Preparation method and application of recombinant escherichia coli electrocatalyst for overexpressing cytochrome c

Abstract

The invention discloses a preparation method and application of a recombinant Escherichia coli electrocatalyst for overexpressing cytochrome c. The preparation method comprises the following steps: integrating target genes of tor Y and feck for promoting protein biosynthesis of cytochrome c with a carrier plasmid by utilizing a double-gene synergistic engineering technology to construct a recombinant expression plasmid; and transferring the recombinant plasmid into wild Escherichia coli for induced expression culture to finally obtain the recombinant Escherichia coli whole-cell bioelectrocatalyst for overexpression of cytochrome c protein. The electrocatalyst prepared by the invention shows excellent performance of electrocatalysis and degradation of organic pollutants in domestic wastewater when being used for cathode oxygen reduction catalysis of a microbial fuel cell, and the maximum power density of 334 W cm < 2 > and the glucose degradation amount of 22.9 mM within 140 hours are respectively realized by the total cell electricity generation performance and the glucose model pollutant degradation capability.

Description

Technical Field

[0001] The invention belongs to the technical field of air cathode biomaterials for microbial fuel cells, and in particular relates to a preparation method and application of a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c. Background Art

[0002] Microbial fuel cells (MFCs) can generate electricity by utilizing microbial metabolism to degrade organic matter in wastewater, achieving the dual benefits of energy recovery and pollutant treatment. They are sustainable, pollution-free, and have extensive resource utilization, and have great development potential in the fields of energy and environment. However, the oxygen reduction reaction (ORR) performance of the current MFC air cathode mainly relies on precious metal-based electrocatalysts, which are costly and cannot degrade pollutants, which is not conducive to sustainable development.

[0003] The development of green, renewable and efficient microbial ORR electrocatalysts can effectively regulate the multifunctional coupling of the cathode, that is, promoting biopower generation and organic waste degradation at the same time. ORR plays an important role in the biological respiration process and can be used in many bioelectrochemical devices and systems, such as microbial fuel cells, microbial electrosynthesis and biosensing. Microbial electrocatalysts have excellent sustainability and operational durability. However, an important limitation of their application in ORR catalysis is their relatively low intrinsic catalytic activity, which is mainly attributed to the insufficient number of electrocatalytically active enzymes / proteins in the cell and the poor electron transfer between the cell membrane and the current collector.

[0004] Cytochrome c (Cyt c) protein has good bioelectron conduction ability and electrocatalytic ORR performance. In Escherichia coli, the biosynthesis of Cyt c protein includes two key structural components, apo-cyt c and heme, involving the tor Y gene that promotes the synthesis of apo-cyt c and the ferrochelatase fech gene that promotes the synthesis of heme. Genetic engineering methods have been used to design and improve the biosynthesis efficiency and electron transfer rate of electroactive microorganisms. Gene manipulation and editing have achieved effective regulation of gene expression, knockout and reduction of microorganisms, which are used to regulate the biochemical functions of microbial electrocatalysts. Therefore, the use of genetic engineering strategies can improve the electron transfer efficiency of microbial cells and the synthesis yield of key catalytic proteins, thereby promoting catalytic efficiency and electrical energy production. At present, there are no reports on the overexpression of Cyt c protein based on Escherichia coli BL21 (DE3) and its application in MFC. Summary of the invention

[0005] The technical problem solved by the present invention is to provide a method for preparing a biosafe, green and renewable recombinant Escherichia coli electrocatalyst that overexpresses cytochrome c. When the recombinant Escherichia coli electrocatalyst that overexpresses cytochrome c prepared by the method is used as a catalytic material for the MFC air cathode, it not only has good interfacial electron transfer efficiency, but also produces abundant ORR catalytic active protein sites, thus giving the Escherichia coli cells excellent electrocatalytic ORR activity and the dual-effect functions of efficient electricity production of the microbial fuel cell and degradation of glucose-containing model organic wastewater.

