Safflower 14-3-3 protein Ctgrf5 gene and application thereof in flowering

By constructing an overexpression vector for the safflower 14-3-3 protein CtGRF5 gene, the flowering time and flavonoid synthesis of safflower were regulated, solving the problem that the function of the 14-3-3 protein in safflower had not been reported, and achieving effective regulation of flowering time and flavonoid synthesis.

CN118995746BActive Publication Date: 2025-10-21JILIN AGRICULTURAL UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411240334.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-05
Publication Date
2025-10-21
Estimated Expiration
2044-09-05

AI Technical Summary

Technical Problem

In safflower, the function of the 14-3-3 protein in flowering regulation has not been reported, which affects the regulation efficiency of flowering time and flavonoid synthesis.

Method used

This study provides a safflower 14-3-3 protein CtGRF5 gene and its application in flowering. By constructing the overexpression vector pGreenIISK-CtGRF5, transient overexpression and silencing of the CtGRF5 gene were achieved, thereby regulating the flowering time and flavonoid synthesis of safflower.

Benefits of technology

It can promote the earlier or later flowering time of safflower and increase the amount of flavonoid synthesis, thereby achieving effective regulation of safflower flowering and flavonoid synthesis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995746B_ABST
    Figure CN118995746B_ABST
Patent Text Reader

Abstract

The present invention discloses a safflower 14-3-3 protein CtGRF5 Gene and its application in flowering, the safflower 14-3-3 protein CtGRF5 The nucleic acid sequence of the gene is shown in SEQ ID NO.1. It comes from the safflower variety Jihong No. 1. After transient silencing, the experimental group bloomed later, and the flavonoids in the control group were higher than those in the experimental group; after transient overexpression, the experimental group bloomed earlier, and the flavonoids in the experimental group were higher than those in the control group, indicating that CtGRF5 It can promote flowering and flavonoid synthesis of safflower varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a safflower 14-3-3 protein CtGRF5 gene and application thereof in flowering. Background Art

[0002] Safflower is a novel oil-based medicinal plant with both edible and medicinal properties. It has high economic value and great development potential, making it a highly sought-after cash crop across my country. Safflower yellow pigment, extracted from safflower petals, has multiple pharmacological effects, including promoting blood circulation and removing blood stasis, relieving pain, improving myocardial blood supply, and inhibiting thrombosis. It is widely used in the treatment of coronary heart disease, hypertension, tumors, and diabetic complications. 14-3-3 proteins, also known as General Regulatory Factor (GRF) proteins, are important regulatory proteins in plants, typically existing as homo- or heterodimers. They recognize specific phosphorylation sequences and can simultaneously bind to two target proteins or to two domains of a single target protein. They often interact with phosphorylated proteins to regulate gene expression. 14-3-3 proteins regulate plant growth and development, biotic and abiotic stresses, and various plant hormone signaling pathways. Studies have shown that in plants such as rice and Arabidopsis, 14-3-3 proteins form the floral activation complex (FAC) with FT and FD to regulate flowering and interact with various flowering-related proteins. However, the function of 14-3-3 genes in safflower has not been reported. Summary of the Invention

[0003] The purpose of the present invention is to solve the above problems and provide a safflower 14-3-3 protein CtGRF5 gene and its application in flowering.

[0004] A safflower 14-3-3 protein CtGRF5 gene, the nucleic acid sequence of which is shown as SEQ ID NO.1.

[0005] The invention discloses an overexpression vector pGreenIISK-CtGRF5, wherein the gene shown in SEQ ID NO. 1 is inserted into the expression vector pGreenIISK.

[0006] The safflower 14-3-3 protein CtGRF5 gene is used to promote early flowering of safflower.

[0007] The safflower 14-3-3 protein CtGRF5 gene is used to enhance the synthesis of safflower flavonoids.

