A fungus-drug composition containing Bacillus subtilis and its application in preventing and treating hyperuricemia

Abstract

The invention discloses a fungus-drug composition containing Bacillus subtilis and application thereof in preventing and treating hyperuricemia, belonging to the field of microorganisms. The fungus-drug composition of Bacillus subtilis BS01, clematis and plumeria provided by the invention can significantly reduce the kidney index of mammals; significantly reduce the contents of blood uric acid, serum urea nitrogen and serum creatinine in mammals; significantly reduce the activity of xanthine oxidase in mammal livers; significantly improve the antioxidant capacity of mammals, especially the GSH level of kidneys; significantly increase the expression amount of ABCG2 mRNA in mammals; can extremely reduce the uric acid level of the body, alleviate kidney function damage, and alleviate kidney oxidative damage. The fungus-drug composition of the invention can be used to prepare drugs for preventing and treating hyperuricemia and the composition thereof, can also be used as an auxiliary product of existing therapeutic drugs and treatment methods, can also be used as a microecological preparation in medicines or health products, and has a very broad application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and in particular to a fungus-drug composition containing Bacillus subtilis and application thereof in preventing and treating hyperuricemia. Background Art

[0002] Hyperuricemia (HUA) is the second most common metabolic disease after diabetes. Its incidence has continued to rise in recent years. Its clinical manifestations are elevated serum uric acid. If it is not well controlled, it will further induce gout, renal failure and cause irreversible joint damage. The onset of hyperuricemia is mainly due to purine metabolism disorders in the body, and uric acid accumulates in the body to exceed normal levels (3-7mg / dL).

[0003] Hyperuricemia drugs are mainly divided into three categories: uricostatic drugs, uricosuric drugs, and uricolytic drugs, including purinol, oxypurinol, febuxostat, benzbromarone, probenecid, losartan, and pegylated recombinant uricase. However, the above drugs have adverse reactions such as hemolytic anemia, gastrointestinal discomfort, liver damage, and allergic syndrome, and their clinical application is limited.

[0004] Therefore, there is an urgent need for a drug for preventing and treating hyperuricemia without side effects and an application method thereof. Summary of the invention

[0005] The invention aims to overcome the shortcomings of the prior art, and provides a fungus-drug composition containing Bacillus subtilis and application thereof in preventing and treating hyperuricemia, belonging to the field of microorganisms. The fungus-drug composition of Bacillus subtilis BS01, Clematis chinensis and Plumeria dahurica provided by the invention can significantly reduce the renal index of mammals; significantly reduce the contents of blood uric acid, serum urea nitrogen and serum creatinine in mammals; significantly reduce the activity of xanthine oxidase in the liver of mammals; significantly improve the antioxidant capacity of mammals, especially the GSH level of kidneys; significantly increase the expression amount of ABCG2 mRNA in mammals; can extremely reduce the uric acid level of the body, alleviate kidney function damage, and alleviate kidney oxidative damage; the fungus-drug composition provided by the invention can be used to prepare drugs and compositions thereof for preventing and treating hyperuricemia, can also be used as auxiliary products of existing therapeutic drugs and treatment methods, can also be used as microecological preparations in medicines or health products, and has very broad application prospects.

[0006] In order to achieve the above technical effects, the following technical solutions are adopted:

[0007] A fungus-drug composition containing Bacillus subtilis, which is prepared by compounding Bacillus subtilis BS01 bacterial liquid, Clematis chinensis Chinese medicine liquid and Plumeria odorifera Chinese medicine liquid;

[0008] The Bacillus subtilis BS01 strain is classified and named Bacillus subtilis BS01; the deposit number is: CCTCC NO: M 2012485, the deposit date is November 28, 2012, the depository is China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the postal code is 430072;

[0009] The concentration of the Bacillus subtilis BS01 bacterial solution is 1-2×10 9 CFU / mL;

[0010] The Clematis Chinese medicine liquid is a concentrate obtained by decocting the Clematis raw material drug to a volume of 2.5 mL to 3 mL per gram of the Clematis raw material drug;

[0011] The plumeria Chinese medicine liquid is a Chinese medicine liquid concentrate obtained by boiling the plumeria raw material medicine until the volume of the Chinese medicine liquid concentrate corresponding to each gram of the plumeria raw material medicine is 2.5 mL-3 mL;

[0012] The ratio of the dosage of the fungus-drug composition to the body weight of a mammal is 1.5 mL-2.5 mL: 1 kg.

