A recombinant sea cucumber peptide with anti-aging efficacy, its preparation method and application
High-purity recombinant sea cucumber peptide was prepared through genetic engineering, which solved the problems of marine environmental damage and immunogenic risks, and achieved excellent anti-aging effects of cosmetics.
Patent Information
- Application Number
- CN202411356681.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2044-09-26
AI Technical Summary
The extraction method of sea cucumber peptide in the prior art leads to damage to the marine environment and has an animal immunogenic risk, and has poor anti-aging effect.
Through genetic engineering, Pichia cerevisiae expressed and purified the recombinant sea cucumber peptide with anti-aging effects. The amino acid sequence is GPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK, and was prepared into cosmetics for anti-aging.
It achieves high-purity and low-cost anti-aging effects, avoids the risk of marine environment damage and immunogenicity, and cosmetics show excellent anti-aging effects.
Smart Images

Figure BDA0005064505450000041 
Figure BDA0005064505450000051 
Figure BDA0005064505450000081
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and in particular to a recombinant sea cucumber peptide with anti-aging efficacy, and a preparation method and application thereof. Background Art
[0002] Sea cucumber is a general term for animals of the class Holothuroidea, phylum Echinodermata. Although cylindrical in shape, sea cucumbers vary greatly in thickness, shape, and size among species. Common large edible sea cucumbers are relatively stout and cylindrical, with tube feet on their dorsal surface and tube feet on their ventral surface. The body wall of sea cucumbers is flexible and rich in connective tissue, and the thickness varies among species. Its cucumber-like appearance gives it the English name "sea cucumber." There are over 900 species of sea cucumbers worldwide, with approximately 140 species in China. Since ancient times, sea cucumbers have been a precious tonic and a potent remedy for various diseases, with numerous references to them in Chinese medical texts. Sea cucumbers are sweet and warm in nature, boasting benefits comparable to those of ginseng, such as tonifying the kidneys and replenishing essence, nourishing the blood and moistening dryness, and promoting longevity. Sea cucumbers represent one of the marine organisms with potential beneficial effects on human health. Modern pharmacological research has shown that sea cucumber peptides, as marine bioactive peptides, possess a variety of bioactive properties, including antioxidant, anti-inflammatory, anti-fatigue, anti-tumor, immunomodulatory, and blood pressure-lowering properties.
[0003] Currently, most sea cucumber peptides and collagen on the market are extracted from sea cucumbers. Fresh sea cucumbers are expensive, and extraction yields are limited. Furthermore, large-scale harvesting of sea cucumbers can cause ecological damage, impacting the marine environment and the ecosystem. Furthermore, extracted sea cucumber peptides and collagen carry the risk of animal immunogenicity. Therefore, recombinant sea cucumber peptides, obtained through genetic engineering, fermentation, and purification, hold great market potential. Summary of the Invention
[0004] Sea cucumber polypeptides have many physiological functions, but in the prior art, research has mainly focused on the anti-aging effects of sea cucumber polypeptides. The purpose of this application is to provide an active polypeptide derived from sea cucumbers with anti-aging effects.
[0005] The present application provides an amino acid sequence with anti-aging efficacy, wherein the amino acid sequence is SEQ ID NO.1, and the SEQ ID NO.1 is
[0006] GPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK.
[0007] Furthermore, the amino acid sequence is derived from sea cucumber.
[0008] The present application provides a polypeptide with anti-aging efficacy, which comprises the following amino acid sequence: (GPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK)n , n is 1, 2, 3, 4 or 5.
[0009] Furthermore, the polypeptide is derived from sea cucumber.
[0010] The present application provides a nucleotide sequence encoding the aforementioned amino acid sequence or the aforementioned polypeptide.
[0011] Furthermore, the nucleotide sequence is SEQ ID NO.6, and the SEQ ID NO.6 is
[0012] GGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCAC CAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAAC GTTAAG.
[0013] The present application provides a method for preparing a polypeptide, wherein the polypeptide is the aforementioned polypeptide.
[0014] The method comprises:
[0015] The polypeptide is expressed and purified by using Pichia pastoris, and the Pichia pastoris carries an expression vector having the nucleotide sequence of the polypeptide.
[0016] Furthermore, the Pichia pastoris is Pichia pastoris GS115, and preferably the expression vector is pPIC9K.
[0017] The present application provides the use of the aforementioned amino acid sequence or the aforementioned polypeptide or the polypeptide prepared by the aforementioned method in the preparation of cosmetics.
[0018] The present application provides a cosmetic comprising the aforementioned amino acid sequence or the aforementioned polypeptide or a polypeptide prepared by the aforementioned method.
[0019] The present invention extracts a short amino acid sequence from sea cucumbers, resulting in a highly effective anti-aging peptide. This peptide, produced through synthetic biology, fermented, and purified, boasts high purity, excellent efficacy, and low cost. By formulating a lifting and anti-aging serum, the product achieves excellent anti-aging effects. This can be further applied in cosmetics. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is the mass spectrum obtained by mass spectrometry detection of sea cucumber polypeptides in Example 2.
