Application of inducible promoter in genetic engineering of Clostridium aerovorum

Abstract

The present invention belongs to the field of biotechnology, specifically to the use of an inducible promoter (propylene glycol-inducible promoter) in the genetic engineering of Clostridium aerovorum. The present invention utilizes the propylene glycol-inducible promoter in the genetic engineering of Clostridium aerovorum to control the expression of the Cas9 gene, optimizing the CRISPR / Cas9 tool and achieving 100% gene editing efficiency. The propylene glycol-inducible promoter is used to control gene expression in Clostridium aerovorum, increasing gene expression levels by more than 50-fold after induction.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to the application of an inducible promoter (propylene glycol inducible promoter) in the genetic engineering transformation of Clostridium aerovorum. Background Art

[0002] Clostridium aerovorans is a Gram-positive, anaerobic clostridium that can fix CO2 and CO2 using syngas or industrial carbon-rich tail gas as its primary carbon source. It fixes CO2 and CO2 through the Wood-Ljungdahl pathway, converting the CO2 into acetyl-CoA, a key metabolic intermediate, through a series of catalytic reactions. Acetyl-CoA is then synthesized through various branched metabolic pathways into a variety of products, including acetate, ethanol, lactate, 2,3-butanediol, butyrate, and butanol. Metabolic engineering can also yield a richer variety of non-natural products. Therefore, C. aerovorans is an ideal host for constructing CO2-fixing cell factories.

[0003] Inducible promoters are important tool elements in genetic manipulation. They can control the expression of related genes by adding or not an inducer, thereby controlling the switch of related pathways. Currently reported inducible promoters that can be used in Clostridium aerogenes include lactose-inducible promoters and tetracycline-inducible promoters. For example, a study used a lactose-inducible promoter to control the expression of the adhE1 gene. After lactose induction, the expression level of adhE1 increased by 30 times compared with the wild-type strain (Banerjee et al., Lactose-inducible system for metabolic engineering of Clostridium ljungdahlii. Appl Environ Microbiol, 2014, 80, 2410-2416).

[0004] Another inducible promoter proven to function in Clostridium aerovorans is the tetracycline-inducible promoter. Patent CN109072245A discloses a method for genetically engineering Clostridium aerovorans using CRISPR / Cas9 technology, in which expression of the Cas9 gene is controlled by a tetracycline-inducible promoter. This technique overcomes the problem of constitutively expressing Cas9 plasmids failing to produce transformants, achieving gene editing efficiencies exceeding 50%.

[0005] Currently, more available inducible promoters need to be developed for metabolic engineering of Clostridium aerovorum. Summary of the Invention

[0006] The present invention aims to provide an application of an inducible promoter (propylene glycol inducible promoter) in genetic engineering modification of Clostridium aerovorum.

[0007] In order to achieve the above purpose, the technical solution adopted is:

[0008] The invention relates to the application of an inducible promoter in the genetic engineering transformation of Clostridium aerovorum, and the application of a propylene glycol inducible promoter in the genetic engineering transformation of Clostridium aerovorum.

[0009] Furthermore, the propylene glycol-inducible promoter is used in gene editing or target gene expression of Clostridium aerovorum.

[0010] The propanediol-inducible promoter is derived from Clostridium ljungdahlii or Clostridium autoethanogenum.

[0011] The promoter sequence is shown in seq NO: 1.

[0012] seq NO.1:

[0013] CTATATAATTTAGATTTCTATTTTGCAGAATTAAAGTTATTAATTTAAAA

[0014] CTCCTCTACTGTAAGTAGAGGAGTATTGTTGTGTAAATTTTTTATATATC

[0015] AAAATAATACATCATATTCAAATCTATAATACAAAAACAGGTCGAAA

[0016] TAATCAAAAAAAGATAGGAACTTTAAGAATAAAATGTAATTATGAAAA

[0017] TGATTAATAAAAGTTATATAAAATTAATTAAGGGGGTTGTTTA

[0018] The gene editing is to use the CRISPR / Cas system to delete, mutate, or insert new nucleotide sequences into the target sequence of the genome.

[0019] The CRISPR / Cas system comprises:

[0020] (a) a nucleotide sequence encoding a guide RNA that hybridizes to a target sequence; (b) a nucleotide sequence encoding a Cas protein under the control of a propanediol-inducible promoter; (c) a donor DNA comprising a 5' homology arm that hybridizes upstream of the target sequence and a 3' homology arm that hybridizes downstream of the target sequence as a gene editing template;

[0021] The 5' homology arm and the 3' homology arm hybridize with the DNA molecule and undergo homologous recombination, resulting in the DNA between the 5' homology arm and the 3' homology arm replacing the target sequence.

