A molecular marker for regulating corn stalk brittleness and its application
By developing molecular markers for the ZmBK2 gene, the problem of identifying corn stalk brittleness was solved, efficient degradation and transformation of corn varieties was achieved, and the efficiency of corn breeding and the degradation performance of the varieties were improved.
Patent Information
- Application Number
- CN202410922386.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-10
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-07-10
AI Technical Summary
The existing technology lacks effective molecular markers for identifying and regulating corn stalk brittleness, which affects the screening and breeding of corn varieties, especially the improvement of degradation and conversion efficiency.
A molecular marker located at the ZmBK2 gene was developed, specifically ZmBK2-1506-ins16bp and ZmBK2-1506-ins83bp. Through PCR amplification and genotyping detection, the stalk brittleness and degradation and conversion efficiency of corn varieties were identified, and gene editing technology was used to transform corn varieties to improve the degradation and conversion efficiency.
The genetic identification and efficient degradation and transformation of corn stalk brittleness were achieved, providing a method for screening and cultivating efficient degradation corn varieties, and improving the breeding value of silage corn.
Smart Images

Figure CN119061177B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a molecular marker for regulating corn stalk fragility and an application thereof. Background Art
[0002] Plant cell walls have a complex structure and synthesis regulatory mechanisms, which are closely related to plant growth, development, stress resistance, and lodging resistance. Plant brittle stalk mutants are excellent materials for studying cell wall synthesis and an important resource for cell wall improvement. Plant brittle stalk mutants have high cellulose degradation and conversion efficiency and are an important direction for silage improvement. Currently, multiple brittle stalk mutants have been reported in rice and multiple genes regulating brittleness have been cloned. However, there are relatively few reports on brittle stalk mutants in maize (Zea mays L.), and there is a lack of development and application of molecular markers related to the identification of maize brittleness. Summary of the Invention
[0003] The purpose of the present invention is to provide a molecular marker for regulating corn stalk brittleness and its application in order to solve the above problems.
[0004] The present invention achieves the above-mentioned purpose through the following technical solutions:
[0005] A molecular marker for regulating maize stalk brittleness, the molecular marker having a nucleotide sequence as shown in SEQ ID NO. 7 or SEQ ID NO. 8, the molecular marker being located at position +1506 bp of the genomic sequence of the ZmBK2 gene, and the primer sequence for verifying the molecular marker being shown in SEQ ID NO. 1-2;
[0006] SEQ ID NO.1: GTTCTACGGGCTCAAGT;
[0007] SEQ ID NO.2: GGAGCAGCAACAGTAGG;
[0008] SEQ ID NO.7: CCCGTTCGGCAACGTT;
[0009] SEQ ID NO. 8: ACGCAAGGACCTTCACCTTCAGCATGGGCTGGGCGTTCCCGCG CAAGATCTACTTCAACGGCGACGAGTGCAAGATGCCGCCG.
[0010] A method for regulating corn stalk brittleness and its application in identifying corn brittleness and degradation conversion efficiency. When the molecular marker inserted at the +1506 bp position of the genomic sequence of the ZmBK2 gene of the tested corn variety is a 16 bp base sequence as shown in SEQ ID NO. 7, the tested corn variety is a stalk-brittle corn variety and a stalk-efficiently degradable corn variety. When the molecular marker inserted at the +1506 bp position of the genomic sequence of the ZmBK2 gene of the tested corn variety is an 83 bp base sequence as shown in SEQ ID NO. 8, the tested corn variety is a stalk-non-brittle corn variety and a stalk-inefficiently degradable corn variety.
[0011] As a further optimization scheme of the present invention, the molecular marker sequence of the non-brittle stalk corn variety and the low-efficiency stalk degradation corn variety is shown as SEQ ID NO.3, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.4; the molecular marker sequence of the brittle stalk corn variety and the high-efficiency stalk degradation corn variety is shown as SEQ ID NO.5, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.6.
[0012] As a further optimization scheme of the present invention, the corn variety with crispy stalks has crispy corn veins and stalks, and the corn variety with non-crisp stalks has non-crisp corn veins and stalks.