[0013] Furthermore, the mass ratio of the Bacillus subtilis BS01 bacterial solution, the Clematis chinensis traditional Chinese medicine solution and the Plumeria dahurica traditional Chinese medicine solution is 2-3:1-1.5:1-1.5.

[0014] Further, the preparation method of the Bacillus subtilis BS01 bacterial liquid is as follows: according to the live bacterial count result of placing the Bacillus subtilis BS01 seed liquid in a sterile LB liquid medium at 37°C and culturing for 24 hours, the bacterial cells are prepared into 1-2×10 9 The bacterial solution with a concentration of CFU / mL was stored at 4°C for future use and mixed with a vortex instrument to prepare a bacterial suspension before intragastric administration.

[0015] Furthermore, the preparation method of the Clematis chinensis Chinese medicine liquid is as follows: step 1: take 15g of Clematis chinensis, crush it and pass it through a 100-mesh sieve, put the sieved raw medicine into a cooking container, soak it in mixed water for 30min-60min, the solid-liquid ratio of the medicine to water is 1:8-12, decocted at 65°C for 3h, filtered at normal pressure, and collected the filtrate; step 2: add water to the filter residue in the above step 1 and decoct it for 1h, the solid-liquid ratio of the filter residue to water is 1:5-9, filtered at normal pressure, and collected the filtrate; step 3: combine the filtrates in step 1 and step 2, concentrate them under reduced pressure at 50°C, and concentrate them to a volume of 2.5mL-3mL of the concentrated solution corresponding to each gram of the raw medicine, collect the concentrated solution, mix it evenly, and let it stand, perform high-temperature instantaneous sterilization at 105°C to obtain the Clematis chinensis Chinese medicine liquid; store it at 4°C for use, and use a vortex instrument to mix the Chinese medicine suspension before gavage.

[0016] Furthermore, the preparation method of the plumeria traditional Chinese medicine liquid is as follows: step 1: take 15g of plumeria, crush it and pass it through a 100-mesh sieve, put the sieved raw medicine into a cooking container, soak it in mixed water for 30min-60min, the solid-liquid ratio of the medicine-mixed water is 1:8-12, boil it at 65°C for 3h, filter it at normal pressure, and collect the filtrate; step 2: add water to the filter residue in the above step 1 and boil it again for 1h, the solid-liquid ratio of the filter residue and water is 1:5-9, filter it at normal pressure, and collect the filtrate; step 3: combine the filtrates in step 1 and step 2, concentrate them under reduced pressure at 50°C, and concentrate them to a volume of 2.5mL-3mL of the concentrated solution corresponding to each gram of the raw medicine, collect the concentrated solution, mix it evenly, let it stand, and perform high-temperature instantaneous sterilization at 105°C to obtain the plumeria traditional Chinese medicine liquid; store it at 4°C for use, and use a vortex instrument to mix the traditional Chinese medicine suspension before gavage.

[0017] Furthermore, the bacterial drug composition is used in the preparation of a drug for preventing and treating hyperuricemia, wherein the bacterial drug composition is a lyophilized powder or an aqueous solution;

[0018] Furthermore, the drug for preventing and treating hyperuricemia also includes a pharmaceutical composition, a functional food or a health product.

[0019] Furthermore, the medicine or pharmaceutical composition also contains a pharmaceutically acceptable carrier.