[0021] Figure 2 This is the mass spectrum obtained by mass spectrometry detection of sea cucumber polypeptides in Example 2.
[0022] Figure 3 This is the plasmid map of the recombinant sea cucumber peptide in Example 4.
[0023] Figure 4 This is the hydrophilicity diagram of the recombinant sea cucumber peptide in Example 4.
[0024] Figure 5 This is a graph showing the moisture content of the skin stratum corneum before and after use of the lifting and repairing base lotion in Example 5.
[0025] Figure 6 This is a graph showing the transepidermal water loss rate of the skin before and after use of the lifting and repairing base lotion in Example 5.
[0026] Figure 7 This is a graph showing the skin firmness (RO) before and after using the lifting and repairing base lotion in Example 5. DETAILED DESCRIPTION
[0027] The following description of exemplary embodiments of the present application includes various details of the embodiments of the present application to facilitate understanding, and should be considered as merely exemplary. Therefore, those skilled in the art will recognize that various changes and modifications may be made to the embodiments described herein without departing from the scope and spirit of the present application. Similarly, for the sake of clarity and conciseness, descriptions of well-known functions and structures are omitted in the following description.
[0028] As used herein, the terms "polypeptide," "peptide," "sea cucumber peptide," and "sea cucumber polypeptide" are used interchangeably herein to refer to a polymer of amino acid residues. That is, descriptions of polypeptides are equally applicable to descriptions of peptides and proteins, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the terms encompass amino acid chains of any length.
[0029] As used herein, the term "nucleic acid molecule" may include those comprising naturally and / or non-naturally occurring nucleotides and bases, for example, including those with backbone modifications, and refers to polymers of nucleotides. Such polymers of nucleotides may contain natural and / or non-natural nucleotides and include, but are not limited to, DNA, RNA, and PNA. Nucleotide sequence refers to the linear sequence that makes up a nucleic acid molecule.
[0030] In some cases, the nucleic acid molecule contains cDNA, and in some cases, the nucleic acid molecule can be modified for use in the constructs described herein, such as for codon optimization. In some cases, for the purpose of cloning into a vector, the sequence can be designed to contain a terminal restriction site sequence.
[0031] In some cases, nucleic acid molecules can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of encoding nucleotides within or isolated from one or more given cells.
[0032] As used herein, the terms "nucleic acid," "polynucleotide," or "nucleotide" may be used generically to refer to deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in single or double stranded form. Unless specifically limited, the terms encompass nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the terms also mean oligonucleotide analogs, including PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences.
[0033] As used herein, the term "vector" is used to describe a nucleic acid molecule that can be engineered to contain a polynucleotide or multiple polynucleotides that can be cloned and amplified in a host cell. Vectors include, but are not limited to: single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, no free ends (e.g., circular); nucleic acid molecules comprising DNA, RNA, or both; and other polynucleotide species known in the art. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA fragments can be inserted, for example, by standard molecular cloning techniques. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (e.g., bacterial vectors and episomal mammalian vectors having a bacterial origin of replication). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell after introduction into the host cell, thereby replicating together with the host genome. In addition, certain vectors are capable of directing the expression of those genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." The recombinant expression vector may contain the nucleic acid of the present application in a form suitable for expressing the nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory elements, which can be selected based on the host cell used for expression and can be operably linked to the nucleic acid sequence to be expressed.
[0034] As used herein, the term "expression" includes any step involved in the production of the variant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0035] As used herein, the term "expression vector" means a linear or circular DNA molecule comprising a polynucleotide encoding a variant and operably linked to other nucleotides that provide for its expression.
[0036] As used herein, the term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. of a nucleic acid construct or expression vector comprising the polynucleotides of the present application. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The host cell can be any cell useful in the production of recombinant human-like collagen of the present application.
[0037] In the following amino acid sequences and polypeptide sequences, capital letters such as I, P, V, Q, E, S, T, and W each represent an amino acid or its amino acid residue. The correspondence between the capital letters and the amino acids is shown in Table 1.
[0038] Table 1 shows the amino acids and their corresponding abbreviations
[0039]
[0040]
[0041] The present application provides an amino acid sequence with anti-aging effect, the amino acid sequence is shown in SEQ ID NO.1, and the SEQ ID NO.1 is
[0042] GPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK.
[0043] The amino acid sequence is derived from sea cucumber.
[0044] The present application also provides a polypeptide with anti-aging efficacy, wherein the polypeptide comprises the following amino acid sequence: (GPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK) n , n is a positive integer from 1 to 5.
[0045] In some embodiments, when n is 1, the polypeptide comprises an amino acid sequence of GPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK (SEQ ID NO. 1).
[0046] In some embodiments, when n is 2, the polypeptide comprises the amino acid sequence of GPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPS DTIENVK (SEQ ID NO. 2).
