A SNP molecular marker related to self-incompatibility trait of pitaya and its application

Abstract

The present invention belongs to the field of modern agricultural technology, and specifically relates to a SNP molecular marker related to the self-incompatibility trait of pitaya and its application. The present invention creatively provides a SNP marker related to the self-incompatibility of pitaya, and confirms the correlation between different genotypes and the self-incompatibility of pitaya; by detecting the SNP marker, early prediction and rapid screening of self-incompatibility of pitaya can be achieved, and the breeding process of pitaya variety improvement can be accelerated, which has important scientific and economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of modern agriculture, and particularly relates to a SNP molecular marker related to the self-incompatibility trait of pitaya and an application thereof. Background Art

[0002] Pitaya is native to Mexico and other regions of the Americas. It belongs to the Cactaceae family, the Hylocereus or Seleniereus genus. Its fruit is rich in vitamins and other antioxidants. As an emerging tropical fruit tree, pitaya has become a key industry for increasing the efficiency of Hainan's agricultural economy in recent years.

[0003] At present, previous studies have shown that most red-fleshed pitayas are self-incompatible. Because they only bloom at night and lack pollinators, a large amount of manpower and material resources are needed to support artificial pollination to ensure the production of pitaya. Therefore, the production cost is increased; the economic benefits of pitaya are greatly reduced, and in Hainan, it is easily affected by continuous rainy season weather, resulting in serious production reduction. Therefore, one of the biggest factors restricting pitaya production is its self-incompatibility. The mainstream varieties on the pitaya market are all self-compatible red-heart pitayas, such as the 'Jindu No. 1' variety and the 'Mihonglong' variety. They have the advantages of strong tree vigor, long fruiting period, large fruit shape, and high sweetness. They are planted on a large scale in Hainan, Guangdong, Guangxi and other places in my country, bringing great economic benefits. At present, there are still many excellent varieties whose promotion in production is greatly restricted due to the limitation of self-incompatibility, such as 'Coarse Sand' and 'White Crystal'. Therefore, cultivating new varieties of self-compatible pitaya has important economic significance.

[0004] At present, the breeding mechanism of new pitaya self-compatible varieties is still unclear, and there are few relevant research reports. Therefore, the development of molecular markers related to pitaya self-incompatibility, as well as identification or auxiliary identification methods using molecular markers, have great application prospects for the breeding of new pitaya varieties. Summary of the invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a SNP marker related to self-incompatibility of pitaya and its application, which can be used to screen out pitaya materials related to self-incompatibility and can be used to cultivate new pitaya varieties with self-compatibility in the field of pitaya genetic breeding.

[0006] The purpose of the first aspect of the present invention is to provide SNP molecular markers related to self-incompatibility of pitaya.

[0007] The purpose of the second aspect of the present invention is to provide an application of a substance for detecting the SNP molecular marker described in the first aspect of the present invention in the preparation and screening of pitaya germplasm resources for self-incompatibility traits.

[0008] The third aspect of the present invention aims to provide a product.

[0009] The fourth aspect of the present invention aims to provide a reagent or a kit.

[0010] The purpose of the fifth aspect of the present invention is to provide a method for identifying and screening pitaya germplasm resources with self-incompatibility traits.

[0011] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0012] The first aspect of the present invention provides a SNP molecular marker related to self-incompatibility of pitaya, wherein the site of the SNP molecular marker is located at base 139082875 of chromosome 1 of pitaya; the SNP polymorphism is G / A. The pitaya genome data of the present invention is derived from http: / / www.pitayagenomic.com / download.php.

[0013] In some embodiments of the present invention, the sequence of the SNP molecular marker is as shown in SEQ ID NO.1; ACATCGGCTGCAAACTCTGAACTCGGCACCGCCATTTCCTTGCTCCGACAACCCGAAGCCGCATTCGGATCCCCCGTTCCGACACCCGAAATGGGCGACAGTCGCAAGCGAAAGCGCGGCCGGAAATCCAAAGCCTCCCTTCCGGAAACCCTAGACGCCTCACCCGCCGCCACCACTGCCGCCGCCGCATCATTTGAACAAACCGACGTCATCTTCTCCGTCGGAAATACAGACCTCGTCGAACCCT; wherein the SNP site is located at the 133rd site from the 5' end, and the polymorphism is G / A.

[0014] The second aspect of the present invention provides the use of a substance for detecting the SNP molecular marker described in the first aspect of the present invention in preparing pitaya germplasm resources for screening self-incompatibility traits.

[0015] In some embodiments of the present invention, the substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, gene chip method, and nucleic acid sequencing method.

[0016] The third aspect of the present invention provides a product comprising a substance for detecting the SNP marker described in the first aspect of the present invention.

[0017] In some embodiments of the present invention, the substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, gene chip method, and nucleic acid sequencing method.

[0018] In some embodiments of the present invention, the product comprises at least one of a reagent, a kit, a test paper, a chip, and a system.

[0019] In some embodiments of the present invention, the product comprises a primer pair for amplifying the SNP molecular marker of the first aspect of the present invention.