[0020] Furthermore, the application method is to administer orally the medicine, medicine composition, functional food or health care product prepared by the bacterial medicine composition prepared by the bacterial medicine composition of Bacillus subtilis BS01 bacterial liquid, Clematis chinensis Chinese medicine liquid and Plumeria dahurica Chinese medicine liquid.

[0021] Furthermore, the application for preventing and treating hyperuricemia includes at least one of (a)-(e):

[0022] (a) Significantly reduce the renal index of mammals;

[0023] (b) significantly reducing the levels of blood uric acid, serum urea nitrogen and serum creatinine in mammals;

[0024] (c) Significantly reduce the activity of xanthine oxidase in mammalian liver;

[0025] (d) Significantly increase the antioxidant capacity of mammals;

[0026] (e) Significantly increased the expression level of mammalian ABCG2 mRNA.

[0027] Furthermore, the mammals include humans.

[0028] The present invention discloses Bacillus subtilis and its application in alleviating hyperuricemia, belonging to the field of microorganisms. The present invention provides Bacillus subtilis BS01 (classified as Bacillus subtilis When Bacillus subtilis BS01 and Clematis chinensis and Plumeria odorata are used alone or in combination, the effect of preventing and treating hyperuricemia is not obvious, but the composition of Bacillus subtilis BS01, Clematis chinensis and Plumeria odorata can synergize with each other, jointly improve the effect of preventing and treating hyperuricemia, and can effectively prevent and treat hyperuricemia. The composition can synergistically significantly reduce the renal index of mammals, restore the healthy level of kidneys, significantly reduce the content of blood uric acid, serum urea nitrogen and serum creatinine in mammals, significantly reduce the activity of xanthine oxidase in the liver of mammals, significantly increase the antioxidant capacity of mammals, especially the GSH level of kidneys, and significantly increase the expression of ABCG2 mRNA in mammals. The composition of Bacillus subtilis BS01 and Clematis chinensis and Plumeria odorata provided by the present invention can be used to prepare drugs and compositions for preventing and treating hyperuricemia, can also be used as auxiliary products of existing therapeutic drugs and treatment methods, and can also be used as microecological preparations in medicines or health products, and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. The drawings in the following description are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0030] Figure 1 is a graph showing the results of the blood uric acid content of each group of mice in the embodiment of the present invention;

[0031] Figure 2 1 is a graph showing the results of the serum urea nitrogen content of each group of mice in the embodiment of the present invention;

[0032] Figure 3 is a graph showing the results of serum creatinine content of each group of mice in the embodiment of the present invention;

[0033] Figure 4 is a graph showing the kidney index results of each group of mice in the embodiment of the present invention;

[0034] Figure 5 This is a graph showing the relative expression of ABCG2 mRNA in the kidneys of each group of mice in the embodiment of the present invention;

[0035] Figure 6 This is a graph showing the results of the GSH levels in the kidneys of each group of mice in the examples of the present invention;

[0036] Figure 7 is a graph showing the activity of xanthine oxidase in the liver of mice in each group in the embodiment of the present invention; DETAILED DESCRIPTION

[0037] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0038] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0039] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations and / or combinations thereof.

[0040] Embodiment 1:

[0041] Animal Experiment Design:

[0042] For a more concise description later, the definition is as follows:

[0043] Bacillus subtilis strains (classified as Bacillus subtilis BS01): concentration is 10 9 The preparation method of the bacterial suspension of Bacillus subtilis BS01 with a concentration of 10 CFU / mL is as follows: according to the viable bacterial count result of Bacillus subtilis BS01 seed liquid placed in a sterile LB liquid medium at 37°C for 24 hours, the bacterial cells are prepared into 10 CFU / mL suspension using a PBS buffer with a concentration of 1X and a pH of 7.0. 9CFU / mL bacterial solution was stored at 4°C for future use. A vortex was used to mix the bacterial suspension before intragastric administration. Fresh bacterial solution was prepared once a week on average. The Bacillus subtilis strain involved in the embodiment is defined as component A.