[0006] The present invention adopts the following technical solution to solve the above technical problems, a method for preparing a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c, characterized by the specific steps of: Step S1: retrieve the target gene information and coding sequence of tor Y and fech required for the biosynthesis of cytochrome c protein in Escherichia coli from the NCBI database, use T7 promoter as the start gene to promote the start of transcription, integrate the target genes of tor Y and fech into the vector plasmid pCOLADuet-1 to construct the recombinant expression plasmid Cyt c-pCOLADuet-1, wherein the primer sequence of Nco Ⅰ restriction site upstream of tor Y target gene is: 5'AACTTTAATAAGGAGATATAATGCGAGGGAAAAAACGCAT 3'; the primer sequence of Not Ⅰ restriction site downstream of tor Y target gene is: 5'CTGTTCGACTTAAGCATTATTCACTGTTTCTCGGTAATAT 3'; the primer sequence of Nde Ⅰ restriction site upstream of fech target gene is: 5'TAAGAAGGAGATATACATATGCGTCAGACTAAAACCGG 3'; the primer sequence of Xho Ⅰ restriction site downstream of fech target gene is: 5'TAAGAAGGAGATATACATATGCGTCAGACTAAAACCGG 3' The primer sequence for restriction site I was: 5′GGTTTCTTTACCAGACTCGAGTTAGCGATACGCGGCAACAAG 3′; Step S2: The recombinant expression plasmid constructed in step S1 was transformed into competent E. coli cells, cultured in LB liquid medium for 40-80 min, and then the transformed E. coli suspension was spread to a medium containing 90-120 μg mL −1 The plasmid was maintained on LB agar plates containing kanamycin at 35-40°C for 12-16 h, and a single colony was selected for purification in LB liquid medium at 35-40°C overnight. Finally, it was transferred to a new medium containing 90-120 μg mL −1After culturing for 3 to 5 hours in LB liquid culture medium containing kanamycin, IPTG inducer was added to a concentration of 0.05 to 0.6 mM, and then the expression was induced and cultured at 10 to 37° C. for 4 to 20 hours, and finally a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c was obtained.

[0007] It is further defined that the recombinant Escherichia coli in step S2 is based on the biosafe Escherichia coli BL21 (DE3) as a starting strain.

[0008] Further defined, the composition of the LB liquid culture medium in step S2 is 10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 Sodium chloride.

[0009] The application of the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c in the preparation of the air cathode of a microbial fuel cell is characterized by the specific process of: using a carbon cloth electrode attached with the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c as a cathode, the cathode liquid is a 30mM glucose solution, and a carbon cloth electrode coated with commercial Pt / C as an anode, the anode liquid is a 1M glucose solution, the two chambers are separated by a proton exchange membrane, the MFC is placed in an incubator at 30-37°C, an external 2000Ω resistor is connected, oxygen is introduced into the cathode liquid, and nitrogen is introduced into the anode liquid.

[0010] It is further defined that the specific preparation process of the cathode is: suspending the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c in LB liquid culture medium, and placing the carbon cloth electrode in the LB liquid culture medium and incubating it with the recombinant Escherichia coli, finally obtaining a carbon cloth electrode, i.e., a cathode, with a recombinant Escherichia coli electrocatalyst biofilm overexpressing cytochrome c attached thereto.

[0011] Further defined, the composition of the LB liquid medium is 10g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 Sodium chloride.

[0012] It is further defined that the co-incubation time is 24 to 48 hours.

[0013] The invention discloses an application of the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c in preparing a working electrode of a three-electrode half-cell, in which a platinum sheet and a saturated silver / silver chloride electrode are used as a counter electrode and a reference electrode, respectively.

[0014] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. Compared with the chemical material engineering method, the preparation method of the present invention performs design operations and engineering modifications at the gene molecular level, which is more accurate and efficient, has no effect on cell viability, and further improves the protein expression ability and biochemical characteristics of the microbial cells themselves.