[0008] The present invention provides a safflower 14-3-3 protein CtGRF5 gene and its use in flowering. The nucleic acid sequence of the safflower 14-3-3 protein CtGRF5 gene is shown in SEQ ID NO. 1. The gene, derived from the safflower variety Jihong No. 1, showed delayed flowering in the experimental group after transient silencing, while higher flavonoid levels were observed in the control group. Furthermore, transient overexpression of the gene delayed flowering in the experimental group, while higher flavonoid levels were observed in the control group compared to the experimental group. This indicates that CtGRF5 can promote flowering and flavonoid synthesis in safflower varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 Electrophoresis of RNA extracted from safflower petals;

[0010] Figure 2 PCR image of the bacterial solution of CtGRF5 gene connected to the cloning vector;

[0011] Figure 3 Correlation between CtGRF5 gene expression and flavonoid content under UV-B stress;

[0012] Figure 4 pTRV2-CtGRF5 bacterial solution was identified by PCR, M: DL 2000 DNA Marker;

[0013] Figure 5 pGreenIISK-CtGRF5 bacterial solution PCR identification;

[0014] Figure 6 Safflower phenotypes of pTRV2-CtGRF5 and controls;

[0015] Figure 7 flavonoid content of pTRV2-CtGRF5 and control;

[0016] Figure 8 Red flower phenotypes of pGreenIISK-CtGRF5 and control;

[0017] Figure 9 Flavonoid content of pGreenIISK-CtGRF5 and control. DETAILED DESCRIPTION

[0018] Example 1 Cloning of the coding region sequence of the safflower GRF5 gene

[0019] 1. RNA extraction from safflower petals

[0020] Safflower variety: Jihong No. 1, Engineering Research Center for Bioreactor and Drug Development, Ministry of Education, Jilin Agricultural University.

[0021] 1) Treat forceps, mortar, pestle, spoon, 1.5 mL centrifuge tube, and pipette tips with 0.1% DEPC water overnight, then autoclave at 120°C for 20 min. Dry in a 60°C oven until ready to use.

[0022] 2) Take approximately 100 mg of safflower petals, add liquid nitrogen and quickly grind to a fine powder. Divide into two 1.5 mL EP tubes, add 1 mL of RNAiso Plus to each tube and mix thoroughly. Then add 200 μL of chloroform, mix thoroughly, and incubate at 4°C for 15 minutes.

[0023] 3) Centrifuge at 12,000 rpm for 15 min at 4°C and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0024] 4) Add an equal volume of isopropanol to the supernatant, incubate at 4°C for 10 min, and centrifuge at 12,000 rpm for 10 min at 4°C.

[0025] 5) Discard the supernatant and take the precipitate. Add 1 mL of 75% ethanol to the precipitate and centrifuge at 12,000 rpm for 5 minutes at 4°C. Repeat this step once.

[0026] 6) Discard the supernatant and keep the precipitate, then air dry at room temperature;

[0027] 7) Redissolve the RNA in RNA-Free water and store the extracted RNA at -80°C until use.

[0028] 8) The concentration of safflower total RNA samples was measured using a NanoDrop2000 ultra-micro spectrophotometer (purchased from Thermo Fisher Scientific).

[0029] 9) RNA purity was checked by 1% agarose gel electrophoresis. After electrophoresis, the gel was stained with nucleic acid dye and photographed on a UV gel imaging system. Figure 1 ,Depend on Figure 1 Two clear bands, 28S and 18S, are visible, with the 28S band being approximately twice as bright as the 18S band. This indicates that the RNA extraction is complete and free of degradation, and can meet the needs of subsequent experiments.

[0030] 2. Synthesis of first-strand cDNA

[0031] RNA stored at -80°C was measured using a NanoDrop micro-nucleic acid protein analyzer. The extracted RNA concentration was approximately 1000 ng / μl. Reverse transcription of cDNA was performed according to the reverse transcription kit's instructions. The reverse transcription reaction system is shown in Table 1. The reverse-transcribed cDNA was stored at -20°C until needed.

[0032]

[0033] Reverse transcription reaction conditions: 37℃ 2min; 55℃ 15min; 85℃ 5min.