[0047] In some embodiments, when n is 3, the polypeptide comprises the amino acid sequence of GPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPS DTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK (SEQ ID NO. 3).
[0048] In some embodiments, when n is 4, the polypeptide comprises the amino acid sequence of GPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPS DTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGT ITLEVEPSDTIENVK (SEQ ID NO. 4).
[0049] In some embodiments, when n is 5, the polypeptide comprises the amino acid sequence of GPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPS DTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGTITTLEVEPSDTIENVKGPPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK(SEQ ID NO.5).
[0050] In the present application, the amino acid sequence or polypeptide is derived from sea cucumber. In some embodiments, the amino acid sequence or polypeptide is obtained by hydrolyzing sea cucumber by enzymatic hydrolysis.
[0051] The present application also provides a nucleic acid sequence of the aforementioned amino acid sequence or the aforementioned polypeptide.
[0052] The nucleotide sequence of the recombinant sea cucumber peptide with anti-aging effects is shown below:
[0053] (GGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCA TCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAG) n, n is a positive integer from 1 to 5, and the optimal value is n=2.
[0054] In some embodiments, when n is 1, the nucleotide sequence of the recombinant sea cucumber peptide with anti-aging efficacy is
[0055] GGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCA TCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAG (SEQ ID NO. 6).
[0056] In some embodiments, when n is 2, the nucleotide sequence of the recombinant sea cucumber peptide with anti-aging efficacy is
[0057] GGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAGGGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAG (SEQ ID NO. 7).
[0058] In some embodiments, when n is 3, the nucleotide sequence of the recombinant sea cucumber peptide with anti-aging efficacy is
[0059] GGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAGGGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAGGGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAG(SEQ ID NO.8).
[0060] In some embodiments, when n is 4, the nucleotide sequence of the recombinant sea cucumber peptide with anti-aging efficacy is
[0061] GGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAGGGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAGGGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAGGGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAG(SEQ ID NO.9).
[0062] In some embodiments, when n is 5, the nucleotide sequence of the recombinant sea cucumber peptide with anti-aging efficacy is
[0063] (SEQ ID NO.10).
[0064] In some embodiments, the amino acid sequence or polypeptide can be produced by chemical synthesis. In some embodiments, the polypeptide can be produced by biosynthesis. In some embodiments, the polypeptide can be extracted from food or obtained by enzymatic hydrolysis.
[0065] The present application provides a method for preparing a polypeptide, wherein the polypeptide is the aforementioned polypeptide.
[0066] In this application, the method comprises:
[0067] The polypeptide is expressed and purified by using Pichia pastoris, and the Pichia pastoris carries an expression vector having the nucleotide sequence of the polypeptide.
[0068] Pichia pastoris is a unicellular fungus belonging to the family Saccharomyces. The Pichia pastoris ferments under anaerobic conditions. Its cell morphology is usually elliptical or spherical, with a diameter of 2 to 4 microns, and sometimes pseudohyphae are formed. The optimal growth temperature of Pichia pastoris is 28 to 30°C, but it can also grow at 37°C. The Pichia pastoris has an AOX1 gene, which is the methanol utilization gene of Pichia pastoris. The promoter of the AOX1 gene is one of the promoters with the strongest regulatory mechanism and the strictest regulation mechanism. At the same time, the constructed Pichia pastoris can be stably integrated in the form of single or multiple copies at specific sites in the genome of Pichia pastoris. The Pichia pastoris strain is easy to ferment at high density, and the expression level of exogenous proteins is high. Pichia pastoris also has peroxisomes, in which the expressed proteins are stored, which can be protected from degradation by proteases and reduce toxic effects on cells.
[0069] The Pichia pastoris is Pichia pastoris GS115.
[0070] The Pichia pastoris GS115 strain is a yeast commonly used in biotechnology and protein expression systems. It has an AOX1 gene that can normally express and produce an enzyme that converts methanol into formaldehyde, and is a normal methanol-utilizing yeast.
[0071] In a specific embodiment, the expression vector is pPIC9K.
[0072] The pPIC9K plasmid is an expression system plasmid for Escherichia coli, commonly used to express foreign genes in E. coli. pPIC9K contains a selectable marker, primarily for screening and maintaining the presence of the plasmid in Pichia pastoris culture medium. A selectable marker is a gene or DNA fragment that allows only cells carrying a specific plasmid to grow and reproduce. pPIC9K typically contains multiple cloning sites, allowing researchers to insert foreign genes of interest. These sites are often located around restriction enzyme sites to facilitate the insertion of DNA fragments.
[0073] In one specific embodiment, the method for preparing the polypeptide is: codon optimizing the amino acid sequence or the polypeptide to obtain a nucleic acid sequence encoding the amino acid sequence or the polypeptide sequence; connecting the nucleic acid sequence with the vector pPIC9K to obtain a recombinant vector; electroporating the recombinant vector into Pichia pastoris GS115 to obtain recombinant Pichia pastoris; and inducing fermentation of the recombinant Pichia pastoris to obtain the polypeptide.