[0020] In some embodiments of the present invention, the nucleotide sequence of the upstream primer of the primer pair is: 5'-ACATCGGCTGCAAACTCTGA-3' (SEQ ID NO: 2).

[0021] In some embodiments of the present invention, the nucleotide sequence of the downstream primer of the primer pair is: 5'-AGGGTTCGACGAGGTCTGTA-3' (SEQ ID NO: 3).

[0022] In some embodiments of the present invention, the amplification product of the primer pair is 247 bp, and the sequence is shown in SEQ ID NO. 1. The above primer pair is used to perform PCR amplification and sequencing analysis on the genomic DNA of different pitaya materials, which can effectively screen out self-incompatible pitaya germplasm resources, specifically, the genotype of the pitaya material with self-incompatibility at the SNP site is GG, while the genotype of the pitaya material with self-compatibility is AA.

[0023] The fourth aspect of the present invention provides a reagent or kit comprising the primer pair described in the third aspect of the present invention.

[0024] In some embodiments of the present invention, the kit further comprises DNA polymerase, dNTP, PCR buffer, Mg 2+ At least one of .

[0025] A fifth aspect of the present invention provides a method for identifying and screening pitaya germplasm resources with self-incompatibility traits, comprising the following steps:

[0026] Extract the pitaya genome, use the product, reagent or kit described in the third and fourth aspects of the present invention to perform detection, obtain amplification products, and analyze the results; wherein the sample to be tested of the GG genotype is a pitaya with self-incompatibility, and the sample to be tested of the AA genotype is a pitaya with self-compatibility.

[0027] Specifically, in some embodiments of the present invention, the scheme comprises the following steps:

[0028] (1) Extracting genomic DNA from pitaya plants;

[0029] (2) using the genomic DNA of step (1) as a template and using the primer pair to perform a PCR amplification reaction;

[0030] (3) The PCR amplification products were detected by 1% agarose gel electrophoresis and then sequenced. Then, the sequencing peak graph was checked, the genotype of the pitaya material to be tested was analyzed, and the pitaya material with self-incompatibility was screened.

[0031] In step (3), the sequencing comparison results are as follows:

[0032] When the position of the molecular marker of the PCR product is G, the sample to be tested is of GG genotype;

[0033] When the position of the molecular marker of the PCR product is A, the sample to be tested is of AA genotype;

[0034] The sample to be tested of the GG genotype is a pitaya material with self-incompatibility, and the sample to be tested of the AA genotype is a pitaya material with self-compatibility.

[0035] Beneficial effects of the present invention:

[0036] (1) The present invention creatively provides a SNP marker associated with self-incompatibility of pitaya, and confirms the correlation between different genotypes and self-incompatibility of pitaya;

[0037] (2) By detecting this SNP marker, early prediction and rapid screening of pitaya self-incompatibility can be achieved, accelerating the breeding process of pitaya variety improvement, which has important scientific and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a diagram of the Sanger sequencing results of the self-incompatible variety in Example 1 of the present invention.

[0039] Figure 2 This is a diagram of the Sanger sequencing results of the self-compatible variety in Example 1 of the present invention. DETAILED DESCRIPTION

[0040] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0041] Example 1 Identification of self-incompatibility SNP loci in pitaya

[0042] In the germplasm resource garden of Hainan Enhong Agricultural Technology Co., Ltd. in Banqiao Town, Dongfang City, Hainan Province, 13 self-incompatible pitaya varieties and 19 self-compatible pitaya varieties were selected. Among them, 5 self-incompatible and 9 self-compatible pitaya samples were randomly selected as screening sets, and the remaining pitaya samples were used as independent validation sets for subsequent validation. The screening set samples were sent to Beijing Biomarker for more than 10X whole genome resequencing. The resequencing data analysis used the self-incompatible pitaya variety as a reference (the genome data website is: http: / / www.pitayagenomic.com / download.php), and the GATK software was used for SNP variation detection. The Samtools software was used for filtering to obtain high-quality SNP sites. The results are shown in Table 1.

[0043] Table 1 Sample information of the whole genome resequencing data validation set

[0044]

[0045] Table 2 Validation set sample information

[0046]

[0047] Experimental method: Selective elimination analysis of the screening set resequencing data in Table 1 was performed based on the high-quality SNPs obtained. The vcftools software package was used to detect selective elimination regions on a genome-wide scale by calculating the population differentiation index (Fst) and nucleotide polymorphism (π) of all SNP sites within a sliding window (100 kb) with a specific step size (10 kb).

[0048] The genomic regions associated with self-incompatibility were evaluated using the two selection signal methods of Fst and π, and the top 5% of the regions were identified as significant genomic regions. The overlapping regions in the two methods were considered to be selected regions. The specific comparison strategy was to screen the selection signals of the self-compatible population relative to the self-incompatible population (i.e., SC vs SI). Screening was performed in the self-incompatibility selected region, and the screening results showed that a SNP marker located on chromosome 1 was associated with pitaya self-incompatibility. The SNP was located at the 139,082,875th base of chromosome 1, and the SNP site was the difference in base G / A.