[0044] Clematis: 1) Take 15g of Clematis, crush it and pass it through a 100-mesh sieve, put the sieved raw material into a cooking container, soak it in mixed water for 30min-60min, the solid-liquid ratio of the drug to water is 1:8-12, decocted at 65℃ for 3h, filtered at normal pressure, and the filtrate is collected; 2) Add water to the filter residue in the above step and decoct it again for 1h, the solid-liquid ratio of the filter residue to water is 1:5-9, filtered at normal pressure, and the filtrate is collected; 3) The filtrates in step 1) and step 2) are combined, concentrated by rotary evaporation under reduced pressure at 50℃, and concentrated to a volume of 2.5mL of the concentrate corresponding to each gram of the raw material, collect the concentrated solution, mix it evenly, and sterilize it at high temperature at 105℃ to obtain the Clematis Chinese medicine liquid. Store it at 4℃ for use, use a vortex instrument to mix the Chinese medicine suspension before gavage, and prepare fresh Chinese medicine liquid once a week on average. The Chinese medicine Clematis involved in the embodiment is defined as component B.

[0045] Plumeria: 1) Take 15g of plumeria, crush it and pass it through a 100-mesh sieve, put the sieved raw material into a cooking container, soak it in mixed water for 30min-60min, the solid-liquid ratio of the medicine to water is 1:8-12, boil it at 65℃ for 3h, filter it at normal pressure, and collect the filtrate; 2) Add water to the filter residue in the above step and boil it again for 1h, the solid-liquid ratio of the filter residue to water is 1:5-9, filter it at normal pressure, and collect the filtrate; 3) Combine the filtrates in step 1) and step 2), and concentrate them under reduced pressure at 50℃ to a volume of 2.5mL of concentrated solution per gram of raw material, collect the concentrated solution, mix it evenly, and sterilize it at high temperature at 105℃ to obtain plumeria Chinese medicine solution. Store it at 4℃ for use, use a vortex instrument to mix the Chinese medicine suspension before gavage, and prepare fresh Chinese medicine solution once a week on average. The Chinese medicine plumeria involved in the experiment is defined as component C.

[0046] Seventy-two 8-week-old male Kunming mice were housed in a room with a temperature of 20-22°C and a humidity of 40-60%, with a 12-h day-night cycle from 8 a.m. to 8 p.m., and were adapted for 7 days with free access to water and food. After the adaptation period, the body weight was 45±5g, and they were randomly divided into 12 groups (6 rats in each group), namely, control group (group C), model group (group M), modeling + 0.05mL A + 0.025 mL B + 0.025mL C (group Y1), modeling + 0.05 mL A (group Y2), modeling + 0.025 mL B (group Y3), modeling + 0.025 mL C (group Y4), modeling + 0.1 mL A (group Y5), modeling + 0.1 mL B (group Y6), modeling + 0.1 mL C (group Y7), modeling + 0.05 mLA + 0.05 mL B (group Y8), modeling + 0.05 mL A + 0.05 mL C (group Y9), and modeling + 0.05 mL B + 0.05 mL C (group Y10).

[0047] The modeling group was given potassium oxonate and carboxymethyl cellulose (CMC) by intragastric administration for 12 weeks (the frequency of intragastric administration was 1 day / 1 time) (dose: potassium oxonate 250 mg / kg body weight, dissolved in 0.2 mL 0.5% CMC) to establish the model; 1 hour after the potassium oxonate was intragastrically administered, the modeling group was intragastricly administered with 0.1 mL of normal saline.