[0022] Preferably, the Cas protein is Cas9 protein;

[0023] Among them, the Cas9 protein, whose coding sequence comes from Streptococcus pyogenes or Streptococcus thermophilus;

[0024] The expression of the gene is to control the transcription of endogenous or heterologous genes of Clostridium aerovorans using a propanediol-inducible promoter.

[0025] The aerogenes Clostridium refers to Clostridium ljungdahlii or Clostridium autoethanogenum.

[0026] The advantages of the present invention are:

[0027] The present invention utilizes a propylene glycol-inducible promoter in the genetic engineering of Clostridium aerovorum to control the expression of the cas9 gene, thereby optimizing the CRISPR / Cas9 tool and achieving a gene editing efficiency of 100%. The propylene glycol-inducible promoter is used to control gene expression in Clostridium aerovorum, and the gene expression level after induction is increased by more than 50 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The catP (pMTL82254-P PD ) and catP (pMTL82254) activities without promoter control.

[0029] Figure 2 This is the identification result of the Clostridium lndall ΔpyrE strain provided in the embodiments of the present invention.

[0030] Figure 3 The growth curves of the Clostridium lndall ΔpyrE strain provided in the embodiments of the present invention in the presence or absence of exogenous uracil.

[0031] Figure 4 This is the identification result of the ethanologenic Clostridium ΔpduS strain provided in the examples of the present invention.

[0032] Figure 5 This is the identification result of the Clostridium jondahl Δaor2 strain provided in the embodiments of the present invention.

[0033] Figure 6 Schematic diagram of the transcription level of the aor2 gene in different Clostridium jundal strains provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0034] The above implementation steps are described in detail below with reference to specific embodiments.

[0035] The present invention utilizes a propylene glycol-inducible promoter through a constructed CRISPR / Cas system to perform knockout verification on three genes during gene editing of Clostridium aerovorum, with a gene editing efficiency of 100%. Simultaneously, when the promoter is used to overexpress a target gene in Clostridium aerovorum, the expression level of the exogenous gene is increased by 185 times after induction compared with non-induced conditions. When expressing an endogenous gene of Clostridium aerovorum, the expression level of the gene is increased by 60 times after induction compared with non-induced conditions, and the gene expression level is increased by 20 times compared with the wild type, thereby achieving high-level induced gene expression.

[0036] Strains and plasmids:

[0037] The strain was Clostridium jondahlii DSM 13528, which was purchased from the German Collection of Microorganisms and Cell Cultures.

[0038] The plasmid is pMTL82254 (described in the literature Heap JT, Pennington OJ, Cartman ST, Minton NP. A modular system for Clostridium shuttle plasmids. J Microbiol Methods. 2009.);

[0039] pMTLcas-pyrE (Recorded in the literature Huang H, Chai C, Li N, et al. Crispr / cas9-based efficient genome editing in clostridium ljungdahlii, an autotrophic gas-fermenting bacterium. ACS Synthetic Biology, 2016.)

[0040] SMP buffer: 270 mM sucrose, 1 mM magnesium chloride, 7 mM sodium phosphate, 10% DMSO, pH 6.0.

[0041] Example 1: Construction of a catP-overexpressing strain of Clostridium ljungdahlii DSM 13528

[0042] 1. pMTL82254-PPD Plasmid construction

[0043] The pMTL82254 plasmid carries a catP gene without a promoter at the 5' end. The plasmid pMTL82254 was digested with restriction endonuclease NdeI and the linearized plasmid was recovered. The band size was about 6000 bp.

[0044] Using the genomic DNA of Clostridium jondahlii DSM 13528 as a template and PD-catP-F / PD-catP-R as primers, the propanediol-inducible promoter fragment P was obtained by polymerase chain reaction. PD -1.

[0045] Use 2× Fusein Mix cloning recombinase to linearize the pMTL82254 plasmid and P PD -1 fragments were assembled and the propanediol-inducible promoter was cloned upstream of the catP gene to obtain pMTL82254-P PD plasmid.