[0074] In a specific embodiment, the induced culture is induced culture using methanol.
[0075] The present application provides the use of the aforementioned amino acid sequence or the aforementioned polypeptide or the polypeptide prepared by the aforementioned method in the preparation of cosmetics.
[0076] The present application provides a skin care product, which is composed of raw materials in the mass ratio shown in Table 2 below.
[0077] Table 2
[0078]
[0079] Example
[0080] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.
[0081] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0082] Example 1 Extraction of sea cucumber polypeptides
[0083] 1) Take fresh sea cucumber, remove the mouth, internal organs and inner membrane, wash and crush, and weigh 1 kg.
[0084] 2) Add 6 kg of ultrapure water, adjust the pH to 7.0, add 1% neutral protease, and control the enzymatic hydrolysis at 27° C. for 8 hours.
[0085] 3) heating the hydrolyzate at 100° C. for 40 minutes to inactivate the enzyme, and cooling to room temperature to obtain a sea cucumber enzymatic hydrolyzate;
[0086] 4) Add 95% ethanol to the sea cucumber hydrolysate until the ethanol volume fraction is 80%, and let it stand for 12 hours.
[0087] 5) Centrifuge at 10000rpm for 30 minutes.
[0088] 6) recovering ethanol from the supernatant, and decolorizing and removing the fishy smell of the sea cucumber polypeptide mixture through an anionic resin to obtain a sea cucumber polypeptide extract.
[0089] 7) Use dialysis bag to perform desalination at 4°C.
[0090] The extract is placed in liquid nitrogen for rapid freezing and drying to obtain sea cucumber polypeptide freeze-dried powder.
[0091] Example 2: Screening of polypeptide sequences with anti-aging efficacy
[0092] Take the freeze-dried powder of sea cucumber polypeptide prepared in Example 1 and dissolve it in 1% formic acid solution. Use orbital ion trap mass spectrometer (Thermo, America) for analysis. The flow rate is 0.300μl / min, the analytical column is Acclaim PepMap RSLC column (75μm ID, 250mm length, C18), the mobile phase A is composed of 0.1% formic acid-water, and the mobile phase B is composed of 80% acetonitrile and 0.1% formic acid. Gradient elution conditions: 0-5min, 3% B; 5-80min, 22% B; 80-92min, 35% B; 92-103min, 90% B; 103-109min, 90% B; 109-110min, 3% B. The scanning range is 600-10000 m / z, the resolution is 60000, and the results are as follows. Figure 1 as well as Figure 2 shown.
[0093] Screening of peptide sequences with anti-aging effects:
[0094] Orbitrap-MS analysis of freeze-dried sea cucumber powder revealed 327 peptide spectra, 74 proteins, 24 proteomes, and 197 peptides by searching the NCBI sea cucumber protein database. 98.98% of the peptides had a theoretical molecular weight between 800 and 2000 Da. The MS / MS spectra were searched against the selected sea cucumber protein database using the Byonic software (version 3.2.0). Gene Ontology (GO) analysis (using the GO tool provided by the UniProt community (http: / / www.uniprot.org / )) was performed on the 74 proteins. Sixty-four of these proteins were expressed, with eight molecular functions identified, participating in 11 biological processes and present in five cellular components. The sea cucumber peptide sequence identified as possessing anti-aging properties is shown in SEQ ID NO. 1.
[0095] Example 3: Determination of the anti-aging properties of sea cucumber peptides
[0096] Anti-aging performance measurement principle: Matrix metalloproteinases (MMPs): MMP1 and MMP3 are members of the MMP family. They degrade various types of collagen and extracellular matrix molecules, contributing to skin sagging and wrinkling. UV irradiation induces the secretion of MMP-1 and MMP-3 by fibroblasts in the dermis. Measuring the amount of MMP-1 and MMP-3 secreted by fibroblasts (FBs) provides an indicator of the sample's anti-wrinkle efficacy.
[0097] Cell viability: It can reflect the metabolic activity and proliferation of cells. The amino acid sequence of the sea cucumber peptide in this example is shown in SEQ ID NO.1.
[0098] 1. Cytotoxicity assay
[0099] Unless otherwise specified, P5-P8 generation human skin-derived primary fibroblasts were selected for the experiment. Under sterile conditions, sea cucumber peptide samples were prepared with serum-free culture medium and diluted to 5%, 2%, 1%, 0.5%, 0.2%, 0.1%, 0.05%, 0.02% (w / v), and stored at 4°C for later use. Human skin-derived primary fibroblasts were seeded in 96-well plates and cultured under saturated humidity, 5% carbon dioxide, and 37°C. When the cell density was about 50%, the sample was added. 24 hours after the sample addition, the cell metabolic activity was detected by the CCK-8 method, and the cell survival rate was calculated according to the following formula. The results are shown in Table 4. The specific groupings are as follows
[0100] Table 3.
