min, 15min, and 10min. DETAILED DESCRIPTION

[0040] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0041] In the following examples, the DNA isothermal rapid amplification kit (RPA) and CRISPR / Cas12a enzyme were purchased from NEB; gRNA, recombinase polymerase amplification primers, and ssDNA probes were synthesized by Sangon Biotech; the present invention used a plasmid extraction kit purchased from Novozymes to obtain extracted plasmids. The white-headed bulbul coronavirus nucleic acid was stored in the laboratory.

[0042] The detection of white-headed bulbul coronavirus based on CRISPR / Cas12a can be detected by either fluorescence quantitative detection or immunochromatographic test strips. When using fluorescence quantitative detection, the DNA (ssDNA) reporter system in the CRISPR / Cas12a detection system is ssDNA FQ reporter, and ssDNA FQ reporter is ssDNA labeled with 6-carboxyfluorescein and a fluorescence quencher. When using immunochromatographic test strips for detection, the DNA (ssDNA) reporter system is ssDNA FB reporter, and ssDNAFB reporter is ssDNA labeled with fluorescein and biotin.

[0043] When using fluorescence quantitative detection, when the white-headed bulbul coronavirus gene is present in the CRISPR / Cas12a detection system, the nuclease activity of the CRISPR / Cas12a protein will be specifically activated under the mediation of the white-headed bulbul coronavirus-specific gRNA. The activated CRISPR / Cas12a protein will cut the ssDNA FQreporter labeled with a fluorescent group and a quenching group, thereby releasing the activated fluorescent group, and the fluorescence reading can be detected using fluorescence quantification. Correspondingly, when the white-headed bulbul coronavirus gene sequence is not present in the sample to be tested, the fluorescence reading is displayed as a base value.

[0044] The immunochromatographic test strip detects the 5' end and 3' end of ssDNA modified with FAM group and Biotin group respectively, and the immunochromatographic test strip contains anti-fluorescein antibodies labeled with colloidal gold nanoparticles, which can bind to the fluorescein-modified end of the reporter molecule ssDNA FB. The quality control line (C line) of the immunochromatographic test strip contains streptavidin, which can bind to the biotin group.

[0045] When using the immunochromatographic test strip for detection, after the sample to be detected after CRISPR / Cas12a cutting is added to the immunochromatographic test strip, the anti-fluorescein antibody labeled with colloidal gold nanoparticles combines with the ssDNA reporter system labeled with fluorescein, and the complex moves from the quality control line (C line) to the detection line (T line) along the liquid flow direction; the streptavidin on the quality control line saturates the capture of the ssDNA reporter system labeled with biotin, thereby displaying the band; when CRISPR / Cas12a detects the gene of the white-headed bulbul coronavirus, the ssDNA reporter system labeled with fluorescein and biotin will be cut off, so that the ssDNA fragment labeled with fluorescein will be captured by the detection line and then colored; when CRISPR / Cas12a cannot detect the gene sequence of the white-headed bulbul coronavirus, the ssDNA reporter system labeled with fluorescein and biotin cannot be cut off, so that the ssDNA fragment labeled with fluorescein will not be captured by the detection line and colored.

[0046] Since the coronavirus is an RNA virus, after extracting the DNA / RNA of the subject to be tested, it is necessary to reverse transcribe it into a cDNA sample, then perform RPA amplification and Cas12a enzyme reaction, and judge the result by a fluorescent instrument or by adding the reaction product to an immunochromatographic test strip.

[0047] Example 1: Nucleic acid preparation and gRNA design

[0048] 1. Nucleic Acid Preparation

[0049] The S gene fragment of the white-crowned bulbul coronavirus is a positive fragment amplified from the feces of the white-crowned bulbul, and it was linked to the PUC57 vector to construct the recombinant plasmid pUC57-S.

[0050] Add Amp antibiotics to the liquid LB medium, then add the recombinant plasmid DH5α containing the white-headed bulbul coronavirus pUC57-S, shake the bacteria overnight, and then extract the plasmid using the plasmid extraction kit of Novozymes according to the operating procedures.