[0048] The above-mentioned treatment groups Y1-Y10 were given potassium oxonate and carboxymethyl cellulose (CMC) by gavage for 12 weeks (gavage frequency was 1 day / 1 time) (dose: potassium oxonate 250 mg / kg body weight, dissolved in 0.2 mL 0.5% CMC) to establish the model. One hour after modeling with potassium oxonate, the mice were gavaged with the treatment solutions of the above treatment group formulas; i.e., modeling + 0.05 mL A + 0.025 mL B + 0.025 mL C (group Y1), modeling + 0.05 mL A (group Y2), modeling + 0.025 mL B (group Y3), modeling + 0.025 mL C (group Y4), modeling + 0.1 mL A (group Y5), modeling + 0.1 mL B (group Y6), modeling + 0.1 mL C (group Y7), modeling + 0.05 mL A + 0.05 mLB (group Y8), modeling + 0.05 mL A + 0.05 mL C (group Y9), and modeling + 0.05 mL B + 0.05 mL C (group Y10).

[0049] In the above control group, the intragastric administration of potassium oxonate and carboxymethyl cellulose (CMC) was replaced by intragastric administration of an equal amount of normal saline (the frequency of intragastric administration was once a day). One hour after intragastric administration of normal saline, the control group was intragastricly administered with 0.1 mL of normal saline;

[0050] After the experimental period, samples were taken from 72 mice, including whole blood, kidneys and livers.

[0051] 1) Determination of mouse serum muscle tissue indicators:

[0052] Mouse blood was centrifuged at 4°C and 3500 rpm for 10 minutes, and the supernatant was collected as serum and stored at -80°C for later use. Accurately weigh the liver, and add 9 times the volume of normal saline at a ratio of weight (g): volume (mL) = 1:9, prepare homogenate in an ice water bath, and then centrifuge at 3000 rpm for 10 minutes. The supernatant was taken as 10% tissue homogenate and stored at -80°C for later use. The levels of blood uric acid, urea nitrogen, creatinine and liver xanthine oxidase were detected using the Solarbio kit, and all operations were performed according to the instructions.

[0053] Kidney panel ABCG2 determination:

[0054] Total RNA was isolated from kidney samples using a total RNA extraction kit according to the manufacturer's instructions. The quantity and quality of the isolated RNA were assessed by agarose gel electrophoresis, and the absorbance was measured at 260 nm and 280 nm. First-strand complementary DNA (cDNA) was synthesized using a cDNA synthesis kit according to the manufacturer's instructions. The cDNA product was stored at -20°C for subsequent gene expression analysis. RT-qPCR was performed using the LightCycle® 96 Real-Time System and SYBR Green Supermix.

[0055] The RT-qPCR reaction system included: cDNA product (1 μL), upstream primer (1 μL), downstream primer (1 μL), SYBRGreen Supermix (5 μL) and sterile deionized water (2 μL). The RT-qPCR program included: initial 50°C (2 min), followed by 95°C (5 min), followed by denaturation at 95°C for 10 s, annealing at the optimal temperature for 30 s, and repeating the above steps in 40 cycles. The final melting point was determined to determine the purity of the PCR product. The expression level of the target gene at the mRNA level was determined by the above method. After normalization of β-actin, the expression level of the relevant genes was calculated using Microsoft Excel software and the 2-ΔΔCq relative abundance method.

[0056] ABCG2 primers: synthesized by Hangzhou Youkang Biotechnology Co., Ltd. (Hangzhou, Zhejiang, China) (upstream primer Forward: CCTCGATATGGCTTCACAGCTT; downstream primer Reverse: GGCCACATGATTCCTCCACA).

[0057] Reagents and consumables used in the above experiments:

[0058] Potassium oxonate (McLean, batch number P831461); sodium carboxymethylcellulose (McLean, batch number C804626); serum uric acid (UA) test kit purchased from Solarbio, batch number BC1365; urea nitrogen (BUN) test kit (Solarbio, batch number BC1535); creatinine (CRE) test kit (Solarbio, batch number BC4910); liver xanthine oxidase (XOD) test kit (Solarbio, batch number BC1095); total RNA extraction kit (OMEGA, batch number R6834); PrimeScript TM RT reagent Kit with gDNA Eraser (TakaRa, lot number RR047A); SYBRGreen Supermix (Bio-Rad, lot number 170-882); LightCycle® 96 Real-Time System (Boehringer Mannheim GmbH).