[0015] 2. According to the structural composition of cytochrome c active protein, the present invention uses dual-gene collaborative engineering to efficiently produce a large number of catalytically active protein sites and heme catalytically active centers, effectively improving the interfacial electron transfer rate and intrinsic catalytic activity of the whole cell.

[0016] 3. When a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c is used as a catalytic material for the MFC air cathode, it not only exhibits excellent electrocatalytic ORR activity in a half-cell, but also exhibits good dual-effect functions of biopower generation and glucose-containing wastewater degradation when assembled into a full cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 A graph showing the relative expression of cytochrome c protein of the recombinant Escherichia coli electrocatalysts prepared in Example 1 and Example 2; Figure 2 CV (a) and LSV (b) diagrams of the electrocatalytic ORR of the recombinant Escherichia coli electrocatalyst prepared in Example 1; Figure 3 This is a polarization curve-power density diagram of the recombinant Escherichia coli electrocatalyst prepared in Example 1; Figure 4 This is a graph of glucose degradation by the recombinant Escherichia coli electrocatalyst prepared in Example 1. DETAILED DESCRIPTION

[0018] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention. Example 1

[0019] Step S1: retrieve the target gene information and coding sequence of tor Y and fech required for the biosynthesis of cytochrome c protein in Escherichia coli from the NCBI database, integrate the two target genes into the vector plasmid pCOLADuet-1 to construct the recombinant expression plasmid Cyt c-pCOLADuet-1, wherein the T7 promoter is used as the starter gene to promote the start of transcription, the coding sequence of the tor Y gene is shown in SEQ ID NO.1; the coding sequence of the fech gene is shown in SEQ ID NO.2; the primer sequence of the Nco Ⅰ restriction site upstream of the tor Y target gene is: 5'AACTTTAATAAGGAGATATAATGCGAGGGAAAAAACGCAT 3' (as shown in SEQ ID NO.3); the primer sequence of the Not Ⅰ restriction site downstream of the tor Y target gene is: 5'CTGTTCGACTTAAGCATTATTCACTGTTTCTCGGTAATAT 3' (as shown in SEQ ID NO.4); the Nde Ⅰ restriction site upstream of the fech target gene is: 5'CTGTTCGACTTAAGCATTATTCACTGTTTCTCGGTAATAT 3' (as shown in SEQ ID NO.4); The primer sequence of the I restriction site is: 5'TAAGAAGGAGATATACATATGCGTCAGACTAAAACCGG 3' (as shown in SEQ ID NO.5); the primer sequence of the Xho I restriction site downstream of the fech target gene is: 5'GGTTTCTTTACCAGACTCGAGTTAGCGATACGCGGCAACAAG 3' (as shown in SEQ ID NO.6).

[0020] Step S2: The recombinant expression plasmid constructed in step S1 was transformed into competent E. coli cells and cultured in LB liquid medium (10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 The transformed E. coli suspension was then spread onto a plate containing 100 μg mL −1 The plasmid was maintained on LB agar plates containing kanamycin at 37 °C for 14 h, and a single colony was selected and plated in LB liquid medium (10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 The cells were purified overnight in 5% sodium chloride (37°C, 200 rpm) and finally transferred to a new medium containing 100 μg mL −1 LB liquid medium containing kanamycin (10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1After culturing for 4 h, IPTG inducer was added to a concentration of 0.2 mM, and then the expression was induced and cultured at 20°C for 12 h, and finally a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c was obtained. Example 2