[0051] 2. Design and preparation of gRNA specific for white-headed bulbul coronavirus

[0052] The gRNA preparation was carried out according to the following scheme. For the conserved region of the S gene of the white-headed bulbul coronavirus, a targeting sequence containing the CRISPR / Cas12a recognition sequence (PAM) TTTN was searched, and a gRNA with a recognition length of 44 nt was designed. The designed gRNAs are shown in Table 1 and are named gRNA-1 and gRNA-2 (sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively). After the design was completed, the gRNA was directly synthesized at Sangon Biotech Co., Ltd.

[0053] Table 1 White-crowned bulbul coronavirus-specific gRNA

[0054] name gRNA sequence (5'---3') Sequence number gRNA-1 UAAUUUCUACUAAGUGUAGAUCACGUACCAUUGCUGCCUCUACA SEQ ID NO.1 gRNA-2 UAAUUUCUACUAAGUGUAGAUGAAUUGCAUAAUGGUAUUGCAUU SEQ ID NO.2

[0055] Example 2: CRISPR / Cas12a system cleavage of target fragments and fluorescence quantitative detection

[0056] 1. RPA isothermal amplification of nucleic acids in the sample to be tested

[0057] The RPA reaction system was as follows: 20 μL C buffer, 5 μL L buffer, 12 μL P-core, 2 μL each of 10 μM upstream primer (SEQ ID NO.3: CTATTTATGGTGTGTCTGGTACGGGCATTATAACTC) and downstream primer (SEQ ID NO.4: CACTTGAAAAGACCTACCTGATGTTGTATTTTTGAA), 1.5 μL 10 mM dNTPs, 3 μL template (cDNA of S gene of white-headed bulbul coronavirus), 2 μL ddHO 2 O and 2.5 μL B buffer. After the components in the reaction system are fully mixed, react at 39°C in a constant temperature device for 30 minutes to obtain specific products.

[0058] 2. CRISPR / Cas12a system cuts the target fragment

[0059] The reaction system of CRISPR / Cas12a system for target gene detection (as shown in Table 2) was added with various components in sequence. After mixing the components, the reaction was carried out at 37°C for 30 min (detection was performed every 30 s, and the fluorescence signal was read for 60 cycles), and the fluorescence curve was obtained (the reaction instrument was qTOWER Jena, Germany). 3 Fluorescence quantitative PCR instrument). The fluorescence quantitative results are used to monitor the CRISPR / Cas12a reaction kinetics. Among them, the target fragment is the specific product amplified by the RPA reaction.

[0060] Table 2 CRISPR / Cas12a detection system for white-crowned bulbul coronavirus

[0061] Reagents concentration volume 10×NEBuffer 2μL Cas12a 500nM 1μL ssDNA reporter 500nM 1μL gRNA 300nM 1μL Purpose fragment 2μL <![CDATA[H 2 The]]> 13μL Total 20μL

[0062] Note: The modified sequence of ssDNA reporter (single-stranded DNA reporter) is TTATTATT; if fluorescence quantitative detection is used later, the ssDNA reporter is ssDNA FQ (fluorophore-quencher) reporter, and the labeled product is as follows: 5'-FAM-TTATTATT-BHQ-3'; if immunochromatographic test strips are used later, the ssDNA reporter is ssDNA FB (fluorophore-biotin) reporter, and the labeled product is as follows: 5'-FAM-TTATTATT-Biotin-3'; gRNA is gRNA-1 or gRNA-2.

[0063] Fluorescence quantitative results such as Figure 1-Figure 3 shown. Figure 1-Figure 2 The gRNA-1 and gRNA-2 designed for the white-headed bulbul coronavirus were cut and then kinetically monitored; Figure 3 As shown, the results showed that gRNA-2 had a higher fluorescence value for the detection of white-crowned bulbul coronavirus.

[0064] According to the results obtained, gRNA-2 had a higher fluorescence value for the detected white-crowned bulbul coronavirus gene, so the specific gRNA-2 was used for subsequent detection.

[0065] Example 3: CRISPR / Cas12a detection system optimizes gRNA concentration

[0066] Fluorescence quantification was used to measure and detect the CRISPR / Cas12a reaction kinetics monitoring, using a 20 μL system as shown in Table 2, where the gRNA-2 concentration was set to 300 nM, 200 nM, 100 nM, 50 nM, 25 nM and a negative control (ddH2 O). Figure 4 As shown, in the detection of white-crowned bulbul coronavirus, it was found that when the concentration of gRNA-2 was 300nM, there was a higher fluorescence value for the detection of white-crowned bulbul coronavirus.