[0059] Result analysis:

[0060] Effects of different treatment groups on blood uric acid:

[0061] like Figure 1 As shown: Potassium oxonate is a uricase inhibitor, which can inhibit the activity of uricase, reduce the decomposition and excretion of uric acid, increase the uric acid level, and cause hyperuricemia in mice. It has been used. The results showed that the blood uric acid content of the modeling group reached 411 mg / L, which was significantly higher than that of the normal group ( p <0.0001). After treatment in each group, the synergistic effect of Bacillus subtilis + Clematis chinensis + Plumeria odorifera in the Y1 treatment group can significantly alleviate the abnormal increase of uric acid caused by potassium oxonate ( p <0.0001), and the other treatment groups could not significantly alleviate the abnormal increase of uric acid caused by potassium oxonate.

[0062] Effects of different treatment groups on serum urea nitrogen:

[0063] like Figure 2 As shown: Serum urea nitrogen is the main indicator for judging kidney function damage. The urea nitrogen content of the model group mice was significantly higher than that of the normal group mice ( p <0.0001). The results showed that the abnormal increase of uric acid caused by potassium oxonate would significantly affect kidney function, which was mainly reflected in the serum urea nitrogen index. After treatment in each group, the synergistic effect of Bacillus subtilis + Clematis chinensis + Plumeria dahurica in the Y1 treatment group could significantly reduce the increase of serum urea nitrogen content caused by potassium oxonate ( p<0.0001), significantly alleviating renal function damage.

[0064] Effects of different treatment groups on serum creatinine:

[0065] like Figure 3 As shown: Serum creatinine is the main indicator for judging kidney function damage. The serum creatinine content of the model group mice was significantly higher than that of the normal group mice ( p <0.0001). The results showed that the abnormal increase in uric acid caused by potassium oxonate would significantly affect kidney function, mainly reflected in the serum creatinine index. After treatment in each group, the synergistic effect of Bacillus subtilis + Clematis chinensis + Plumeria odorifera in the Y1 treatment group could significantly reduce the increase in serum creatinine caused by potassium oxonate ( p <0.0001), significantly alleviating renal function damage.

[0066] Effects of different treatment groups on renal indexes:

[0067] like Figure 4 As shown in the figure: The kidney is the main organ for uric acid metabolism, and the kidney index can reflect the health of the organ to a certain extent. The results show that the injection of potassium oxonate will significantly increase the kidney index, thereby causing damage to the kidney ( p <0.0001). After treatment in each group, the synergistic effect of Bacillus subtilis + Clematis chinensis + Plumeria odorifera in the Y1 treatment group can significantly reduce the increase in renal index caused by potassium oxamate ( p <0.0001), significantly improving kidney health.

[0068] Effects of different treatment groups on the relative expression of ABCG2 mRNA in kidney:

[0069] like Figure 5 As shown: ABCG2 is adenosine triphosphate binding cassette transporter G2, which is involved in the transport of uric acid in the body. The results showed that compared with the control group, the renal ABCG2 mRNA of the model group mice was significantly downregulated ( p <0.0001), indicating that potassium oxonate interfered with the normal metabolism of uric acid. After treatment in each group, the synergistic effect of Bacillus subtilis + Clematis chinensis + Plumeria dahurica in the Y1 treatment group could significantly improve the significant downregulation of renal ABCG2 mRNA caused by potassium oxonate ( p <0.0001), promoting the excretion of excess uric acid in the body.

[0070] Effects of different treatment groups on renal GSH levels:

[0071] like Figure 6As shown: Hyperuricemia can cause oxidative stress in the kidneys, which is characterized by a decrease in GSH levels. The results showed that compared with the control group, the GSH level in the modeling group was significantly reduced, suggesting that the abnormal increase in uric acid caused by potassium oxonate can cause oxidative stress damage to the kidneys. After treatment in each group, the synergistic effect of Bacillus subtilis + Clematis chinensis + Plumeria dahurica in the Y1 treatment group can significantly improve the decrease in GSH levels caused by potassium oxonate ( p <0.0001), significantly alleviating renal oxidative stress injury.