[0101]
[0102] Table 3 shows the cytotoxicity detection groups and detection indicators of this example.
[0103]
[0104] Table 4 shows the cytotoxicity test results in this example.
[0105]
[0106] Summary: From the above, it can be seen that the survival rate of cells cultured with the sea cucumber peptide sample of the present application is relatively high, so the sea cucumber peptide of the present application is safe and non-toxic.
[0107] 2. MMP-1 and MMP-3 cell viability detection
[0108] Based on the results of the cytotoxicity test, three sea cucumber peptide sample concentrations were selected as the test concentrations for the efficacy experiment. Primary human skin fibroblasts were seeded in 24-well plates and cultured under saturated humidity, 5% carbon dioxide, and 37°C. The next day, samples were added according to the description in the table below, and UVA irradiation was performed 4 hours later at a dose of 4.8J / cm 2 After UVA irradiation, each well was replaced with a fresh culture medium containing the test substance and cultured for 20 hours under saturated humidity, 5% carbon dioxide, and 37°C. At the end of the time period, the supernatant of the culture medium in each well was collected and centrifuged. The secretion of MMP-1 and MMP-3 in each well was detected according to the operating instructions of the MMP-1 and MMP-3 detection kits, and the inhibition rate was calculated. At the same time, the cell viability of each well was detected using the CCK8 method, and the cell proliferation rate was calculated. The experimental groups are shown in Table 5, and the experimental results are shown in
[0109] Table 6-Table 8.
[0110]
[0111] Table 5 shows the experimental groups and detection indicators in this embodiment.
[0112]
[0113] Table 6 shows the results of MMP-1 secretion detection
[0114]
[0115] ##: compared with the blank control group, p < 0.01; **: compared with the UV irradiation group, p < 0.01;
[0116] Table 7 shows the results of MMP-3 secretion detection.
[0117]
[0118] ##: compared with the blank control group, p < 0.01; *: compared with the UV irradiation group, p < 0.05; **: compared with the UV irradiation group, p < 0.01;
[0119] Table 8 shows the results of cell viability test.
[0120]
[0121] ##: compared with the blank control group, p < 0.01; **: compared with the UV irradiation group, p < 0.01;
[0122] Summary: Recombinant sea cucumber peptide can significantly inhibit the expression of MMP-1 and MMP-3 caused by UV irradiation. The inhibition rate of 2% concentration of sea cucumber peptide on MMP-1 expression reached 50.6%±2.06%, and the inhibition rate of 2% concentration of sea cucumber peptide on MMP-3 expression reached 66.5%±2.7%. At the same time, the sea cucumber peptide sample can significantly inhibit the decline in cell viability caused by UV irradiation.
[0123] Example 4 Preparation of recombinant sea cucumber peptide
[0124] The amino acid sequence of the recombinant sea cucumber peptide in this example is SEQ ID NO. 1. The following describes in detail the steps for synthesizing the recombinant sea cucumber peptide using genetically engineered bacteria.
[0125] 1. Synthesis of plasmid
[0126] The amino acids of the above Shanghai ginseng peptide were reverse translated and optimized according to the preference of Pichia pastoris codons. The nucleotide sequence is SEQ ID NO.6. The receptor was Pichia pastoris GS115, the vector was pPIC9K, the restriction sites were EcoRI and NotI, and the plasmid was synthesized by Beijing Qingke Biotechnology Co., Ltd. The plasmid structure is shown in Figure 3 .
[0127] 2. Linearization of plasmid
[0128] 1) Prepare the vector enzyme digestion system according to Table 9:
[0129] 2) Enzyme digestion at 37°C overnight;
[0130] 3) Agarose gel electrophoresis detection, using undigested plasmid as a control;
[0131] 4) After successful enzyme digestion, inactivate at 65°C for 20 minutes.
[0132] Table 9
[0133]
[0134] 3. Purification and recovery of linearized plasmid
[0135] 1) Prepare the vector purification system according to Table 10:
[0136] Table 10
[0137]
[0138] 2) Stand at -20℃ for more than 35 minutes;
[0139] 3) Centrifuge at 12,000 rpm at 4°C for 15 min and discard the supernatant. A white precipitate can be observed on the wall.
[0140] 4) Add 400 μl of pre-chilled 80% ethanol to resuspend the pellet;
[0141] 5) Centrifuge at 12000 rpm for 10 min at 4°C, discard the supernatant, and dry the tube.
[0142] 6) Add 10 μl ddH2O to dissolve the precipitate.
[0143] 4. Preparation of GS115 sea cucumber peptide
[0144] 1) Streak the strain onto a YPD plate and incubate at 30°C for 3-5 days until a single colony emerges.