[0021] Step S1: retrieve the target gene information and coding sequence of tor Y and fech required for the biosynthesis of cytochrome c protein in Escherichia coli from the NCBI database, integrate the two target genes into the vector plasmid pCOLADuet-1 to construct the recombinant expression plasmid Cyt c-pCOLADuet-1, wherein the T7 promoter is used as the starter gene to promote the start of transcription, the coding sequence of the tor Y gene is shown in SEQ ID NO.1; the coding sequence of the fech gene is shown in SEQ ID NO.2; the primer sequence of the Nco Ⅰ restriction site upstream of the tor Y target gene is: 5'AACTTTAATAAGGAGATATAATGCGAGGGAAAAAACGCAT 3' (as shown in SEQ ID NO.3); the primer sequence of the Not Ⅰ restriction site downstream of the tor Y target gene is: 5'CTGTTCGACTTAAGCATTATTCACTGTTTCTCGGTAATAT 3' (as shown in SEQ ID NO.4); the Nde Ⅰ restriction site upstream of the fech target gene is: 5'CTGTTCGACTTAAGCATTATTCACTGTTTCTCGGTAATAT 3' (as shown in SEQ ID NO.4); The primer sequence of the I restriction site is: 5'TAAGAAGGAGATATACATATGCGTCAGACTAAAACCGG 3' (as shown in SEQ ID NO.5); the primer sequence of the Xho I restriction site downstream of the fech target gene is: 5'GGTTTCTTTACCAGACTCGAGTTAGCGATACGCGGCAACAAG 3' (as shown in SEQ ID NO.6).

[0022] Step S2: The recombinant expression plasmid constructed in step S1 was transformed into competent E. coli cells and cultured in LB liquid medium (10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 The transformed E. coli suspension was then spread onto a plate containing 100 μg mL −1 The plasmid was maintained on LB agar plates containing kanamycin at 37 °C for 14 h, and a single colony was selected and plated in LB liquid medium (10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1The cells were purified overnight in 5% sodium chloride (37°C, 200 rpm) and finally transferred to a new medium containing 100 μg mL −1 LB liquid medium containing kanamycin (10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 After culturing for 4 h, IPTG inducer was added to a concentration of 0.1 mM, and then the expression was induced and cultured at 30°C for 16 h, and finally a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c was obtained.

[0023] The protein expression test confirmed the cytochrome c protein content of the recombinant Escherichia coli electrocatalysts prepared in Example 1 and Example 2. Figure 1 It can be seen that both Example 1 and Example 2 produced cytochrome c protein expression levels higher than that of wild bacteria, indicating that the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c was successfully prepared. Example 3

[0024] The recombinant Escherichia coli electrocatalyst overexpressing cytochrome c obtained in Examples 1 and 2 was suspended in LB liquid culture medium (10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 The carbon cloth electrode of 2 cm × 3 cm was placed in LB liquid culture medium and incubated with recombinant Escherichia coli for 36 h, and finally a carbon cloth electrode with a recombinant Escherichia coli electrocatalyst biofilm overexpressing cytochrome c was obtained.

[0025] Half-cell electrochemical performance test: ORR performance test was carried out on CHI 760E electrochemical workstation (ShanghaiChenhua, China), with the carbon cloth electrode prepared as above as working electrode, platinum sheet and saturated silver / silver chloride electrode as counter electrode and reference electrode, respectively. Electrochemical measurements were carried out in 100 mL phosphate buffer (pH = 7) composed of 22 mM KH2PO4, 42 mM Na2HPO4, 85.5 mM NaCl, 1.0 mM MgSO4 and 0.1 mM CaCl2. After O2 saturation, the ORR performance was tested at 50 mVs −1 Cyclic voltammetry (CV) measurements were performed at a scan rate of 5 mV s −1 The linear sweep voltammetry (LSV) curve was tested at a scan rate of 1.

[0026] MFC full cell test: A two-chamber MFC device with a working volume of 50 mL was used, separated by a proton exchange membrane (nafion 211 from DuPont, USA). Carbon cloth (2cm×3cm) was used as the cathode electrode and the anode electrode base electrode. The cathode chamber electrolyte was a 30mM glucose solution, saturated with oxygen to remove nitrogen. The anode liquid was a 1M glucose solution. The carbon cloth electrode prepared above was used as the biocathode, and the carbon cloth electrode coated with commercial Pt / C was used as the anode. The anode catalyst was 40wt% Pt / C with a loading of 2mg cm −2 The assembled MFC voltage measurements were evaluated on a CHI 760E electrochemical workstation (Shanghai Chenhua, China). When the MFC voltage reached a steady state, the polarization and power density curves were obtained by changing the external resistance (10~300000Ω). The output performance of the MFC under long-term operation was tested using a Keithley 2700 data acquisition system when the external resistance was 2000Ω. The MFC was operated at 37°C and repeated 3 times.