[0072] Effects of different treatment groups on liver xanthine oxidase activity:

[0073] like Figure 7 As shown: The liver is the main site of uric acid production. The xanthine oxidase present in it can catalyze the oxidation and reduction of hypoxanthine to form xanthine, and finally form uric acid. Therefore, the activity of xanthine oxidase in the liver is proportional to the body's uric acid production function. The results showed that compared with the control group, the xanthine oxidase activity in the modeling group was significantly increased ( p <0.0001). After treatment in each group, the synergistic effect of Bacillus subtilis + Clematis chinensis + Plumeria odorata in the Y1 treatment group can significantly reduce the abnormal increase of xanthine oxidase caused by potassium oxonate ( p <0.0001), significantly alleviating liver and body damage, while the other treatment groups obviously did not have the above-mentioned significant improvement effect.

[0074] In summary, the present invention discloses a Chinese medicine composition containing Bacillus subtilis and its application in preventing and treating hyperuricemia, belonging to the field of microorganisms, the composition of Bacillus subtilis BS01, Clematis chinensis and Plumeria odorata provided by the present invention can cooperate with each other, jointly improve the prevention and treatment effect, can prevent and treat hyperuricemia very well, the composition can synergistically restore the kidney index of mice, restore the healthy level of kidneys; significantly reduce the content of blood uric acid, serum urea nitrogen and serum creatinine in mice; significantly reduce the activity of xanthine oxidase in mouse liver; significantly increase the antioxidant capacity of mice, especially the GSH level of kidneys; significantly increase the expression of ABCG2 mRNA in mice. The composition of Bacillus subtilis BS01, Clematis chinensis and Plumeria odorata provided by the present invention can be used to prepare drugs and compositions thereof for preventing and treating hyperuricemia, can also be used as auxiliary products of existing therapeutic drugs and treatment methods, can also be used as microecological preparations in medicines or health products, and has a very wide application prospect.

[0075] At this point, those skilled in the art recognize that, although the embodiments of the present invention have been shown and described in detail herein, many other variations or modifications that conform to the principles of the present invention can still be directly determined or derived based on the contents disclosed in the present invention without departing from the spirit and scope of the present invention. Therefore, the scope of the present invention should be understood and recognized as covering all such other variations or modifications.