[0145] 2) Pick a single clone and transfer it to 10 mL YPD culture medium (125 mL conical flask) and culture at 30°C, 300 rpm for 1-2 days;
[0146] 3) Transfer the cells to 100 mL of YPD culture medium with an initial bacterial concentration of OD600 = 0.2 and culture at 30°C, 300 rpm for 1-2 days until the OD600 reaches 1.3-1.5. (Note: If the OD value cannot be determined, transfer the cells to different concentrations for culture.)
[0147] 4) Centrifuge at 1500g for 5 min at 4°C to collect the culture and resuspend in 250 mL of pre-chilled sterile water to wash the culture.
[0148] 5) Centrifuge at 1500g for 5 min at 4°C to collect the culture (adjust the deceleration damping to greater than 6). Resuspend the culture in 10 mL of pre-chilled 1 M sorbitol, gently pipetting.
[0149] 6) Collect the culture by centrifugation at 1500g for 5 min at 4°C (adjust the deceleration damping to greater than 6). Resuspend the culture in 300 μl of pre-chilled 1 M sorbitol, gently pipetting to a final volume of approximately 500 μl (in practice, the final volume is approximately 700 μl). Aliquot 100 μl per tube and place on ice for electroporation.
[0150] 5. Electroconversion
[0151] 1) Take 80 μl of competent cells, add 6 μg of linearized pPIC9K, mix well, and transfer to a pre-chilled 0.2 cm electroporation cuvette;
[0152] 2) Place on ice for 5 minutes;
[0153] 3) Electric shock according to the yeast electric shock parameters (1.5kV, 25μF, 200Ω);
[0154] 4) Immediately add 2 ml of pre-chilled 1 M sorbitol + HEPES (10 ml 1 M sorbitol + 100 μl 2 M HEPES, pH = 8.0) and transfer to a 2 ml sterile centrifuge tube;
[0155] 5) Incubate at 30°C for 1-2 hours;
[0156] 6) After 5-fold, 10-fold, and 100-fold dilution, spread 300 μl / plate on a 15 cm YPD plate containing 100 mg / l Zeocin and culture at 30°C until colonies emerge.
[0157] 6. Positive clone screening
[0158] 1) Use a 10 μl pipette tip to streak the clones grown on the MD plate onto a 0.5 mg / mL G418 plate and incubate at 30°C for 3-5 days.
[0159] 2) Select the best-growing clones and streak them onto 2 mg / mL and 4 mg / mL G418 plates simultaneously. Incubate at 30°C for 3-5 days.
[0160] 3) Try to select five clones that grow well on 4 mg / mL G418 plates for induction of expression. If the growth on 4 mg / mL plates is poor, select clones on 2 mg / mL plates.
[0161] 7. Transformant expression test
[0162] 1) Prepare seven 50 ml conical flasks, add 5 ml of YPG medium to each, inoculate the verified clones, and culture at 30°C, 220 rpm, for 1-2 days until the culture is saturated.
[0163] 2) Transfer the solution to a 50 ml centrifuge tube, centrifuge at 4000 rpm for 5 min, and discard the supernatant.
[0164] 3) Resuspend the cells in 5 ml of BMMY medium, transfer to a new sterile 50 ml conical flask, add methanol to a final concentration of 0.5%, and incubate at 28°C, 220 rpm, for 6 days.
[0165] 4) Methanol was added every 24 h (final concentration was 0.5%);
[0166] 5) On the morning of the 6th day, the bacterial suspension was collected, centrifuged at 4000 rpm for 5 min, and the supernatant was collected;
[0167] 6) Screen the strain with ideal expression and store it in glycerol stock (the ratio of bacterial liquid to 20% glycerol is 1:1).
[0168] 8. Expression
[0169] 1) In a 10 L fermenter, the culture medium is BSM, prepared as follows:
[0170] Fermentation medium: including 26.7 ml / L of 85% phosphoric acid, 18.2 g / L of KOH, 1.18 g / L of CaSO4·2H2O, 18.2 g / L of K2SO4, 14.9 g / L of MgSO4·7H2O, and 40 g / L of glycerol; after high-temperature sterilization of the fermentation medium, wait for the temperature to cool to room temperature, add PTM1, and adjust the pH to 5.0 with aqueous ammonia.
[0171] Feed medium: 50% w / v glycerol, plus 12 mL PTM1 trace elements per liter;
[0172] Induction medium: 100% methanol, plus 12mL PTM1 trace elements per liter.
[0173] 2) Fermentation control: liquid volume 5 L, temperature controlled at 28° C., dissolved oxygen controlled to greater than 30% by stirring speed and air flow, maximum stirring speed 800 rpm, maximum air flow controlled at 6 L / min.
[0174] 3) Induction: Control the wet weight of the bacteria to about 150 g / L for induction, starve for 0.5-1 h first, then induce with methanol, add methanol intermittently, control the methanol concentration to 0.5-1% for induction, and induce for 90-120 h.
