A recombinant varicella zoster antigen and its preparation method and application

Through codon optimization and Pichia cerevisiae expression system, the efficient expression of varicella zoster virus gE protein is solved, and the problems of low-cost expression efficiency and high cost in the prior art are achieved, and the development of a low-cost varicella zoster vaccine and a strong immune response are achieved.

CN119061037BActive Publication Date: 2025-08-12INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411157866.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-22
Publication Date
2025-08-12
Estimated Expiration
2044-08-22

AI Technical Summary

Technical Problem

The existing recombinant protein expression system is inefficient in the preparation of varicella zoster virus gE protein, and it is difficult to meet the research and development needs of low-cost varicella zoster vaccines.

Method used

The polynucleotide sequence was designed using codon optimization method to construct Pichia cerevisiae expression vector, and the expression of varicella zoster virus gE protein was induced in Pichia cerevisiae, and vaccines were prepared, including AS01 and aluminum salt + CpG ODN.

Benefits of technology

It has achieved efficient expression of varicella zoster virus gE protein, has good immunogenicity, can induce strong immune response, and is suitable for industrial production and vaccine preparation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119061037B_ABST
    Figure CN119061037B_ABST
Patent Text Reader

Abstract

The present invention discloses a recombinant varicella-zoster antigen and its preparation method and application, relating to the field of biomedicine technology. The recombinant varicella-zoster antigen of the present invention comprises a VZV-gE protein having an amino acid sequence as shown in SEQ ID NO.1. The present invention optimizes and designs the gE protein gene sequence of the varicella-zoster virus and constructs a recombinant expression vector, which can achieve efficient expression of the recombinant gE protein on Pichia pastoris, and is easy to obtain a high-efficiency expression strain. The recombinant varicella-zoster virus gE protein (VZV-gE) prepared by the present invention is suitable for preparing a vaccine after being combined with an adjuvant, has good immunogenicity and can induce a good immune response.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and more particularly to a recombinant varicella zoster antigen and a preparation method and application thereof. Background Art

[0002] Recombinant protein expression technology refers to a technique in which a nucleic acid sequence encoding a protein from another source is transformed into the host cells of an expression system. The exogenous protein can be expressed in the cells of the expression system under certain induction conditions, either in the form of a free plasmid or integrated into the vector genome. Currently, mainstream recombinant protein expression systems include yeast expression systems, prokaryotic expression systems such as Escherichia coli, mammalian cell expression systems, and plant cell expression systems. The Pichia pastoris expression system is an important expression system for recombinant protein preparation and vaccine development in developing countries due to its high yield, low cost, ability to apply high-density fermentation, and a certain degree of post-translational modification. Recombinant protein expression technology is an important foundation for many research fields today, such as biology and biopharmaceuticals, and has a wide range of applications in areas such as protein function research and vaccine development. Recombinant protein expression is a key technology in the development of recombinant protein vaccines. Developing coding sequences that can efficiently express exogenous proteins is of great significance for the development of recombinant protein vaccines.

[0003] A codon is a set of three consecutive nucleotides arranged according to a specific pattern in a nucleic acid sequence that encodes a protein. Different nucleotide combinations correspond to different amino acids. Different expression systems have different codon preferences. Even within the same expression system, differences in codon usage can significantly affect the expression efficiency of recombinant proteins. Codon optimization is generally based on the codon usage frequency for different amino acids in the corresponding species, taking into account factors such as the GC content of the coding sequence. Therefore, coding sequences for the same protein can vary significantly, and the efficiency of expressing foreign proteins can also vary significantly.