[0013] A method for identifying corn stalk brittleness and degradation conversion efficiency using molecular markers related to regulating corn stalk brittleness comprises the following steps:
[0014] S1, extracting the corn DNA to be tested;
[0015] S2. Using a sequence containing the site where the molecular marker is located and its upstream and downstream bases as an amplification template, PCR amplification is performed using primers that verify the molecular marker to obtain an amplification product containing the site where the molecular marker is located;
[0016] S3. Performing genotyping detection on the amplified product to obtain the molecular marker type of the tested corn variety;
[0017] If the type of the maize molecular marker to be tested is ZmBK2-1506-ins16bp, the maize to be tested is a stalk-brittle maize variety and a high-efficiency degradation maize variety;
[0018] If the molecular marker type of the corn to be tested is ZmBK2-1506-ins83bp, the corn to be tested is a stalk non-brittle corn variety and a low-efficiency degradation corn variety.
[0019] The beneficial effects of the present invention are:
[0020] The present invention conducts genetic identification and analysis of the brittle phenotype of the maize brittle stalk mutant bk1 and finds that the maize brittle phenotype is consistent with single gene recessive inheritance. By using the method of genome resequencing, a molecular marker (bk1-indel; ZmBK2-1506-ins16bp / ZmBK2-1506-ins83bp) located in the ZmBK2 gene and linked to brittleness is developed. The BC1F2 population of the maize brittle stalk mutant bk1 and maize B73 is used to prove that the molecular marker is closely related to the maize brittle phenotype. The two types are genetically linked. It was also found that compared with the wild type (corn B73), a 16bp new base was inserted at the 1506bp position of the genomic sequence of the ZmBK2 gene of the corn brittle stalk mutant bk1, replacing the old 83bp base. This mutation caused the protein sequence encoded by the ZmBK2 gene to change. The stalks of the corn brittle stalk mutant bk1 showed a higher degradation and conversion efficiency. The development of this molecular marker will help to screen and cultivate silage corn varieties with high degradation efficiency and has important breeding value. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Agronomic traits of the maize brittle stalk mutant bk1, A: Plant at the 11-leaf stage; B: Leaf vein brittleness at the 11-leaf stage; C: Stalk brittleness at the 11-leaf stage;
[0022] Figure 2 Figure 1 shows the results of the initial localization experiment of the bk1 gene. A: DeepBSA analysis confirmed that the gene is located on chromosome 9; B: SNP analysis showed that the gene is located between 120 and 130 Mb on chromosome 9.
[0023] Figure 3 Agarose gel electrophoresis pattern;
[0024] Figure 4 This is an annotation map of the mutation site of the maize brittle stalk mutant bk1;
[0025] Figure 5 This is a diagram analyzing the degradation and conversion efficiency of the corn brittle stalk mutant bk1 and corn B73;
[0026] Figure 6 Diagram for the gene editing design of the ZmBK2 gene. DETAILED DESCRIPTION
[0027] The present application will be described in further detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.
[0028] 1. Materials
[0029] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.
[0030] The corn brittle stalk mutant bk1 was derived from brittle stalk 1 material used in Wu et al., 2019, Green Chemistry, Altered carbonassimilation and cellulose accessibility to maximize bioethanol yield under low-cost biomass processing in corn brittle stalk.
[0031] 2. Methods
[0032] 2.1 Morphological observation of the maize brittle stalk mutant bk1
[0033] The maize brittle stalk mutant bk1 exhibited normal growth characteristics from the five-leaf stage to the seven-leaf stage. However, at the eleven-leaf stage (e.g. Figure 1 As shown in the figure, a comparison between maize Z31 plants and the maize brittle stalk mutant bk1 plants shows that the leaf veins and stems of the maize brittle stalk mutant bk1 begin to show obvious brittleness, and this brittle characteristic persists in the subsequent growth stages.
[0034] 2.2 Preliminary mapping of the gene for the maize brittle stalk mutant bk1
[0035] A total of 303 plants were collected from the BC1F2 population of the maize brittle stalk mutant bk1 and maize B73, from which 74 brittle stalk plants and 229 normal plants were identified, with a segregation ratio of about 1 / 3, which is basically consistent with single gene recessive inheritance.