[0175] 9. Purification
[0176] 1) After the fermentation, solid-liquid separation was performed by centrifugation at 6000 rpm for 10 min, and the supernatant was collected.
[0177] 2) Ultrafiltration desalination: use an organic membrane with a molecular weight of 500Da for ultrafiltration desalination.
[0178] 3) Ion chromatography, protein PI = 4.1, select Q BB column, buffer A: 50 mM phosphate buffer, pH = 7; buffer B: 50 mM phosphate buffer + 1 M sodium chloride, pH = 7;
[0179] 4) Ultrafiltration desalination: use an organic membrane with a molecular weight of 500Da for ultrafiltration desalination.
[0180] 5) Freeze-drying. The hydrophilicity of recombinant sea cucumber peptide is shown in Figure 4 .
[0181] Example 5: A lifting and repairing skin base liquid
[0182] The formula of the lifting and repairing base lotion in this embodiment is shown in Table 11 below.
[0183] Table 11 is the formula of the lifting and repairing base lotion
[0184] Raw material serial number Standard Chinese name Added amount / g 1 water 55.0 2 Caprylic / capric triglyceride 4.6 3 glycerin 4.2 4 Butanediol 3.8 5 Isononyl Isononanoate 2.1 6 Squalane 2.0 7 Avocado tree (BUTYROSPERMUMPARKII) butter 1.5 8 Tridecyl trimellitate 1.3 9 Oat (AVENASATIVA) β-glucan 1.3 10 C14-22 alcohol, C12-20 alkyl glucoside 0.8 11 Cetearyl Olivate, Sorbitan Olivate 0.8 12 Cetearyl Alcohol 0.5 13 Polydimethylsiloxane 0.4 14 Dipropylene glycol 0.4 15 Tocopheryl acetate 0.4 16 p-Hydroxyacetophenone 0.2 17 1,2-Hexanediol 0.2 18 Panthenol 0.2 19 Acrylates / C10-30 Alkyl Acrylate Crosspolymer 0.015 20 Arginine 0.015 21 Biotin 0.015 22 Magnolia officinalis 0.010 23 Xanthan gum 0.009 24 Allantoin 0.009 25 Dipotassium glycyrrhizate 0.008 26 Sea cucumber peptide ((SEQ ID NO.1)) 0.008 27 Ceramide NP 0.006 28 Gynostemma pentaphyllum extract 0.002
[0185] 1. Prepare the lifting and repairing base solution according to the formula in Table 11. The specific method is as follows:
[0186] Raw materials for phase A1: water (1 / 3 of the content in the formula), acrylic acid (esters) / C10-30 alkyl acrylate crosspolymer.
[0187] Phase A2 raw materials: butanediol and magnolol.
[0188] Phase A3 ingredients: Water (the remaining amount in the formula), glycerin, dipropylene glycol, p-hydroxyacetophenone, 1,2-hexanediol, panthenol, xanthan gum, allantoin, Gynostemma pentaphyllum extract.
[0189] Phase B ingredients: Caprylic / capric triglyceride, isononyl isononanoate, squalane, shea butter (BUTYROSPERMUMPARKII) fruit butter, tridecyl trimellitate, C14-22 alcohol, C12-20 alkyl glucoside, cetearyl olivate, sorbitan olivate, cetearyl alcohol, polydimethylsiloxane, tocopheryl acetate, sea cucumber extract.
[0190] Phase C raw materials: arginine.
[0191] Phase D ingredients: oat (AVENA SATIVA) β-glucan, biotin, dipotassium glycyrrhizate, and ceramide NP.
[0192] 1) Weigh the raw materials of Formulation A1 and swell overnight until the material is translucent and uniform;
[0193] 2) Weigh the raw materials of phase A2 and mix them evenly for later use;
[0194] 3) Weigh phase A3 and add it to the main pot in sequence. Add the dispersed phase A1 ingredients to the main pot. Add the phase A2 ingredients to the main pot. Stir and heat to 85±3°C. Keep warm for 30 minutes. Open the pot and check until the material is dissolved and transparent with no insoluble matter. Set aside.
[0195] 4) Weigh the raw materials of phase B and add them to the oil pan in sequence. Heat to 85±3°C with stirring. Keep stirring for 30 minutes and check the dissolution of the liquid until the material is uniformly dissolved. Set aside.
[0196] 5) Emulsification: Pour phase B raw materials into phase A, stir until the material is uniform, start homogenization, homogenize for 8-12 minutes, open the pot to check the emulsification effect, and start cooling until the material liquid is uniform;
[0197] 6) The temperature dropped to 70 ± 3 ° C, and the vacuum was turned on and maintained between -0.06 and -0.08 kPa for 20 minutes;
[0198] 7) Lower the temperature to 60±3°C, weigh the raw materials of Phase C, add them into the pot, and stir until the material is homogeneous;
[0199] 8) Lower the temperature to 40±3°C, weigh the ingredients of Phase D, add them into the pot in sequence, and stir until the mixture is uniform;
[0200] 9) The temperature is lowered to 35±3° C., stirring is stopped, and the material is taken for testing. If the material is qualified, it is discharged to obtain the lifting and repairing muscle base liquid of this embodiment.