[0004] Varicella zoster virus (VZV) is a highly contagious virus that causes chickenpox in children, remains latent in the body after recovery, and is the cause of shingles in immunocompromised adults, such as the elderly. The primary immunogenicity of VZV lies in its glycoprotein E (gE), and currently available recombinant VZV protein vaccines all use gE as an antigen. Therefore, the production of gE in a Pichia pastoris expression system is of great significance for the development of a low-cost varicella-zoster vaccine and for improving public health prevention and control of varicella-zoster in my country. Summary of the Invention

[0005] In view of this, the present invention provides a recombinant varicella-zoster antigen and a preparation method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A polynucleotide comprising a signal peptide nucleotide sequence as shown in SEQ ID NO.3 and a VZV-gE nucleotide sequence as shown in SEQ ID NO.2.

[0008] Another object of the present invention is to provide a recombinant protein encoded by the above polynucleotide.

[0009] Another object of the present invention is to provide a biomaterial comprising the above-mentioned polynucleotide.

[0010] Preferably, the expression vector of the biological material is a Pichia pastoris expression vector.

[0011] Another object of the present invention is to provide a cell line, wherein the polynucleotide mentioned above is integrated into the genome of the cell line, or the cell line comprises the biological material mentioned above.

[0012] Another object of the present invention is to provide a recombinant varicella-zoster antigen, which comprises the VZV-gE protein having an amino acid sequence as shown in SEQ ID NO.1.

[0013] Another object of the present invention is to provide a method for preparing the above-mentioned recombinant varicella-zoster antigen, comprising the following steps:

[0014] S1: Artificially synthesized varicella-zoster virus codon-optimized gE gene, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0015] S2: Add the signal peptide sequence shown in SEQ ID NO.3 before the codon-optimized gE gene obtained in step S1, and construct an expression vector in the order of pMT-V5 vector-signal peptide-gE protein-6xHis tag-pMT-V5 vector to obtain a VZV-gE expression vector;

[0016] S3: Transform the VZV-gE expression vector obtained in step S2 into Pichia pastoris competent cells; induce with methanol; and collect the induced supernatant;

[0017] S4: Filter, concentrate, and purify the induced supernatant obtained in step S3 to obtain recombinant varicella zoster antigen.

[0018] Another object of the present invention is to provide an immunogen, which is the above-mentioned recombinant protein or the above-mentioned recombinant varicella-zoster antigen.

[0019] Another object of the present invention is to provide the use of the above-mentioned recombinant protein or the above-mentioned recombinant varicella-zoster antigen in the preparation of a product for preventing varicella-zoster virus infection.

[0020] Another object of the present invention is to provide a pharmaceutical composition for preventing varicella-zoster virus infection, wherein the pharmaceutical composition comprises the above-mentioned recombinant protein or the above-mentioned varicella-zoster virus antigen, and a pharmaceutically acceptable carrier.

[0021] Preferably, the pharmaceutically acceptable carrier is an adjuvant, and the adjuvant is AS01, aluminum salt+CpG ODN.

[0022] Beneficial effects:

[0023] (1) Ease of obtaining efficient expression strains: The present invention optimizes the gene sequence of the varicella-zoster virus gE protein and constructs a recombinant expression vector, which can achieve efficient expression of the recombinant gE protein in Pichia pastoris.

[0024] (2) Easy to scale up industrial production: The yeast expression system has the characteristics of simple culture, rapid growth, suitability for high-density fermentation and low cost, and the expression level of exogenous proteins is high.

[0025] (3) Good stability: The recombinant protein expression vector can be integrated into the host yeast genome through homologous recombination, is not easily lost, and the product is not easily degraded.

[0026] (4) The recombinant varicella-zoster virus gE protein (VZV-gE) produced by the present invention is suitable for preparing vaccines after being combined with an adjuvant, has strong immunogenicity and can induce a good immune response. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0028] Figure 1 This is a map of the Pink-HC-VZV-gE expression vector.

[0029] Figure 2 represents the expression effect of recombinant gE protein, where M is Protein Marker; empty is the supernatant of pPink-HC empty vector; 0 is the supernatant without induction; 1.1-1.3 are the supernatants after 24h, 48h, and 72h of sig1gE induction, respectively.