[0046] PD-catP-F:

[0047] GCGGCCGCTGTATCCACTATATAATTTAGATTTCTATTTTGCAGAATTAA AG;

[0048] PD-catP-R:

[0049] ATTTTTATCAATTTTTTCAAATACCATATAAACAACCCCCTTAATTAATT

[0050] TTATATAAC

[0051] 2. pMTL82254-P PD Construction of transformed strains

[0052] Frozen Clostridium jundal DSM 13528 was activated on ice, then transferred twice to YTF liquid medium and grown at 37°C until OD 600nm Reach between 0.35 and 0.4. Add 0.1 times the volume of 2M sucrose solution and 0.15 times the volume of 1.25M glycine solution to the bacterial solution and incubate at 37°C for 2 hours. Harvest the cells in the logarithmic growth phase by centrifugation at 10,000 rpm for 10 minutes at 4°C. Wash the cells twice with SMP buffer and resuspend them in SMP buffer to prepare competent cells for later use.

[0053] The entire electroporation process was performed in an anaerobic chamber. Take 200 μL of the competent cells obtained above and add 4 μg of the pMTL82254-P PDThe plasmids were mixed and incubated on ice for 1 to 2 minutes. The mixture of competent cells and plasmids was then transferred to a 2 mm electroporation cuvette with the electroporation parameters set to 1.0 kV, 200 Ω, and 50 μF.

[0054] The transformation solution was resuspended in 5 mL of YTF medium and incubated at 37°C for 12-16 h. 2.5 mL of the bacterial solution was centrifuged and the bacterial cells were spread on YTF plates (containing 5 μg / mL clarithromycin) and cultured at 37°C for about 3 days until a single colony grew, which was pMTL82254-P. PD Transformed strains.

[0055] The control plasmid pMTL82254 was transformed into Clostridium lndall DSM 13528 cells using the same method to obtain a pMTL82254-transformed strain, which was used as a control strain for catP activity determination.

[0056] 3. pMTL82254-P PD Analysis of catP expression levels in transformed strains

[0057] pMTL82254-P PD The transformed strain and the pMTL82254-transformed strain were inoculated into YTF medium (containing 5 μg / ml clarithromycin) and cultured at 37°C for 36 h until the culture became turbid. The culture was then inoculated into YTF medium containing 5 μg / ml clarithromycin and 3 g / L propylene glycol, and YTF medium containing 5 μg / ml clarithromycin, respectively. The cultures were cultured at 37°C for 36 h and the cells were harvested by centrifugation for detection of catP activity.

[0058] The catP activity was detected by DTNB method. The specific method is as follows:

[0059] (1) Prepare the mother solution required for the reaction detection solution: 0.1M Tris-HCl pH 8.0 buffer; 2.5mg / ml chloramphenicol ethanol solution; 9.5mM acetyl CoA aqueous solution; 8.33mM DTNB ethanol solution.

[0060] (2) Prepare the reaction detection solution. Mix Tris-HCl buffer, chloramphenicol solution, acetyl CoA solution, and DTNB solution in a volume ratio of 47:1:1:1 to prepare the reaction detection solution.

[0061] (3) Resuspend the collected cells in Tris-HCl buffer and ultrasonically disrupt them to obtain a crude enzyme solution. The protein concentration of the crude enzyme solution was determined by the BCA assay. 150 μL of reaction solution, 40 μL of Tris-HCl buffer, and 10 μL of the appropriately diluted crude enzyme solution were mixed. The absorbance change at 412 nm was measured on a microplate reader for 60 seconds and the slope was calculated.

[0062] (4) Calculate the specific enzyme activity of the crude enzyme solution according to the following formula to measure catP activity: A412 is the absorbance slope; df is the dilution factor of the crude enzyme solution; c is the protein concentration of the crude enzyme solution.

[0063]

[0064] The results are as follows Figure 1 As shown, catP controlled by the propanediol-inducible promoter has a slightly higher background expression than catP controlled by the promoterless promoter. PD The catP activity of the strain increased 185-fold, and the propanediol-inducible promoter achieved high-level induction of catP gene expression. Example 2: Construction of Clostridium ljungdahlii DSM 13528 pyrE knockout strain

[0065] SpCas9 gene expression was controlled by a propanediol-inducible promoter for gene editing in Clostridium jondahlii DSM 13528 to knock out the pyrE gene.

[0066] 1. pMTL83151-P PD Construction of -pyrE plasmid

[0067] The plasmid pMTLcas-pyrE (Huang et al., 2016) was double-digested with restriction endonucleases NcoI and XbaI to recover a fragment of approximately 9500 bp, which is the pMTL83151-pyrE plasmid backbone.