[0049] Example 2 Verification of pitaya self-incompatibility SNP loci

[0050] (1) Test materials

[0051] The pitaya samples in Table 2 of Example 1 were used as an independent validation set, and PCR was performed to verify the specificity and accuracy of the SNP site.

[0052] (2) Acquisition of SNP markers

[0053] Based on the above SNP site information and combined with the whole genome sequence information of pitaya, SNP marker primers were developed.

[0054] Upstream primer F is: 5′-ACATCGGCTGCAAACTCTGA-3′ (SEQ ID NO: 2);

[0055] The downstream primer R is: 5'-AGGGTTCGACGAGGTCTGTA-3' (SEQ ID NO: 3) with an amplified size of 247 bp. The SNP is located at the 133 bp of the amplified fragment. The above primers are used to detect the variation of the base at 139082875 of chromosome 1 of pitaya.

[0056] (3) DNA extraction

[0057] Fresh stems of pitaya were used as materials and DNA was extracted using the CTAB method. The detailed steps are as follows:

[0058] a) Add an appropriate amount of liquid nitrogen to the mortar for precooling, and take out a small amount of 2 mL empty tubes and place them in liquid nitrogen for cooling.

[0059] b) Weigh about 0.1g of sample and quickly grind it into fine powder. Transfer it quickly into a cooled centrifuge tube. Avoid wetting the sample during this period.

[0060] c) Before the sample becomes wet, quickly add 1 mL of CTAB extraction buffer (preheated in advance) in a fume hood and mix thoroughly. After mixing thoroughly, add 1 mL of CTAB buffer.

[0061] d) Place in a 65℃ water bath for about 30 minutes, shaking every 5 minutes.

[0062] e) Pipette about 1 mL of supernatant, add an equal volume of extraction phenol: chloroform: isoamyl alcohol (24:1), mix well, and incubate at room temperature, 12,000 rpm, for 10 min.

[0063] f) Pipette the supernatant again (about 900 µL), add an equal volume of extraction phenol:chloroform:isoamyl alcohol (24:1), mix well, and incubate at room temperature, 12,000 rpm, for 10 min.

[0064] g) Carefully aspirate the supernatant (do not aspirate the precipitate), add 0.6 times the volume of isopropanol (about 480 µL), invert to mix, and let stand at -20 °C for 10 min.

[0065] h) Discard the supernatant and centrifuge at 12,000 rpm for 15 min to precipitate the DNA.

[0066] i) Discard the supernatant, add 500 μL 75% ethanol, and rinse twice at 12000 rpm for 5 min.

[0067] j) Place the centrifuge tube upside down on clean toilet paper to dry, add appropriate amount of ddH2O (about 35µL) to dissolve the DNA, and store at -20℃ until use.

[0068] 4) PCR amplification

[0069] The PCR amplification reaction system was: 2×Rapid Taq Master Mix 25μL, 10μmol / L Primer F 2μL, 10μmol / L Primer R 2μL, 100ng / μL template DNA 1.5μL, ddH2O 19.5μL, and the total reaction volume was 50μL.

[0070] The PCR reaction was carried out on a PCR instrument with the following procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 5 s, 34 cycles; extension at 72°C for 5 min, and storage at 4°C.

[0071] (5) After the reaction, the reaction product was sent to Sangon Biotech Co., Ltd. for first-generation sequencing and genotyping identification. The results showed that the SNP site variation was shown in Table 3. Figure 1 and Figure 2 These are the Sanger sequencing results of the self-incompatible and self-compatible materials in the validation set, respectively.

[0072] Table 3

[0073]

[0074] It can be seen that the SNP loci obtained from the screening set can accurately identify the self-incompatibility trait of pitaya materials in another independent validation set. The results show that the molecular markers screened by the present invention can be applied to molecular marker-assisted selection related to the self-incompatibility trait of pitaya materials to improve the accuracy of selection.

Claims

1. Application of reagents for detecting SNP molecular markers in the preparation of products for screening pitaya germplasm resources for self-incompatibility traits; The sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the SNP site is located at the 133rd site from the 5' end; the SNP polymorphism is G / A; wherein the sample to be tested of the GG genotype is a self-incompatible pitaya, and the sample to be tested of the AA genotype is a self-compatible pitaya; the reagent for detecting the SNP molecular marker includes a primer pair; The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.2; The nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: The product further comprises reagents for any one detection technology or method selected from the following group: PCR, gene chip method, nucleic acid sequencing method.

3. A method for identifying or screening pitaya germplasm resources with self-incompatibility traits, comprising the following steps: Extract the pitaya genome, amplify it using a reagent for detecting SNP molecular markers, obtain amplification products, and analyze the results; The sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the SNP site is located at the 133rd site from the 5' end; The reagents for detecting SNP molecular markers include primer pairs; The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.2; The nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.3; The sample to be tested of the GG genotype is a self-incompatible pitaya, and the sample to be tested of the AA genotype is a self-compatible pitaya.

Images