[0030] Figure 3 The results of nickel ion column purification of recombinant gE protein; A is: Western Blot, SDS-PAGE and Coomassie Brilliant Blue staining; B is Western Blot after nickel ion column purification of VZV-gE recombinant protein; (M is ProteinMarker; Blank is empty load of pPink-HC; Original is the concentrated stock solution of yeast cell induction supernatant; Flow is the flow-through collected during loading; Wash is the eluate in the equilibrium stage; 1-13 are the gradient eluates collected at each time period; the red arrow marks the main peak segment containing VZV-gE recombinant protein; the red box marks VZV-gE recombinant protein; the antibody is a mouse monoclonal antibody against VZV-gE protein); C is the peak graph of nickel ion column purification.

[0031] Figure 4 Analysis results of low N-glycosylation modified VZV-gE recombinant protein; wherein, (A) is SDS-PAGE and Coomassie brilliant blue staining, M is Protein Marker; + is glycoprotein staining positive control (horseradish peroxidase); - is negative control (soybean trypsin inhibitor); blank is pPink-HC empty vector; original is yeast cell induction supernatant stock solution; gE is VZV-gE recombinant protein; H is Endo H endoglycosidase; original (H) is Endo H endoglycosidase-digested yeast cell induction supernatant stock solution; gE (H) is VZV-gE recombinant protein after Endo H endoglycosidase-treated nickel ion column purification; (B) is the corresponding glycoprotein staining image of (A); (C) is SDS-PAGE and Coomassie brilliant blue staining of VZV-gE recombinant protein after Endo H endoglycosidase-treated nickel ion column purification; M is Protein Marker; blank is pPink-HC empty vector; H is Endo H endoglycosidase; original is the yeast cell induction supernatant stock solution; 1-3 are VZV-gE recombinant proteins collected at different stages after nickel ion column purification treated with Endo H endoglycosidase; (D) is the grayscale analysis of "3" in (C); 1 is SDS-PAGE band 1 of "3" in (C) from top to bottom; 2 is SDS-PAGE band 2 of "3" in (C) from top to bottom; 3 is SDS-PAGE band 3 of "3" in (C) from top to bottom; the antibody used is a mouse monoclonal antibody against VZV-gE protein.

[0032] Figure 5 The serum antibody levels of mice in different immunization groups at week 4; IgG antibody values are the OD values of the sample wells. 450 The nm value is the maximum dilution when the positive value is obtained; positive value determination: positive value = 2.1 * negative control well OD 450 nm value; when the sample is diluted 100 times, its OD 450If the nm value is still lower than the positive value, it is recorded as 50; one point in the figure represents one serum sample, and the black short solid line is the geometric mean ± standard deviation; ns means no significant difference, P>0.05; *: P<0.05; **: P<0.01; ***: P<0.001.

[0033] Figure 6 The percentages of CD4+T lymphocytes secreting IL-2, IL-10, and IFN-γ cytokines in the lymph nodes of mice under different immunization schemes; ns means no significant difference, P>0.05; *: P<0.05; **: P<0.01; ***: P<0.001.

[0034] Figure 7 The percentages of CD8+T lymphocytes secreting IL-2, IL-10, and IFN-γ cytokines in the lymph nodes of mice under different immunization schemes; ns means no significant difference, P>0.05; *: P<0.05; **: P<0.01; ***: P<0.001. DETAILED DESCRIPTION

[0035] The following examples illustrate how the DNA sequences involved in this invention can be used to produce VZV-gE protein in a Pichia pastoris system and function as a vaccine. However, these examples should not be construed as limiting the present invention. Modifications or substitutions to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the present invention are considered within the scope of the present invention. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual.