[0068] Using the genomic DNA of Clostridium jondahlii DSM 13528 as a template and PD-cas-F / PD-cas-R as primers, the propanediol-inducible promoter fragment P was obtained by polymerase chain reaction. PD -2; using the pMTLcas-pyrE plasmid as a template and cas-F / cas-R as primers, the cas9 gene fragment cas was obtained by polymerase chain reaction.

[0069] PD-cas-F:

[0070] CTAAGCCTATTGAGTATTTCTTATCCATTAAACAAACCCCCTTAATTAATT TTATATAAC;

[0071] PD-cas-R:GGGACTAAATATAAATCTAGATTTTTAACAAAACTATATAATTTAGATTTCTATTTTGC;

[0072] cas-F:ATGGATAAGAAATACTCAATAGGCTTAG;

[0073] cas-R:TATCGACAACTTCTTCAAAATTCCA

[0074] Use 2×Fusein Mix cloning recombinase to clone the pMTL83151-pyrE plasmid backbone and fragment P PD -2. One-step assembly of fragment cas to obtain pMTL83151-P PD -pyrE plasmid.

[0075] 2. Construction of pyrE knockout strain

[0076] Frozen Clostridium jundal DSM 13528 was activated on ice, then transferred twice to YTF liquid medium and grown at 37°C until OD 600nm Reach between 0.35 and 0.4. Add 0.1 times the volume of 2M sucrose solution and 0.15 times the volume of 1.25M glycine solution to the bacterial solution and incubate at 37°C for 2 hours. Harvest the cells in the logarithmic growth phase by centrifugation at 10,000 rpm for 10 minutes at 4°C. Wash the cells twice with SMP buffer and resuspend them in SMP buffer to prepare competent cells for later use.

[0077] The entire electroporation process was performed in an anaerobic chamber. Take 200 μL of the competent cells obtained above and add 4 μg of the pMTL83151-P PD -pyrE plasmid was mixed and incubated on ice for 1-2 minutes; then the mixture of competent cells and plasmid was transferred to a 2 mm electroporation cuvette, and the electroporation parameters were set to 1.0 kV, 200 Ω, and 50 μF.

[0078] Resuspend the transformant in 5 mL of YTF medium and incubate at 37°C for 12–16 hours. Centrifuge 2.5 mL of the culture and spread the cells onto YTF plates supplemented with 20 μg / mL uracil (containing 5 μg / mL thiamphenicol). Incubate at 37°C for approximately 3 days until a single colony emerges. Pick a single colony from the plate and inoculate it into YTF medium supplemented with 20 μg / mL uracil (containing 5 μg / mL thiamphenicol). Incubate at 37°C for approximately 36 hours until the culture becomes turbid. Inoculate the culture at a 5% inoculum ratio into YTF medium supplemented with 20 μg / mL uracil (containing 5 μg / mL thiamphenicol and 3 g / L propylene glycol) and incubate at 37°C for approximately 48 hours. Streak the culture onto YTF plates supplemented with 20 μg / mL uracil and incubate at 37°C for approximately 48 hours until a single colony emerges. Single colonies were picked from the plate and the gene editing results were verified by PCR. The identification primers were pyrE-test-F / pyrE-test-R. The PCR band of the mutant strain was about 1300 bp, and that of the wild type was 1800 bp. The correct mutant strain ΔpyrE was obtained. The identification results were as follows: Figure 2 , a total of 5 single colonies were picked, all of which were positive mutant strains, and the gene editing efficiency was 100%.

[0079] pyrE-test-F:CCTTCTATATTCTGAACCATAACATGA;

[0080] pyrE-test-R:GGCGGGAGCTTATGCAATTCAAGTA

[0081] The ΔpyrE strain was inoculated into PETC medium supplemented with 20 μg / mL uracil and 5 g / L fructose without uracil, and the growth curve was drawn. The results are shown in Figure 2. Figure 3 The ΔpyrE strain only grew in a medium supplemented with exogenous uracil but could not grow in a medium without uracil, which is consistent with the function of pyrE in uracil biosynthesis.

[0082] Example 3: Construction of a knockout strain of Clostridium autoethanogenum DSM 10061pduS (CAETHG_1823)

[0083] A propanediol-inducible promoter was used to control SpCas9 gene expression for gene editing in Clostridium ethanologenum DSM 10061, knocking out the bacterial microcompartment protein encoding gene pduS (CAETHG_1823).