[0201] 2. Performance test of the lifting and repairing base lotion of this embodiment
[0202] We recruited patients aged 30 to 60 years old with facial skin that meets the requirement of Tewl>15g / h / m 232 subjects with a stratum corneum moisture content of <50 (Corneometer Unit, CU) used the Lifting and Repairing Essence of this example for 28 consecutive days. The specific usage method was to take the required amount into the palm of your hand after cleansing or using toner in the morning or evening, warm the Essence with your palms facing each other, and evenly apply it to the face / neck, gently pressing until absorbed. The moisturizing, repairing, and firming effects of the cosmetic were evaluated by testing the changes in the stratum corneum moisture content, transepidermal water loss rate, and skin firmness of the subjects before and 28 days of use of the Lifting and Repairing Essence.
[0203] The moisture content of the stratum corneum was measured on the cheeks of the subjects using a Probe Corneometer CM825 (CK, Germany). The higher the test value, the more hydrated the skin.
[0204] The transepidermal water loss rate (TEWL) and evaporative heat loss (ETWL) of the skin were measured on the cheeks of the subjects using a Probe Tewameter™ Hex (CK, Germany). The lower the test value, the better the skin barrier function.
[0205] Skin firmness was tested on the cheeks of the subjects using a skin elasticity tester, Cutometer Dual MPA580 (CK, Germany). The lower the skin firmness (RO) value, the tighter the skin.
[0206] During the test, the instrument testing process should be carried out under the environmental conditions of temperature 21±1℃ and relative humidity 50±10%RH, and all subjects should sit quietly and balance in this environmental condition for at least 30 minutes before starting the evaluation and testing. Figure 5-Figure 7 .
[0207] Summary: Figure 5 It can be seen that after using the test product continuously for 28 days, the moisture content of the subjects' skin stratum corneum increased significantly compared with the baseline value (P≤0.001). The change rate of the moisture content of the subjects' skin stratum corneum compared with the baseline value after using the test product continuously for 28 days was 28.11%.
[0208] Depend on Figure 6 It can be seen that after using the test product continuously for 28 days, the subjects' transepidermal water loss rate was significantly decreased compared with the baseline value (P≤0.001). After using the test product continuously for 28 days, the change rate of the subjects' transepidermal water loss rate compared with the baseline value was -7.19%.
[0209] Depend on Figure 7It can be seen that after 28 days of continuous use of the test product, the skin firmness (RO) of the subjects showed a significant decrease compared with the baseline value (0.01 < P ≤ 0.05), and the change rate of the skin firmness (RO) of the subjects after 28 days of continuous use of the test product compared with the baseline value was -7.44%.
[0210] Although the embodiments of the present application have been described above, the present application is not limited to the above specific embodiments and application fields. The above specific embodiments are merely illustrative and guiding, rather than restrictive. Those of ordinary skill in the art can also make many forms under the inspiration of this specification and without departing from the scope protected by the claims of the present application, and these all fall within the scope of protection of the present application.
Claims
1. A polypeptide with anti-aging effect, wherein: The amino acid sequence of the polypeptide is GPGGPGLGGQQGPRGPPGPSGTITLEVEPSDTIENVK.
2. The polypeptide according to claim 1, wherein The polypeptide is derived from sea cucumber.
3. A polynucleotide encoding the polypeptide according to claim 1 or 2.
4. The polynucleotide according to claim 3, wherein The sequence of the polynucleotide is SEQ ID NO. 6, and the SEQ ID NO. 6 is GGTCCACCAGGTGGTCCAGGTTTGGGTGGTCAACAAGGTCCAAGAGGTCCACCAGGTCCATCTGGTACTATTACTTTGGAAGTTGAACCATCTGATACTATTGAAAACGTTAAG.
5. A method for preparing a polypeptide, wherein the polypeptide is the polypeptide according to claim 1 or claim 2, comprising: The polypeptide is expressed and purified by using Pichia pastoris, and the Pichia pastoris carries an expression vector containing a nucleotide sequence encoding the polypeptide.
6. The method according to claim 5, wherein: The Pichia pastoris is Pichia pastoris GS115.
7. The method according to claim 5, wherein: The expression vector is pPIC9K.
8. Use of the polypeptide according to claim 1 or 2 or the polypeptide prepared by the method according to any one of claims 5 to 7 in preparing cosmetics with anti-aging effects.
9. A cosmetic with anti-aging efficacy, comprising the polypeptide according to claim 1 or 2 or the polypeptide prepared by the method according to any one of claims 5 to 7.
Citation Information
Patent Citations
Application and preparation method of sea cucumber polypeptide in medical equipment
CN110613832A
Sea cucumber-derived polypeptide with moisturizing function
CN117820433A