[0036] Example 1 Construction of expression vector

[0037] The varicella-zoster virus gE sequence involved in the present invention was obtained from the National Center for Biotechnology Information (NCBI) of the United States. The gene sequence and amino acid sequence of ORF68 in the VZV Dumas strain (NC_001348.1) were obtained. The original secretion signal peptide was removed, and its N-terminal aa25-539 (SEQ ID NO.1) was intercepted. The codon optimization platform of Jinweizhi Company was used to perform codon optimization according to the preference of Pichia pastoris, so that the gene was more suitable for expression in Pichia pastoris (SEQ ID NO.2). The gene fragment after codon optimization was handed over to Sangon Biotech (Shanghai) Co., Ltd. for gene synthesis. The signal peptide sequence used α-mating factor pre-sequence (SEQ ID NO.3), and the expression vector was constructed in the order of pMT-V5 vector-signal peptide-gE protein-6xHis tag-pMT-V5 vector to obtain Pink-HC-VZV-gE expression vector, as shown in the attached figure. Figure 1 The core elements of the vector include: promoter, terminator, replicon, Kozak sequence, resistance gene and VZV-gE insert.

[0038] SEQ ID NO.1:

[0039] MTNPVRASVLRYDDFHTDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYA;

[0040] SEQ ID NO.2:

[0041]

[0042] SEQ ID NO.3:

[0043] ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGC T.

[0044] Example 2 Induced expression of Pichia pastoris strains and purification of VZV-gE protein

[0045] The expression vector successfully linked to VZV-gE was transformed into Pichia pastoris competent cells by electroporation and inoculated onto PAD selection plates. Cultured in a 28.8°C incubator for 5-10 days, single, well-growing white colonies were selected and inoculated into BMGY liquid medium at 280 rpm and 28.8°C for 48 hours. The culture suspension was collected in a 50 mL centrifuge tube and centrifuged at 1500 x g for 5 minutes. The supernatant was discarded and resuspended in an equal volume of BMMY medium for induction. Induction was continued after 24 hours by adding 4% methanol. The supernatant was collected at 24, 48, and 72 hours.

[0046] The yeast cell induction supernatant was filtered with a 0.22 μm filter membrane, and the filtered induction supernatant was concentrated using a 10KD ultrafiltration membrane package VIVAFLOW 200. Then, the concentrated supernatant was replaced three times by centrifugation with ten times the volume of nickel ion column A solution (20 mM PBS, 0.5 M NaCl) in a 10KD ultrafiltration membrane package device. The sample was then concentrated through a loop and loaded onto a nickel ion column. Five column volumes were balanced with nickel ion column A solution, and gradient elution was performed using nickel ion column B solution (20 mM PBS, 0.5 M NaCl, 0.5 M imidazole). From the start of elution, a tube of eluate was received every 5 mL, marked accordingly, and the eluate was collected.

[0047] Western Blot experiments showed that the recombinant gE protein was expressed to varying degrees after different induction times (see Appendix Figure 2 ), and nickel ion column can effectively purify recombinant gE protein (see Appendix Figure 3 ).

[0048] Example 3 De-N-glycosylation of gE recombinant protein

[0049] The VZV-gE recombinant protein purified by nickel ion column was de-N-glycosylated according to the instructions of Endo H endoglycosidase, and the treated samples were subjected to SDS-PAGE, Coomassie brilliant blue staining and glycogen staining (see Appendix Figure 4 ).

[0050] Example 4 Animal Immunization Experiment of Recombinant gE Protein

[0051] BALB / c female mice aged 6-8 weeks were randomly divided into 7 groups, with 5 mice in each group. The first immunization was performed by intramuscular injection at week 0, and the booster immunization was performed at the same dose at week 2. The control samples were PBS, Pink-HC-VZV-gE (Endo H) (obtained in Example 3), and 293-VZV-gE (gE protein obtained via the eukaryotic expression system 293T cell expression system). The adjuvants were Al(OH)3 (aluminum salt), AS01, and CpG ODN. The specific groupings are shown in Table 1. Tail vein blood was collected from mice at week 0, week 2, and week 4 using a coagulant tube. Serum was separated (centrifuged at 3000 rpm, 4°C for 5 minutes) and stored in a -20°C refrigerator until use. The immunoglobulin G (IgG) antibody levels in the serum of mice immunized with VZV-gE recombinant protein were evaluated, and the secretion levels of lymphocytes and cytokines IL-2, IL-10, and IFN-γ were analyzed by flow cytometry.