[0036] In order to more efficiently locate the bk1 gene, an extreme pool sequencing method was adopted. By identifying specific homozygous markers in the maize brittle stalk mutant bk1 sample and using DeepBSA analysis technology, the bk1 gene was successfully locked on chromosome 9 (such as Figure 2 A), on chromosome 9, the density of specific markers in the maize brittle stalk mutant bk1 sample was calculated and the bk1 gene was finally located at 120-130 Mb (as shown in Figure 2 B).
[0037] 2.3 Fine mapping of the maize brittle stalk mutant bk1
[0038] By resequencing the genome of the maize brittle stalk mutant bk1, a molecular marker (bk1-indel) was developed.
[0039] The specific primer nucleotide sequence of the molecular marker is:
[0040] SEQ ID NO.1: bk1-indel-F: 5'-GTTCTACGGGCTCAAGT-3';
[0041] SEQ ID NO. 2: bk1-indel-R: 5'-GGAGCAGCAACAGTAGG-3'.
[0042] The gDNA of the genome of fragile and non-fragile plants in the corn brittle stalk mutant bk1, corn B73, and the BC1F2 population constructed from the corn brittle stalk mutant bk1 and corn B73 was used as a template, and PCR amplification and genotype identification were performed using the above-mentioned specific primers. The results are as follows Figure 3 As shown, the bands are clearly visible and the wild type (WT, B73), heterozygous (He) and homozygous (Ho, bk1) bands are significantly different and easy to distinguish; the BC1F2 population constructed by the corn brittle stalk mutant bk1 and corn B73 verified that the bk1-indel molecular marker is linked to the corn brittle trait, and this specific primer is located in the ZmB K2 gene. Therefore, it is speculated that this corn brittle stalk mutant bk1 may be caused by a mutation in the ZmBK2 gene.
[0043] 2.4 Annotation of the mutation site of the maize brittle stalk mutant bk1
[0044] Based on the speculation in step 2.3 above, the genomes of the maize brittle stalk mutant bk1 and the gene ZmBK2 in maize B73 were sequenced. Figure 4 As shown, it was found that the corn brittle stalk mutant bk1 had a 16 bp base insertion after the 1505 bp position (i.e., the +1506 bp position of the ZmBK2 genomic sequence) and replaced the original 83 bp base compared to corn B73 (the nucleotide sequence of the ZmBK2 gene of corn B73 is shown in SEQ ID NO.3, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.4; the nucleotide sequence of the ZmBK2 gene of the corn brittle stalk mutant bk1 is shown in SEQ ID NO.5, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.6). This mutation caused a change in the protein sequence encoded by the ZmBK2 gene;
[0045] The nucleotide sequence of the 16 bp base is shown in SEQ ID NO.7: CCCGTTCGGCAACGTT;
[0046] The nucleotide sequence of the 83 bp base is shown in SEQ ID NO. 8: ACGCAAGGACCTTCACCTTCA GCATGGGCTGGGCGTTCCCGCGCAAGATCTACTTCAACGGCGACGAGTGCAAGAT GCCGCCG.
[0047] Analysis on the degradation and conversion efficiency of 2.5bk1 straw at maturity
[0048] The cellulose content and degradation efficiency of corn brittle stalks were analyzed in the mature stage of corn brittle stalk mutant bk1 and corn B73 (for specific methods, refer to Wu et al., 2019, Green Chemistry, Altered carbon assimilation and cellulose accessibility to maximize bioethanol yield under low-cost biomass processing in corn brittle stalk). Figure 5 As shown, it was found that B73 stems showed higher cellulose content and lower degradation and conversion efficiency, while the corn brittle stalk mutant bk1 showed lower cellulose content and higher degradation and conversion efficiency.