[0027] Figure 2 The electrocatalytic ORR performance of the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c prepared in Example 1 is shown in the figure. It can be seen from the figure that the prepared catalyst has excellent electrocatalytic activity, and the maximum current density is 3.2 mA cm −2 , the starting potential is 0.58V. Figure 3 and Figure 4 The polarization curve-power density diagram and glucose degradation diagram of the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c prepared in Example 1 as the MFC air cathode are shown in the figure. It can be seen from the figure that the maximum power density of the MFC assembled using the prepared electrocatalyst is 334 μW cm −2 The amount of glucose degradation within 140 h was 22.9 mM, indicating that this recombinant Escherichia coli electrocatalyst overexpressing cytochrome c protein exhibited excellent power generation performance and glucose-containing wastewater degradation ability.

[0028] Coding sequence of tor Y gene (SEQ ID NO.1): Coding sequence of fech gene (SEQ ID NO.2): atgcgtcagactaaaaccggtatcctgctggcaaacctgggtacgcccgatgcccccacacctgaagcggtaaaacgctatctgaaacaatttttaagcgacagacgcgtggttgatacctcacggttgttatggtggccattgctgcgcggcgtgattttgccgctgcgctcgccgcgtgtggcgaagctgtatgcctctgtctggatggaaggtggctcgccgctgatggtttacagccgtcagcaacagcaggcgctggcacaacgtttaccggagacgcccgtagcgctgggaatgagctacggctcgccatcactggaaagcgccgtagatgaactcctggcagagcatgtagatcatattgtggtgctgccgctttatccgcaatactcctgttcaacggtcggtgcggtatgggatgaactggcacgcattctggcgcgcaaacgtagcattccggggatatcgtttattcgtgattacgctgataaccacgattacattaatgcactggcgaacagcgtacgcgcttcttttgccaaacatggcgaaccggatctgctgctgctctcttatcatggcattccccagcgttatgcagatgaaggcgatgattacccgcaacgttgccgcacaacgactcgcgaactggcttccgcactggggatggcaccggaaaaagtgatgatgacctttcagtcgcgctttggtcgggaaccctggctgatgccttataccgacgaaacgctgaaaatgctcggagaaaaaggcgtaggtcatatacaggtgatgtgcccgggctttgctgcggattgtctggagacgctggaagagattgccgagcaaaaccgtgaggtcttcctcggtgccggcgggaaaaaatatgaatatattccagcgcttaatgccacgccggaacatattgaaatgatggctaatcttgttgccgcgtatcgctaa Primer sequence of Nco Ⅰ restriction site upstream of tor Y target gene (SEQ ID NO.3): 5'AACTTTAATAAGGAGATATAATGCGAGGGAAAAAACGCAT 3' Primer sequence of Not Ⅰ restriction site downstream of tor Y target gene (SEQ ID NO.4): 5' CTGTTCGACTTAAGCATTATTCACTGTTTCTCGGTAATAT 3' Primer sequence of Nde Ⅰ restriction site upstream of fech target gene (SEQ ID NO.5): 5'TAAGAAGGAGATATACATATGCGTCAGACTAAAACCGG 3' Primer sequence of Xho Ⅰ restriction site upstream of fech target gene (SEQ ID NO.6): 5'GGTTTCTTACCAGACTCGAGTTAGCGATACGCGGCAACAAG 3' The above embodiments describe the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for illustrating the principles of the present invention. Without departing from the scope of the principles of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of protection of the present invention.