[0084] 1. pMTL83151-P PD Construction of -pduS plasmid

[0085] The plasmid pMTL83151-P obtained in Example 2 was double digested with restriction endonucleases SalI and XhoI. PD -pyrE, and a fragment of about 9000 bp was recovered, namely pMTL83151-P PD Plasmid backbone.

[0086] A guide RNA (pduS) was designed targeting the pduS gene in Clostridium ethanologenum DSM 10061. The sequence was CTGGCAATAAGACGCTTACT, and primers pduS-sgRNA-F and pduS-sgRNA-R were designed. Using pMTLcas-pyrE as a template and pduS-sgRNA-F and pduS-sgRNA-R as primers, the sgRNA scaffold was generated by polymerase chain reaction (PCR) and designated pduS-sgRNA.

[0087] pduS-sgRNA-F:

[0088] CTTAAGGAGGAGTTTTCGTCGACCAATGTAGAATAGACTCAGGGTTTT AGAGCTAGAAA;

[0089] pduS-sgRNA-R:

[0090] CTTTATTAGCAGCCGTTGGATAAAAATAAGAAGCCTGCAAATGCAGGC

[0091] TTCTTATTTTTATAA

[0092] Primers pduS-LHA-F / pduS-LHA-R and pduS-RHA-F / pduS-RHA-R were designed to amplify the homology arms on both sides of the pduS gene. Using the genome of Clostridium ethanologenum DSM 10061 as a template and pduS-LHA-F / pduS-LHA-R as primers, the upstream homology arm pduS-LHA was obtained by polymerase chain reaction. Using the genome of Clostridium ethanologenum DSM 10061 as a template and pduS-RHA-F / pduS-RHA-R as primers, the downstream homology arm pduS-RHA was obtained by polymerase chain reaction. pduS-LHA-F: CCAACGGCTGCTAATAAAGTTCTTAGA;

[0093] pduS-LHA-R:

[0094] CATATTATTCCCTCCTTACATTTATTCTACATTGCAGTCTTCATCAATAAT TC;

[0095] pduS-RHA-F:

[0096] ATGTAGAATAAATGTAAGGAGGGGATAATATGTCACAAGCAAT;

[0097] pduS-RHA-R:

[0098] CGTGGTAGTTCAGTAAAGTATGAACTCGAGGCCTGCAGACATG

[0099] The pduS-sgRNA fragment and the pduS-LHA fragment were assembled by fusion PCR. The reaction system was 40 μl (2×fastpfu Mix, 20 μl; 1 μl each of pduS-sgRNA-F / pduS-LHA-R primers (10 μM), 10-30 ng of pduS-sgRNA / pduS-LHA fragment (molar ratio 1:1), and water was added to 40 μl). The PCR amplification conditions were the same as above to obtain fragment 1823-sgRNA-LHA.

[0100] Use 2×Fusein Mix to clone the recombinase into pMTL83151-P PD The plasmid backbone, fragment pduS-sgRNA-LHA, and fragment pduS-RHA were assembled in one step to obtain pMTL83151-P PD -pduS plasmid.

[0101] 2. Construction of pduS gene knockout strain

[0102] Frozen ethanologenic Clostridium DSM 10061 was activated on ice, then transferred twice to YTF liquid medium and grown at 37°C until OD 600nm Reach between 0.35 and 0.4. Add 0.1 times the volume of 2M sucrose solution and 0.15 times the volume of 1.25M glycine solution to the bacterial solution and incubate at 37°C for 2 hours. Harvest the cells in the logarithmic growth phase by centrifugation at 10,000 rpm for 10 minutes at 4°C. Wash the cells twice with SMP buffer and resuspend them in SMP buffer to prepare competent cells for later use.

[0103] The entire electroporation process was performed in an anaerobic chamber. Take 200 μL of the competent cells obtained above and add 4 μg of the pMTL83151-P PD -pduS plasmid was mixed and incubated on ice for 1-2 minutes; then the mixture of competent cells and plasmid was transferred to a 2 mm electroporation cuvette, and the electroporation parameters were set to 1.0 kV, 200 Ω, and 50 μF.