[0067] According to the results obtained, when the concentration of gRNA-2 was 300nM, it had a higher fluorescence value for the detected white-crowned bulbul coronavirus gene, so gRNA-2 with a concentration of 300nM was used for subsequent detection.

[0068] Example 4: CRISPR / Cas12a detection system optimizes single-stranded DNA probe ssDNA FQ reporter concentration

[0069] Fluorescence quantification was used to measure and detect the kinetics of CRISPR / Cas12a reaction. The 20 μL system shown in Table 2 was used, in which the concentrations of the single-stranded DNA probe ssDNA FQ reporter were set to 500 nM, 250 nM, 125 nM, 50 nM, and 25 nM, and the reaction was carried out in ddH 2 O is the negative control; the gRNA used is gRNA-2.

[0070] The results are as follows Figure 5 As shown, in the detection of white-crowned bulbul coronavirus, it was found that the ssDNA FQ reporter concentration of 500nM had a higher fluorescence value for the detection of white-crowned bulbul coronavirus.

[0071] According to the results obtained, the ssDNA FQ reporter concentration of 500nM had a higher fluorescence value for the detected white-headed bulbul coronavirus gene, so the ssDNA FQ reporter concentration of 500nM was used for subsequent detection.

[0072] Example 5: CRISPR / Cas12a detection system optimizes Cas12a concentration

[0073] Fluorescence quantification was used to measure and detect CRISPR / Cas12a reaction kinetics monitoring, using a 20 μL system as shown in Table 2, wherein the Cas12a concentrations were set to 1 μM, 750 nM, 500 nM, 400 nM, 300 nM, 200 nM, 100 nM, 50 nM and a negative control (ddH 2 O); the gRNA used was gRNA-2, and the concentration of ssDNA FQ reporter was 500 nM.

[0074] like Figure 6 As shown, in the detection of white-headed bulbul coronavirus, it was found that Cas12a concentration of 500nM had a higher fluorescence value for the detection of white-headed bulbul coronavirus.

[0075] According to the results obtained, Cas12a concentration of 500nM had a higher fluorescence value for the detected white-headed bulbul coronavirus gene, so Cas12a concentration of 500nM was used for subsequent detection.

[0076] Example 6: CRISPR / Cas12a detection sensitivity of white-headed bulbul coronavirus

[0077] In the sensitivity test, the glycerol bacteria of the S gene of the white-headed bulbul coronavirus were revived to extract DNA, and the nucleic acid concentration of the recombinant plasmid of the S gene of the white-headed bulbul coronavirus (Bul-Cov-S) was determined by spectrophotometry, and its molecular copy number was calculated. According to the molecular weight converted to copy number, a 10-fold gradient dilution was performed to obtain 3.43×10 3 copy / μL, 3.43×10 2 copy / μL, 3.43×10 1 copy / μL, 3.43×10 0 copy / μL, 3.43×10 -1 The above gradient concentrations of white-headed bulbul coronavirus plasmid were used as templates for RPA amplification reactions. The RPA reaction mixture contained 20 μL CBuffer, 5 μL L buffer, 12 μL P-core, 10 μM upstream primer (SEQ ID NO.3) and downstream primer (SEQ ID NO.4), 2 μL each, 1.5 μL 10 mM dNTPs, 3 μL template (a plasmid containing the S gene of white-headed bulbul coronavirus, in ddH 2 O as negative control), 2 μL ddHO 2 O and 2.5 μL B buffer, mix thoroughly, react at 39°C in a constant temperature device for 30 min, and obtain the sample for the next nucleic acid test, i.e., fluorescent quantitative detection or immunochromatographic test strip detection.

[0078] The results of the sensitivity test for the white-crowned bulbul coronavirus in this example are as follows: Figure 7-Figure 8 As shown in the figure, the CRISPR / Cas12a fluorescence quantitative method (when the Crispr / Cas12 system is sheared, the ssDNA reporter is ssDNA FQ reporter) and the immunochromatographic test strip method (when the Crispr / Cas12 system is sheared, the ssDNA reporter is ssDNA FB reporter) were used to detect the white-headed bulbul coronavirus, which can achieve 3.43×10 0 High-sensitivity detection of copies.