Claims

1. A method for preparing a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c, characterized in that The specific steps are: Step S1: retrieve the target gene information and coding sequence of tor Y and fech required for the biosynthesis of cytochrome c protein in Escherichia coli from the NCBI database, use T7 promoter as the start gene to promote the start of transcription, integrate the target genes of tor Y and fech into the vector plasmid pCOLADuet-1 to construct the recombinant expression plasmid Cyt c-pCOLADuet-1, wherein the primer sequence of Nco Ⅰ restriction site upstream of tor Y target gene is: 5'AACTTTAATAAGGAGATATAATGCGAGGGAAAAAACGCAT3'; the primer sequence of Not Ⅰ restriction site downstream of tor Y target gene is: 5'CTGTTCGACTTAAGCATTATTCACTGTTTCTCGGTAATAT 3'; the primer sequence of Nde Ⅰ restriction site upstream of fech target gene is: 5'TAAGAAGGAGATATACATATGCGTCAGACTAAAACCGG 3'; the primer sequence of Xho Ⅰ restriction site downstream of fech target gene is: 5'TAAGAAGGAGATATACATATGCGTCAGACTAAAACCGG 3' The primer sequence for restriction site I was: 5′GGTTTCTTTACCAGACTCGAGTTAGCGATACGCGGCAACAAG 3′; Step S2: The recombinant expression plasmid constructed in step S1 was transformed into competent E. coli cells, cultured in LB liquid medium for 40-80 min, and then the transformed E. coli suspension was spread to a medium containing 90-120 μg mL −1 The plasmid was maintained on LB agar plates containing kanamycin at 35-40°C for 12-16 h, and a single colony was selected for purification in LB liquid medium at 35-40°C overnight. Finally, it was transferred to a new medium containing 90-120 μg mL −1 After culturing for 3 to 5 hours in LB liquid culture medium containing kanamycin, IPTG inducer was added to a concentration of 0.05 to 0.6 mM, and then the expression was induced and cultured at 10 to 37° C. for 4 to 20 hours, and finally a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c was obtained.

2. The method for preparing a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c according to claim 1, characterized in that: The recombinant Escherichia coli in step S2 uses the biosafe Escherichia coli BL21 (DE3) as a starting strain.

3. The method for preparing the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c according to claim 1, characterized in that: The composition of the LB liquid medium in step S2 is 10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5gL −1 Sodium chloride.

4. Use of a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c prepared according to the method of any one of claims 1 to 3 in preparing an air cathode of a microbial fuel cell.

5. The use according to claim 4, characterized in that The specific process is as follows: a carbon cloth electrode with a recombinant Escherichia coli electrocatalyst overexpressing cytochrome c attached is used as the cathode, the cathode liquid is a 30mM glucose solution, a carbon cloth electrode coated with commercial Pt / C is used as the anode, the anode liquid is a 1M glucose solution, the two chambers are separated by a proton exchange membrane, the MFC is placed in an incubator at 30-37°C, an external 2000Ω resistor is connected, oxygen is passed into the cathode liquid, and nitrogen is passed into the anode liquid.

6. The use according to claim 5, characterized in that The specific preparation process of the cathode is: suspending the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c in LB liquid culture medium, and placing the carbon cloth electrode in the LB liquid culture medium and incubating it with the recombinant Escherichia coli, finally obtaining a carbon cloth electrode with a recombinant Escherichia coli electrocatalyst biofilm overexpressing cytochrome c attached, namely the cathode.

7. The use according to claim 6, characterized in that: The composition of the LB liquid medium is 10 g L −1 Tryptone, 5 g L −1 Yeast extract and 5 g L −1 Sodium chloride.

8. The use according to claim 6, characterized in that: The co-incubation time is 24 to 48 hours.

9. Use of the recombinant Escherichia coli electrocatalyst overexpressing cytochrome c prepared according to the method of any one of claims 1 to 3 in the preparation of a working electrode of a three-electrode half-cell, in which a platinum sheet and a saturated silver / silver chloride electrode serve as a counter electrode and a reference electrode, respectively.

Images