[0104] Resuspend the transformation solution in 5 mL of YTF medium and incubate at 37°C for 12-16 hours. Centrifuge 2.5 mL of the bacterial solution and spread the cells on a YTF plate (containing 5 μg / mL thiamphenicol). Incubate at 37°C for approximately 3 days until a single colony grows. Pick a single colony that grows on the plate and inoculate it into YTF medium (containing 5 μg / mL thiamphenicol). Incubate at 37°C for approximately 36 hours until the solution becomes turbid. Inoculate the bacterial solution into YTF medium (containing 5 μg / mL thiamphenicol and 3 g / L propylene glycol) at a 5% inoculum ratio and incubate at 37°C for approximately 48 hours. Streak the bacterial solution on a YTF plate and incubate at 37°C for approximately 48 hours until a single colony grows. Single colonies were picked from the plate and the gene editing results were verified by PCR. The identification primers were pduS-test-F / pduS-test-R. Positive clones were screened. The PCR band of the positive clone was about 2000 bp, while that of the wild type was 3200 bp. The correct mutant strain ΔpduS was obtained. The identification results were as follows: Figure 4 , a total of 4 single colonies were picked, all of which were positive mutant strains, and the gene knockout efficiency was 100%.

[0105] pduS-test-F:TTAGAACAATGATGCCAATAATCTTTCAG;

[0106] pduS-test-R:GTTCTGCGACCAACTTGTGAAAGATTTT

[0107] Example 4: Construction of Clostridium jondahlii DSM 13528aor2 gene knockout strain

[0108] SpCas9 gene expression was controlled by a propanediol-inducible promoter for gene editing in Clostridium ljungdalariensis DSM 13528, knocking out the aldehyde:ferredoxin oxidoreductase gene aor2 (CLJU_c20210).

[0109] 1. pMTL83151-P PD Construction of -aor2 plasmid

[0110] The plasmid pMTL83151-P obtained in Example 2 was double digested with restriction endonucleases SalI and XhoI. PD -pyrE, and a fragment of about 9000 bp was recovered, namely pMTL83151-P PD Plasmid backbone.

[0111] The guide RNA was designed targeting the target gene aor2 of Clostridium jundal DSM 13528, with the sequence of TTTTATGCATAGGACCAGCT, and the primers aor2-sgRNA-F / aor2-sgRNA-R were designed.PD -1823 as a template and aor2-sgRNA-F / aor2-sgRNA-R as primers, and the sgRNA scaffold was obtained by polymerase chain reaction (PCR) and recorded as aor2-sgRNA.

[0112] aor2-sgRNA-F:

[0113] CTTAAGGAGGAGTTTCGTCGACTTTTATGCATAGGACCAGCTGTTTT AGAGCTAGAAA;

[0114] aor2-sgRNA-R:AAGAACTTTATTAGCAGCCGTTGG

[0115] Primers aor2-LHA-F / aor2-LHA-R and aor2-RHA-F / aor2-RHA-R were designed to amplify the homology arms on either side of the aor2 gene. Using the genome of Clostridium ljungdahlii DSM 13528 as a template and primers aor2-LHA-F / aor2-LHA-R, the upstream homology arm aor2-LHA was amplified by polymerase chain reaction. The downstream homology arm aor2-RHA was amplified by polymerase chain reaction using the genome of Clostridium ljungdahlii DSM 13528 as a template and primers aor2-RHA-F / aor2-RHA-R.

[0116] aor2-LHA-F:

[0117] CCAACGGCTGCTAATAAAGTTCTTGTATTGATAACTGGTGAGAGTGG TAC;

[0118] aor2-LHA-R:ATACCTTACCCTTATATCCGTACATAAAA;

[0119] aor2-RHA-F:

[0120] ATGTACGGATATAAGGGTAAGGTATAGTTAGATGTACTACTACCTGAAT ATTATTCAGT;

[0121] aor2-RHA-R:

[0122] TTGCATGTCTGCAGGCCTCGAGATTTCATACTCACTAGAGAGAAGATC

[0123] CA

[0124] The aor2-sgRNA fragment and the aor2-LHA fragment were assembled by fusion PCR. The reaction system was 40 μl (2×fastpfu Mix, 20 μl; 1 μl each of aor2-sgRNA-F / aor2-LHA-R primers (10 μM), 10-30 ng of aor2-sgRNA / aor2-LHA fragment (molar ratio 1:1), and water was added to 40 μl). The PCR amplification conditions were the same as above to obtain the fragment aor2-sgRNA-LHA.

[0125] Use 2×Fusein Mix to clone the recombinase into pMTL83151-P PD The plasmid backbone, fragment aor2-sgRNA-LHA, and fragment aor2-RHA were assembled in one step to obtain pMTL83151-P PD -aor2 plasmid.