[0049] 3. Conclusion
[0050] The present invention analyzes the brittle phenotype and straw degradation conversion efficiency of the corn brittle stalk mutant bk1 and finds that the molecular marker ZmBK2-1506-ins16bp / ZmBK2-1506-ins83bp located in the ZmBK2 gene is closely linked to brittleness, and varieties containing the ZmBK2-1506-ins16bp molecular marker have higher brittleness and degradation conversion efficiency. Based on this, the ZmBK2 gene can be edited to transform wild-type corn varieties containing ZmBK2-1506-ins83bp into transgenic varieties containing ZmBK2-1506-ins16bp. For example, gRNA knockout primers can be designed through gene editing technology to knock out the 83bp sequence of the wild type (such as Figure 6 As shown, gRNA1 and gRNA2 (as shown in SEQ ID NOs. 9-10) were designed targeting the 1466th and 1600th bp sites of the ZmBK2 gene to knock out the target fragment, and then the 16bp sequence was inserted to obtain a new variety with high degradation and conversion efficiency. Alternatively, the ZmBK2 gene containing the 16bp sequence (as shown in SEQ ID NO. 5) was overexpressed to obtain an overexpressed transgenic variety, thereby cultivating a new silage corn variety with high straw degradation and conversion efficiency.
[0051] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.
Claims
1. Application of a molecular marker in identifying corn stalk fragility and degradation conversion efficiency, characterized in that: The molecular marker is located at SEQ ID NO.3 or SEQ ID NO.5 ZmBK2 The nucleotide sequence of the gene is at position +1506bp, and the primer sequence for verifying the molecular marker is shown in SEQ ID NO.1-2; When the corn variety to be tested ZmBK2 When the 16bp base as shown in SEQ ID NO.7 is inserted at the +1506bp position of the nucleotide sequence of the gene, the corn variety to be tested is a stalk-brittle corn variety and a stalk-efficiently degradable corn variety; ZmBK2 When the 83 bp base shown in SEQ ID NO. 8 is inserted into the +1506 bp position of the gene nucleotide sequence, the corn variety to be tested is a corn variety with non-brittle stalks and a corn variety with low stalk degradation efficiency.
2. The use of a molecular marker according to claim 1 in identifying corn stalk fragility and degradation conversion efficiency, characterized in that: The molecular marker sequences of the non-stalk-brittle corn variety and the low-efficiency stalk-degrading corn variety are shown as SEQ ID NO.3, and the amino acid sequences of the encoded proteins are shown as SEQ ID NO.
4. The molecular marker sequences of the stalk-brittle corn variety and the high-efficiency stalk-degrading corn variety are shown as SEQ ID NO.5, and the amino acid sequences of the encoded proteins are shown as SEQ ID NO.
6.
3. The use of a molecular marker according to claim 2 in identifying corn stalk fragility and degradation conversion efficiency, characterized in that: The corn variety with crispy stalks has crispy leaf veins and stalks, and the corn variety with non-crisp stalks has non-crisp leaf veins and stalks.
4. A method for identifying corn stalk fragility and degradation efficiency using molecular markers, characterized by: The following steps are involved: S1, extracting the corn DNA to be tested; S2. Using a sequence containing the site where the molecular marker is located and its upstream and downstream bases as an amplification template, PCR amplification is performed using primers that verify the molecular marker to obtain an amplification product containing the site where the molecular marker is located; S3. Performing genotyping detection on the amplified product to obtain the molecular marker type of the tested corn variety; The molecular marker is located at SEQ ID NO.3 or SEQ ID NO.5 ZmBK2 The nucleotide sequence of the gene is at position +1506bp, and the primer sequence for verifying the molecular marker is shown in SEQ ID NO.1-2; If the type of the maize molecular marker to be tested is, the maize variety to be tested is ZmBK2 When the 16 bp base sequence shown in SEQ ID NO. 7 is inserted at the +1506 bp position of the nucleotide sequence of the gene, the corn to be tested is a stalk-brittle corn variety and a stalk-efficiently degradable corn variety; If the type of the maize molecular marker to be tested is, the maize variety to be tested is ZmBK2 When the 83 bp base shown in SEQ ID NO. 8 is inserted into the +1506 bp position of the nucleotide sequence of the gene, the corn to be tested is a stalk non-brittle corn variety and a stalk-inefficiently degradable corn variety.
Citation Information
Patent Citations
InDel molecular marker co-separated from corn brittle gene and application thereof
CN112430682A
Inbred corn line RBO1
US20030018998A1