Claims

1. A bacterial drug composition containing Bacillus subtilis for preventing and treating hyperuricemia, characterized in that: The bacterial drug composition is prepared by compounding Bacillus subtilis BS01 bacterial liquid, Clematis chinensis Chinese medicinal liquid and Plumeria dahurica Chinese medicinal liquid; The Bacillus subtilis BS01 strain is classified and named as Bacillus subtilis; the deposit number is: CCTCC NO: M2012485, the deposit date is November 28, 2012, the deposit unit is China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the postal code is 430072; The concentration of the Bacillus subtilis BS01 solution is 1×10 9 CFU / mL -2×10 9 CFU / mL; The Clematis Chinese medicine liquid is a concentrate obtained by decocting the Clematis raw material drug to a volume of 2.5 mL to 3 mL per gram of the Clematis raw material drug; The plumeria Chinese medicine liquid is a Chinese medicine liquid concentrate obtained by boiling the plumeria raw material medicine until the volume of the Chinese medicine liquid concentrate corresponding to each gram of the plumeria raw material medicine is 2.5 mL-3 mL; The ratio of the dosage of the bacterial drug composition to the body weight of the mammal is 1.5 mL-2.5 mL: 1 kg; The preparation method of the Chinese herbal medicine liquid of Clematis chinensis comprises the following steps: step 1: taking 15 g of Clematis chinensis, crushing and passing through a 100-mesh sieve, placing the sieved raw medicine into a cooking container, soaking it in mixed water for 30-60 min, the solid-liquid ratio of the medicine to water being 1:8-12, boiling it at 65° C. for 3 h, filtering it at normal pressure, and collecting the filtrate; step 2: boiling the filter residue in the above step 1 again with water for 1 h, the solid-liquid ratio of the filter residue to water being 1:5-9, filtering it at normal pressure, and collecting the filtrate; step 3: combining the filtrates in step 1 and step 2, concentrating them under reduced pressure by rotary evaporation at 50° C., concentrating them to a volume of 2.5 mL-3 mL of the concentrate corresponding to each gram of the raw medicine, collecting the concentrate, mixing it evenly, and standing it, performing high-temperature instantaneous sterilization at 105° C., and obtaining the Chinese herbal medicine liquid of Clematis chinensis; storing it at 4° C. for use, and mixing the Chinese herbal medicine suspension with a vortex instrument before intragastric administration; The preparation method of the plumeria traditional Chinese medicine liquid is as follows: step 1: taking 15g of plumeria, crushing and passing through a 100-mesh sieve, putting the sieved raw medicine into a cooking container, soaking it in mixed water for 30min-60min, the solid-liquid ratio of the medicine to water is 1:8-12, decocting at 65°C for 3h, filtering at normal pressure, and collecting the filtrate; step 2: adding water to the filter residue in the above step 1 and decocting it again for 1h, the solid-liquid ratio of the filter residue to water is 1:5-9, filtering at normal pressure, and collecting the filtrate; step 3: combining the filtrates in step 1 and step 2, concentrating them under reduced pressure by rotary evaporation at 50°C, concentrating them to a volume of 2.5mL-3mL of the concentrated solution corresponding to each gram of the raw medicine, collecting the concentrated solution, mixing it evenly, and letting it stand, performing high-temperature instantaneous sterilization at 105°C to obtain the plumeria traditional Chinese medicine liquid; storing it at 4°C for use, and mixing the traditional Chinese medicine suspension with a vortex instrument before intragastric administration; The mass ratio of the Bacillus subtilis BS01 bacterial liquid, the Clematis chinensis traditional Chinese medicine liquid and the Plumeria dahurica traditional Chinese medicine liquid is 2-3:1-1.5:1-1.

5.

2. The fungus-drug composition according to claim 1, characterized in that: The preparation method of the Bacillus subtilis BS01 bacterial liquid is as follows: according to the live bacterial count result of placing the Bacillus subtilis BS01 seed liquid in a sterile LB liquid culture medium at 37° C. and culturing for 24 hours, the bacterial cells are prepared into 1×10 9 CFU / mL -2×10 9 The bacterial solution with a concentration of CFU / mL was stored at 4°C for future use and mixed with a vortex instrument to prepare a bacterial suspension before intragastric administration.

3. The use of the fungus-drug composition as claimed in claim 1 in the preparation of a drug for preventing and treating hyperuricemia, characterized in that: The fungus-drug composition is a freeze-dried powder or an aqueous solution.

4. The use as claimed in claim 3, characterized in that The drug also contains a pharmaceutically acceptable carrier.

5. The use as claimed in claim 3, characterized in that The application method comprises the steps of gavage or oral administration of a medicine prepared from a bacterial-drug composition prepared from a bacterial liquid of Bacillus subtilis BS01, a Chinese medicinal liquid of Clematis chinensis and a Chinese medicinal liquid of Plumeria dahurica.

6. The use as claimed in claim 3, characterized in that The application for preventing and treating hyperuricemia includes at least one of (a) to (e): (a) Significantly reduce the renal index of mammals; (b) significantly reducing the levels of blood uric acid, serum urea nitrogen and serum creatinine in mammals; (c) Significantly reduce the activity of xanthine oxidase in mammalian liver; (d) Significantly increase the antioxidant capacity of mammals; (e) Significantly increased the expression level of mammalian ABCG2 mRNA.

7. The use as claimed in claim 6, characterized in that The mammals include humans.

Images