[0126] 2. Construction of aor2 gene knockout strain

[0127] Frozen Clostridium jundal DSM 13528 was activated on ice, then transferred twice to YTF liquid medium and grown at 37°C until OD 600nm Reach between 0.35 and 0.4. Add 0.1 times the volume of 2M sucrose solution and 0.15 times the volume of 1.25M glycine solution to the bacterial solution and incubate at 37°C for 2 hours. Harvest the cells in the logarithmic growth phase by centrifugation at 10,000 rpm for 10 minutes at 4°C. Wash the cells twice with SMP buffer and resuspend them in SMP buffer to prepare competent cells for later use.

[0128] The electroporation process was all performed in an anaerobic chamber. Take 200 μL of the competent cells obtained above and add 4 μg of the pMTLcas12a-P PD -aor2 plasmid was mixed and incubated on ice for 1-2 minutes; then the mixture of competent cells and plasmid was transferred to a 2 mm electroporation cuvette, and the electroporation parameters were set to 1.0 kV, 200 Ω, and 50 μF.

[0129] Resuspend the transformation solution in 5 mL of YTF medium and incubate at 37°C for 12-16 hours. Centrifuge 2.5 mL of the bacterial solution and spread the cells on a YTF plate (containing 5 μg / mL thiamphenicol). Incubate at 37°C for approximately 3 days until a single colony grows. Pick a single colony that grows on the plate and inoculate it into YTF medium (containing 5 μg / mL thiamphenicol). Incubate at 37°C for approximately 36 hours until the solution becomes turbid. Inoculate the bacterial solution into YTF medium (containing 5 μg / mL thiamphenicol and 3 g / L propylene glycol) at a 5% inoculum ratio and incubate at 37°C for approximately 48 hours. Streak the bacterial solution on a YTF plate and incubate at 37°C for approximately 48 hours until a single colony grows. Single colonies were picked from the plate and the knockout results were verified by PCR. The identification primers were aor2-test-F / aor2-test-R. Positive clones were screened. The PCR band of the positive clone was about 1700 bp, while that of the wild type was 3400 bp. The correct mutant strain Δaor2 was obtained. The identification results were as follows: Figure 5 , a total of 3 single colonies were picked, all of which were positive mutant strains, and the gene knockout efficiency was 100%.

[0130] aor2-test-F:CACTATCAATTCCATTTTCAAAAACTT;

[0131] aor2-test-R:ATGAGTATTCTTGATATGGTGCGA

[0132] Example 5: Construction of a Clostridium ljungdahlii DSM 13528Δaor2 complemented strain

[0133] 1. pMTL82254-P PD Construction of -aor2 plasmid

[0134] Plasmid pMTL82254 was digested with restriction endonucleases NdeI / XhoI, and a fragment with a band size of approximately 5500 bp was recovered, which was the pMTL82254 plasmid backbone.

[0135] The propanediol-inducible promoter fragment P was obtained by polymerase chain reaction using the genomic DNA of Clostridium jondahlii DSM 13528 as a template and PD-F / PD-R as primers. PD -3. Using the genomic DNA of Clostridium jungdalariensis DSM 13528 as a template and aor2-F / aor2-R as primers, the aor2 gene fragment was obtained by polymerase chain reaction.

[0136] Use 2× Fusein Mix cloning recombinase to clone the pMTL82254 plasmid backbone and P PD -3 fragment and aor2 fragment were assembled in one step to obtain pMTL82254-PPD -aor2 plasmid.

[0137] PD-F:

[0138] GCATGTCTGCAGGCCTCGAGCTATATAATTTAGATTTCTATTTTGCAGA ATTAAAGTT;

[0139] PD-R:

[0140] TACCTTACCCTTATCCGTACATTAAACAAACCCCCTTAATTAATTTTATA

[0141] TAACTTTT

[0142] aor2-F:ATGTACGGATATAAGGGTAAGGTA;

[0143] aor2-R:

[0144] ACCGCGGCCGCTGTATCCATATGCTAAAGCTTACCTACGTATTCATC 2, Construction of Δaor2 complementation strain

[0145] The frozen Clostridium jundal Δaor2 strain was activated on ice, then transferred twice to YTF liquid medium and grown at 37°C until OD 600nm Reach between 0.35 and 0.4. Add 0.1 times the volume of 2M sucrose solution and 0.15 times the volume of 1.25M glycine solution to the bacterial solution and incubate at 37°C for 2 hours. Harvest the cells in the logarithmic growth phase by centrifugation at 10,000 rpm for 10 minutes at 4°C. Wash the cells twice with SMP buffer and resuspend them in SMP buffer to prepare competent cells for later use.