[0052] Table 1

[0053]

[0054] Humoral (serum) immunity results can be seen (see Appendix Figure 5), at the second week, the antibody levels in the pPinkgE-Al(OH)3+CpG ODN, pPinkgE-AS01, 293gE-Al(OH)3+CpG ODN and 293gE-AS01 groups were significantly increased. The antibody titers of mice were detected at the 4th week (2 weeks after the second dose of immunization) after immunization with different immunization schemes (pPinkgE, pPinkgE(H), 293gE combined with aluminum salt + CpG ODN and AS01 adjuvant, respectively). The geometric mean titers (GMT values) of antibodies produced by mice with the 6 different immunization schemes were as follows from high to low: pPinkgE-ASO1 (85196), pPinkgE-aluminum salt + CpG ODN2395 (45875), 293gE-aluminum salt + CpG ODN 2395 (26214), 293gE-AS01 (26214), pPinkgE(H)-aluminum salt + CpG ODN (24576) and pPinkgE (H) + AS01 (18022) showed that the highly N-glycosylated VZV-gE expressed by Pichia pastoris could induce mice to produce higher antibody levels than VZV-gE expressed by 293T cells. The serum GMT value of mice in the pPinkgE-ASO1 group was greater than that in the pPinkgE-aluminum salt + CpG ODN group, and the difference was statistically significant (P<0.05), indicating that the ability of aluminum salt combined with CpG ODN adjuvant to induce the antibody level in mice was slightly inferior to that of AS01 adjuvant; secondly, the GMT value of mice in the pPinkgE-ASO1 group was greater than that in the pPinkgE(H) + AS01 group, and the difference was statistically significant (P<0.001), and the serum GMT value of mice in the pPinkgE-aluminum salt + CpG ODN group was also higher than that in the pPinkgE(H)-aluminum salt + CpG ODN group, indicating that the high N-glycosylated VZV-gE produced by the Pichia pastoris expression system was combined with AS01 adjuvant or aluminum salt combined with CpG ODN. Both ODNs were able to induce mice to produce stronger antibody levels than the hypoglycosylated VZV-gE produced by the Pichia pastoris expression system; furthermore, the serum GMT value of mice in the pPinkgE-ASO1 group was higher than that in the pPinkgE-ASO1 group, and the difference was statistically significant (P<0.001). The serum GMT value of mice in the pPinkgE-aluminum salt + CpG ODN group was higher than that in the 293gE-aluminum salt + CpG ODN group, indicating that compared with VZV-gE produced by the eukaryotic expression system 293T, VZV-gE expressed in Pichia pastoris can induce mice to produce higher antibody levels.

[0055] Antibody levels and titers were measured after immunization of mice with different immunization regimens (pPinkgE, pPinkgE(H), and 293gE combined with aluminum salts and CpG ODN and AS01 adjuvant, respectively). With the exception of the PBS group, serum antibody levels and titers increased gradually at 0, 2, and 4 weeks in all immunization groups. At 4 weeks (two weeks after two doses of immunization), serum antibody titers in all experimental groups were greater than 18,022, with the highest geometric mean titer reaching 85,196. Hyperglycosylated VZV-gE produced in the Pichia pastoris expression system combined with AS01 adjuvant induced a stronger humoral immune response in mice than hypoglycosylated VZV-gE produced in the Pichia pastoris expression system. Hyperglycosylated VZV-gE produced in the Pichia pastoris expression system combined with AS01 adjuvant or aluminum salts combined with CpG ODN also induced a stronger humoral immune response in mice than VZV-gE produced in the eukaryotic 293 cell expression system.