[0034] The cDNA was cooled on ice and used for subsequent reactions and stored at -20°C for future use.

[0035] 3. Cloning of the coding region sequence of the safflower GRF5 gene

[0036] Our research group previously conducted whole-genome sequencing on safflower and annotated the flowering gene GRF5. Transcriptome sequencing analysis at different flowering stages revealed that its content was highest during the bud stage, suggesting that safflower GRF5 may be related to flowering. Therefore, this project used safflower petal cDNA as a template and designed specific primers based on the coding region sequence annotated in the genome for PCR amplification. The cloning primers were:

[0037] CtGRF5-F:ATGGCCGCCGCATCATCC

[0038] CtGRF5-R:CTACTCATCAGCCTTGGGCG

[0039] The cDNA obtained by reverse transcription of RNA from the petals of Jihong No. 1 safflower at full bloom was used as a template for amplification. The amplified product was ligated with the pEASY-T1 cloning vector (Beijing Quanshijin Biotechnology Co., Ltd.) and transformed into DH5α competent Escherichia coli. The results were verified by bacterial liquid PCR ( Figure 2 The sequencing results were correct. The full-length coding region sequence of 777 bp was obtained, and its base sequence is shown in the sequence listing as SEQ ID NO. 1, and was named CtGRF5.

[0040] 4. Sequence analysis of the full-length coding region of the safflower GRF5 gene

[0041] The sequence was edited into nucleotide sequences and amino acid sequences were deduced using DNAMAN software. A BLAST search for homology was performed on the NCBI website. A phylogenetic tree was constructed using clustalW1.83 software. ProtParam software (http: / / web.expasy.org / ) was used to analyze the amino acid sequence composition, relative molecular mass, isoelectric point, and other physicochemical properties of the encoded protein. Sequence analysis showed that the full-length coding region of safflower GRF5 is 777 bp and encodes 258 amino acids. The amino acid sequence is shown in SEQ ID NO. 2 in the sequence listing. Using online analysis software (http: / / web.expasy.org / ), the deduced protein has a theoretical molecular weight of approximately 28,871.32 Da and an isoelectric point (pI) of 4.67. The instability coefficient is 46.71, and the hydropathic index is -0.475.

[0042] Example 2 Expression Analysis of Safflower GRF5 Gene in Safflower under Abiotic Stress

[0043] To further investigate the relationship between safflower GRF5 gene expression and flavonoid biosynthesis, we subjected safflower seedlings to UV-B stress for 24 and 48 hours and analyzed the relationship between CtGRF5 gene expression and flavonoid biosynthesis. qRT-PCR primers were designed as follows:

[0044] qRT-CtGRF5F: TGCAAAGCAGGCTTTCGATG

[0045] qRT-CtGRF5R: ATCCTGCATATCGGAAGTCCAC

[0046] RNA was extracted from safflower petals under different UV-B stress treatments, and cDNA was obtained by reverse transcription. Real-time fluorescence quantitative PCR and flavonoid content were detected ( Figure 3 ), the results showed that with the extension of stress time, the total flavonoid content of safflower gradually increased, and the expression level of CtGRF5 gene also decreased. This shows that under UV-B stress, CtGRF5 gene is positively correlated with flavonoid synthesis.

[0047] Example 3 Construction of a Plant Expression Vector for the Safflower GRF5 Gene

[0048] In order to further verify the function of the CtGRF5 gene, transient silencing vector and overexpression vector were constructed, and the primer sequences and restriction enzyme cutting sites are shown in Table 2

[0049]

[0050] The CtGRF5 coding region fragment containing the homology arms of Xho I and Hind III restriction sites was amplified by TransStart® FastPfu Fly DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.) and the fragment was cloned with Flashcut TM Xho I and Flashcut TM pTRV2 and pGreenIISK vectors were digested with Hind III (Mona Biotech (Wuhan) Co., Ltd.) and purified using a DNA purification kit (Tiangen Biotech (Beijing) Co., Ltd.). The target fragment was ligated to the linearized vector using a single fragment seamless cloning kit (Mona Biotech (Wuhan) Co., Ltd.), and the ligation product was transformed into competent Escherichia coli DH5α cells. Transformants were screened using resistance plates containing kanamycin (50 mg / L), and single colonies were selected and shaken for identification by PCR ( Figure 4 、 Figure 5), both had target bands, indicating that the expression vectors were successfully constructed and named pTRV2-CtGRF5 and pGreenIISK-CtGRF5.