[0146] The electroporation process was all performed in an anaerobic chamber. Take 200 μL of the Δaor2 competent cells obtained above and add 4 μg of the pMTL82254-P PD -aor2 plasmid was mixed and incubated on ice for 1-2 minutes; then the mixture of competent cells and plasmid was transferred to a 2 mm electroporation cuvette, and the electroporation parameters were set to 1.0 kV, 200 Ω, and 50 μF.

[0147] The transformation solution was resuspended in 5 mL of YTF medium and incubated at 37°C for 12-16 h. 2.5 mL of the bacterial solution was centrifuged and the cells were spread on YTF plates (containing 5 μg / mL clarithromycin). The cells were cultured at 37°C for about 3 days until a single colony grew, which was the Δaor2::aor2 complemented strain.

[0148] 3. Analysis of aor2 expression levels

[0149] The wild-type strain, Δaor2 strain, and Δaor2::aor2 strain were inoculated into YTF medium and cultured at 37°C for 36 hours until the bacterial solution became turbid. The wild-type strain and Δaor2 strain were transferred to 50 ml YTF medium again at a 5% inoculation rate; the Δaor2::aor2 strain was inoculated into 50 ml YTF medium containing 5 μg / ml clarithromycin and 3 g / L propylene glycol, and 50 ml YTF medium containing 5 μg / ml clarithromycin, respectively, and cultured at 37°C for 36 hours. The cells were collected by centrifugation, RNA was extracted, and the expression level of aor2 was detected by RT-qPCR. The results are shown in Figure 2. Figure 6 As shown, compared with the wild-type strain, the expression of aor2 was not detected in the Δaor2 strain. Under non-induction conditions, the aor2 expression level of the Δaor2::aor2 strain was 30% of that of the wild type. After induction, the expression level was upregulated 56 times, which was more than 20 times higher than that of the wild type.

Claims

1. An application of an inducible promoter in genetic engineering of Clostridium aerovorum, characterized by: The inducible promoter is a propylene glycol inducible promoter, and the sequence of the propylene glycol inducible promoter is shown in seq NO:

1.

2. Use of the inducible promoter according to claim 1 in genetic engineering of Clostridium aerovorum, characterized in that: The propylene glycol-inducible promoter is used for gene editing of Clostridium aerovorum or expression of target genes; The expression of the gene is to control the transcription of endogenous or heterologous genes of Clostridium aerovorans using a propanediol-inducible promoter.

3. Use of the inducible promoter according to claim 1 or 2 in genetic engineering of Clostridium aerovorum, characterized in that: The propylene glycol inducible promoter is from Clostridium jundal ( Clostridium ljungdahlii ) or Clostridium autoethanogenum ( Clostridium autoethanogenum ).

4. Use of the inducible promoter according to claim 2 in genetic engineering of Clostridium aerovorum, characterized in that: The gene editing is to use the CRISPR / Cas system to delete, mutate, or insert new nucleotide sequences into the target sequence of the genome.

5. Use of the inducible promoter according to claim 4 in genetic engineering of Clostridium aerovorum, characterized in that: The CRISPR / Cas system comprises: (a) a nucleotide sequence encoding a guide RNA that hybridizes to a target sequence; (b) a nucleotide sequence encoding a Cas protein under the control of a propanediol-inducible promoter; and (c) a donor DNA comprising a 5' homology arm that hybridizes upstream of the target sequence and a 3' homology arm that hybridizes downstream of the target sequence as a gene editing template. The 5' homology arm and the 3' homology arm hybridize with the DNA molecule and undergo homologous recombination, resulting in the DNA between the 5' homology arm and the 3' homology arm replacing the target sequence.

6. Use of the inducible promoter according to claim 5 in genetic engineering of Clostridium aerovorans, characterized in that: The Cas protein is Cas9 protein.

7. Use of the inducible promoter according to claim 1 in genetic engineering of Clostridium aerovorum, characterized in that: The aerotrophic clostridium refers to clostridium jundal ( Clostridium ljungdahlii ) or Clostridium autoethanogenum ( Clostridium autoethanogenum ).

Images