[0079] Example 7: Specific detection of white-crowned bulbul coronavirus

[0080] In this embodiment, nucleic acid is extracted from fecal samples of white-crowned bulbul and CRISPR / Cas12a detection is performed to analyze the specificity of the established CRISPR / Cas12a detection method. The above-mentioned fecal samples of white-crowned bulbul include white-crowned bulbul coronavirus (Bul-cov), avian influenza virus (AIV), Newcastle disease virus (NDV), and avian adenovirus (FAdV). In this embodiment, a plasmid extraction kit purchased from Novavia was used to extract the white-crowned bulbul coronavirus plasmid, and other avian viruses were obtained by using a viral DNA / RNA extraction kit (column method) purchased from Novavia to obtain pre-treated viral genomes. The obtained cDNA containing Bul-cov / AIV / NDV and DNA containing FAdV were used as templates to perform RPA amplification reactions. The RPA reaction mixture contained 20 μL C Buffer, 5 μL L buffer, 12 μL P-core, 2 μL each of 10 μM upstream primer (SEQ ID NO.3) and downstream primer (SEQ ID NO.4), 1.5 μL 10 mM dNTPs, 3 μL template (containing cDNA of Bul-cov, AIV or NDV, DNA containing FAdV, ddH 2 O as negative control), 2 μL ddHO 2 O and 2.5 μL B buffer, after fully mixing, react in a constant temperature device at 39 ° C for 30 minutes. After the RPA amplification reaction is completed, the CRISPR / Cas12a system is used to shear the target fragment according to the system shown in Table 2 (wherein the gRNA uses gRNA-2, the Cas12a concentration is 500nM, and the ssDNA reporter is 500nM ssDNA FQ reporter), and fluorescence quantitative detection is performed.

[0081] Fluorescence quantification was performed using cDNA containing Bul-cov, AIV or NDV and DNA containing FAdV as templates. The results are shown in Fig. 9 As shown, the CRISPR / Cas12a assay is highly specific only to templates containing Bulbul coronavirus (Bul-cov).

[0082] Example 8: Immunochromatographic Test Strip Detection

[0083] Immunochromatographic test strips are Tiosbio Cas 12 / 13 Dedicated Nucleic Acid Test Strips products use the CRISPR / Cas12a system to add various components in sequence according to the detection system in Table 2, and analyze negative samples (ddH 2O), the optimal concentration of ssDNA FB reporter. After mixing all components evenly, react at 37°C for 30 minutes. Among them, the concentration of single-stranded DNA probe ssDNA FB reporter was set to 50nM, 100nM, 200nM, 300nM, 400nM, and 500nM; gRNA used was gRNA-2, and the concentration of Cas12a was 500nM.

[0084] After the cleavage is completed, 20 μL of the cleavage product is mixed with 30 μL of ultrapure water. The test strip is immersed in the diluted cleavage product, reacted for 5 minutes, and the results are observed.

[0085] The results are as follows Fig.10 As shown, it was found that when the concentration of the DNA probe ssDNA FB reporter was 500nM, a quality control line appeared but no detection line appeared, indicating that 500nM ssDNA FB reporter was more accurate for the subsequent immunochromatographic test strip method to detect white-headed bulbul coronavirus. Therefore, a DNA probe ssDNA FB reporter concentration of 500nM was used for subsequent detection.

[0086] Example 9: Further verification of the effect of 500nM ssDNA FB reporter on the accuracy of immunochromatographic test strips in detecting white-headed bulbul coronavirus

[0087] When using the immunochromatographic test strip to verify whether the ssDNA FB reporter concentration of 500nM can detect the white-headed bulbul coronavirus, the CRISPR / Cas12a system was used to add various components in sequence according to the detection system in Table 2 to cut the target fragment (white-headed bulbul coronavirus S gene recombinant plasmid), wherein the single-stranded DNA probe (ssDNA reporter) ssDNA FB reporter concentration was 500nM and the negative control (ddH 2 O); gRNA used was gRNA-2, and the concentration of Cas12a was 500nM.