[0051] Example 4 Transformation of Agrobacterium competent cells

[0052] The target gene is transformed into Agrobacterium using the freeze-thaw method. The process is as follows:

[0053] 1) Add 1µl of pTRV2-CtGRF5 and pGreenIISK-CtGRF5 plasmid DNA to 100µl of competent Agrobacterium EHA105 and refrigerate in liquid nitrogen for 5 minutes;

[0054] 2) Immediately place the tube in a 37°C water bath and heat shock for 5 minutes;

[0055] 3) Add 1 ml of fresh YEP culture medium to the centrifuge tube and shake on a shaker at 28°C for 2-4 hours;

[0056] 4) Spread 50-100 μl of the transformed bacterial solution onto a solid LB plate containing 50 μg / ml kan and 100 μg / ml Rif. Incubate the plate in a 28°C incubator for 2-3 days to screen for transformants.

[0057] 5) Pick a single clone of bacteria and inoculate it into Agrobacterium liquid culture medium, and culture it at 28℃ until OD 600 ≈0.8, 1 μl of bacterial solution was used for PCR detection, the method was the same as above;

[0058] 6) The remaining bacterial solution was thoroughly mixed with glycerol at a ratio of 4:1 (V:V), quickly frozen in liquid nitrogen, and then stored at -80°C until use.

[0059] Example 5 Transient Silencing of Carthamus tinctorius GRF5 Gene and Determination of Flavonoid Content

[0060] Agrobacterium containing pTRV1, pTRV2, and pTRV2-CtGRF5 plasmids was cultured to an OD of 600 = 0.8-1.0, centrifuged at 5000 rpm to collect the cells, and resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6) to an OD 600 =0.8. pTRV1 was mixed with pTRV2 and pTRV2-CtGRF5 Agrobacterium suspensions at a 1:1 ratio, incubated at 28°C in the dark for 3 hours, and injected into leaves near the flower buds using a syringe. Safflower plants were grown in the dark for 1 day and then moved to an artificial climate chamber for 10 days. After transient silencing, flowering occurred earlier in the control group and later in the experimental group, indicating that CtGRF5 can promote flowering ( Figure 6At the same time, the flavonoids in the control group were higher than those in the experimental group, indicating that CtGRF5 can also promote flavonoid synthesis ( Figure 7 ).

[0061] Example 6 Transient Overexpression of Safflower GRF5 Gene and Flavonoid Content Determination

[0062] The Agrobacterium containing pGreenIISK and pGreenIISK-CtGRF5 plasmids was cultured to OD 600 = 0.8-1.0, centrifuged at 5000 rpm to collect the cells, and resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6) to an OD 600 = 0.8 and activated in the dark at 28°C for 3 hours. Agrobacterium suspensions of pGreenIISK and pGreenIISK-CtGRF5 were injected into safflower buds and nearby leaves. Safflower plants were grown in the dark for 1 day and then moved to an artificial climate chamber for 8 days. After transient overexpression, flowering occurred earlier in the experimental group, indicating that CtGRF5 can promote flowering ( Figure 8 At the same time, the flavonoids in the experimental group were higher than those in the control group, indicating that CtGRF5 can also promote flavonoid synthesis ( Figure 9 ).

Claims

1. Use of the safflower 14-3-3 protein CtGRF5 gene, whose nucleic acid sequence is shown in SEQ ID NO. 1, in promoting early flowering of safflower.

2. Use of the safflower 14-3-3 protein CtGRF5 gene with the nucleic acid sequence shown in SEQ ID NO.1 in promoting the synthesis of safflower flavonoids.