[0056] Immunization results can be seen (see Appendix Figure 6 、 7 ), CD4+ and CD8+ T cells secreting IL-2, IL-10, and IFN-γ were present in the lymph nodes of all groups of mice. The pPinkgE-aluminum salt + CpG ODN group had the highest proportion of IL-2-secreting CD4+ T cells, followed by the pPinkgE(H)-aluminum salt + CpG ODN group. The pPinkgE(H)-aluminum salt + CpG ODN group also had the highest proportion of IL-10-secreting CD4+ T cells, suggesting that the deglycosylated recombinant varicella-zoster virus glycoprotein E vaccine produced in the Pichia pastoris expression system may induce stronger Th2-type cellular immunity while maintaining Th1-type cellular immune responses. The 293gE-aluminum salt + CpG ODN group had the highest proportion of IFN-γ-secreting CD4+ T cells, followed by the 293gE-AS01 group. There were significant differences between the 293gE-aluminum salt + CpG ODN group and the pPinkgE-aluminum salt + CpG ODN group (P<0.05). There were also significant differences between the 293gE-aluminum salt + CpG ODN group and the pPinkgE-AS01 group and the pPinkgE(H)-aluminum salt + CpG ODN group (P<0.01). This suggests that the combination of aluminum salt and CpG ODN adjuvants may induce a stronger Th1 cellular immune response.

[0057] The results showed that highly N-glycosylated VZV-gE expressed in Pichia pastoris could induce more effective humoral and cellular immune responses in mice than low-N-glycosylated VZV-gE; compared with AS01, aluminum salt combined with CpG ODN adjuvant could induce stronger Th1 type cellular immune response in VZV-gE recombinant protein vaccine; highly N-glycosylated VZV-gE expressed in Pichia pastoris combined with aluminum salt combined with CpG ODN adjuvant could more effectively induce IL-2 secretion in CD4+ T cells, while VZV-gE combined with aluminum salt combined with CpG ODN adjuvant could more effectively induce IFN-γ secretion in CD4+ T cells.

[0058] In summary, the recombinant gE protein can successfully induce good humoral and cellular immune responses and has important potential value for use as a vaccine.

[0059] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0060] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A polynucleotide, characterized in that The polynucleotide consists of a signal peptide nucleotide sequence as shown in SEQ ID NO.3 and a VZV-gE nucleotide sequence as shown in SEQ ID NO.

2.

2. A host cell, characterized in that The host cell comprises the polynucleotide according to claim 1, and the host cell is Pichia pastoris.

3. The host cell according to claim 2, characterized in that The expression vector of the host cell is a Pichia pastoris expression vector.

4. A method for preparing a recombinant varicella-zoster virus antigen, characterized in that: The following steps are involved: S1: artificially synthesized varicella-zoster virus codon-optimized gE gene, the nucleotide sequence of which is shown in SEQ ID NO.2; S2: Add the signal peptide sequence shown in SEQ ID NO. 3 before the codon-optimized gE gene obtained in step S1, and construct an expression vector in the order of pMT-V5 vector-signal peptide-gE protein-6×His tag-pMT-V5 vector to obtain a VZV-gE expression vector; S3: Transform the VZV-gE expression vector obtained in step S2 into Pichia pastoris competent cells; induce with methanol; and collect the induced supernatant; S4: Filter, concentrate, and purify the induced supernatant obtained in step S3 to obtain recombinant varicella-zoster virus antigen.

5. Use of the polynucleotide according to claim 1 in preparing a product for preventing varicella-zoster virus infection, characterized in that: The product for preventing varicella-zoster virus infection is a recombinant varicella-zoster virus antigen.

Citation Information

Patent Citations

  • Expression method of VZV glycoprotein to pichia pastoris and application of expression method

    CN108383897A

  • Antigen peptide and vaccine composition and application thereof

    CN117886899A