[0088] like Fig.11 As shown in the figure, it was found that the DNA probe ssDNA FB reporter concentration of 500nM could produce a detection line, while the negative control did not produce a detection line, indicating that the ssDNA FB reporter concentration of 500nM can detect the white-headed bulbul coronavirus. Therefore, the DNA probe ssDNA FB reporter concentration of 500nM was used for subsequent detection.

[0089] Example 10: CRISPR / Cas12a detection system optimization Effect of Cas12a reaction cleavage time on immunochromatographic test strips for detecting white-headed bulbul coronavirus

[0090] When the Cas12a reaction cleavage time was optimized by the immunochromatographic test strip method, the reaction system was as shown in Table 2, and the reaction time was set to 30 min, 20 min, 15 min, and 10 min.

[0091] The results are as follows Fig.12 As shown, it was found that the detection line appeared after 10 minutes of Cas12a reaction and cutting. Therefore, the results can be obtained by using the immunochromatographic test strip to detect the white-headed bulbul coronavirus with only 10 minutes of reaction and cutting.

[0092] The results of the above examples prove that the nucleic acid detection technology based on CRISPR / Cas12a can achieve sensitive, rapid and accurate detection of white-headed bulbul coronavirus nucleic acid.

Claims

1. A method for detecting white-crowned bulbul coronavirus for non-disease diagnosis purposes, characterized in that: The following steps are involved: S1: Extract RNA from the sample to be tested and reverse transcribe it into cDNA; S2: using the cDNA obtained in step S1 as a template, performing RPA amplification reaction using primers with nucleotide sequences such as SEQ ID NO.3 and SEQ ID NO.4 to obtain a specific amplification product; S3: The specific amplification product obtained in step S2 is added to the CRISPR / Cas12a detection system to perform a cleavage reaction to obtain a cleavage product; The CRISPR / Cas12a detection system contains 2 μL of 10×NEBuffer, 1 μL of 500 nMCas12a, 1 μL of 500 nM ssDNA reporter system, 1 μL of 300 nM gRNA, 2 μL of the specific amplification product obtained in step S2, and 13 μL of H2O per 20 μL system; the ssDNA reporter system is ssDNA FQ reporter or ssDNA FB reporter; the nucleotide sequence of the gRNA is shown in SEQ ID NO.2; the nucleotide sequence modified by the ssDNA reporter system is TTATTATT; S4: Use fluorescent quantitative detection method or immunochromatographic test strips to detect whether the cleavage product contains the white-crowned bulbul coronavirus gene.

2. The method according to claim 1, characterized in that When using the fluorescence quantitative detection method, the ssDNA reporter system is ssDNA FQ reporter, and its labeled product is: 5'-FAM-TTATTATT-BHQ-3'; when using the immunochromatographic test strip for detection, the ssDNA reporter system is ssDNA FB reporter, and its labeled product is: 5'-FAM-TTATTATT-Biotin-3'.

3. The method according to claim 1, characterized in that The procedure of the RPA amplification reaction is: 39°C for 30 min.

4. The method according to claim 1, characterized in that When step S4 uses the fluorescence quantitative detection method to detect whether the cleavage product contains the white-headed bulbul coronavirus gene, the cleavage reaction procedure in step S3 is 37° C. for 30 minutes, and detection is performed every 30 seconds to read the fluorescence signal and obtain a fluorescence curve.

5. The method according to claim 1, characterized in that When the immunochromatographic test strip is used in step S4 to detect whether the cleavage product contains the white-headed bulbul coronavirus gene, the cleavage reaction procedure in step S3 is 37° C. for 10-30 min.

6. A kit for detecting white-headed bulbul coronavirus, characterized in that: It includes RPA amplification primers with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, gRNA with a nucleotide sequence as shown in SEQ ID NO.2, Cas12a protein and a ssDNA reporter system, wherein the ssDNA reporter system is ssDNA FQ reporter or ssDNAFB reporter.

7. The kit according to claim 6, characterized in that When the fluorescence quantitative detection method is used, the ssDNA reporter system is ssDNAFQ reporter, and its labeled product is: 5'-FAM-TTATTATT-BHQ-3'; when the immunochromatographic test strip is used for detection, the ssDNA reporter system is ssDNAFB reporter, and its labeled product is: 5'-FAM-TTATTATT-Biotin-3'.

Images