TaqMan fluorescent quantitative PCR primer set for monkey varicella virus and its application

Abstract

The present invention provides a monkey varicella virus TaqMan fluorescent quantitative PCR primer set and application, and relates to the technical field of molecular biology. The present invention uses the conserved region of the monkey varicella virus type 9 genome as the target gene, designs two specific primers and one probe according to the basic principle of TaqMan real-time fluorescent PCR, and establishes a simple, efficient and practical detection method. The monkey varicella virus detection method of the present invention is effective in 10 1 ‑10 11 The sensitivity of the template was 1×10 1 The invention uses TaqMan fluorescent quantitative PCR to accurately quantify monkey varicella virus in real time, which can meet the urgent need of early and accurate clinical diagnosis of monkey varicella virus infection and provide a basis for epidemiological investigation and targeted treatment of monkey varicella virus infection.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and specifically relates to a monkey varicella virus TaqMan fluorescent quantitative PCR primer set and an application thereof. Background Art

[0002] The herpesviridae family contains a variety of medium-sized, enveloped DNA viruses, with more than 100 species discovered so far. These viruses widely infect non-human primates. According to the classification and characteristics of the virus, primate herpesviruses are mainly divided into three subfamilies: α, β, and γ. Simian varicella virus (SVV) belongs to the alpha herpesvirus subfamily and can cause diseases similar to human chickenpox, posing a serious threat to the health of non-human primates. The clinical symptoms, pathology, immunity, and viral characteristics of non-human primates infected by this virus are similar to those of humans infected by Varicella-zoster virus (VZV). SVV infection in monkeys may cause symptoms such as fever, vesicular rash, and hepatitis, and severe cases may even be fatal. The virus can remain dormant in the ganglia of non-human primates for life and may be reactivated after the primary disease disappears, causing new infections. Inhalation of infectious droplets is the main mode of transmission of SVV, making monkeys that have not yet developed the disease generally susceptible. The incubation period of SVV is 7-14 days, and the initial symptom is usually a mild rash in the groin area, which is difficult to identify in clinical observation. Studies have shown that early antiviral treatment may be effective in controlling SVV infection. Therefore, timely diagnosis is crucial for controlling and preventing SVV epidemics in non-human primates.

[0003] Traditional herpes virus detection methods mainly include virus isolation and culture and serological testing. The former was once the "gold standard" for the diagnosis of herpes virus, but it has defects such as a long time (3-30 days), low sensitivity (especially after antiviral drug treatment), and difficulty in typing. The latter is divided into direct antigen detection method and indirect antibody detection method. The direct antigen detection method has low sensitivity because some viruses do not produce detectable antigens. The indirect antibody detection method cannot be used for early diagnosis because it takes about 1 week after herpes virus infection to produce effective concentrations of antibodies. In addition, there are cross-reactions between different herpes viruses, and the antibody specificity is not high.

[0004] With the rapid development of molecular biology technology, TaqMan real-time fluorescence quantitative PCR technology has provided a new direction for the detection of pathogenic microorganisms. The basic principle of TaqMan real-time fluorescence quantitative PCR technology is to use the 5'-3' exonuclease nucleic acid activity of Taq enzyme to design a fluorescent double-labeled probe based on ordinary PCR, with the fluorescent reporter group (R) and the quencher group (Q) labeled at both ends respectively; when the probe remains intact, the fluorescence signal of the R group is inhibited by the Q group. Once the probe is cut off, the inhibitory effect of the Q group disappears, and the fluorescence signal of the R group can be detected. This technology realizes real-time monitoring of the amount of product in the PCR process by detecting the fluorescent signal, and can accurately calculate the initial template amount. In addition to the advantages of accurate quantification and rapid detection, the biggest advantage is the use of completely closed tube detection, which eliminates the need for post-processing of PCR products and avoids cross contamination.

[0005] At present, with the further development of materials and instruments, TaqMan real-time fluorescence quantitative PCR technology can realize genotyping, gene mutation detection, SNP analysis and other research by labeling different fluorescent dyes (FAM, HEX, ROX, etc.) at the 5' end of the fluorescent probe and using multi-channel fluorescence quantitative PCR instruments. Therefore, it is urgent to develop a TaqMan fluorescence quantitative PCR detection method for SVV that can perform qualitative and quantitative analysis. Summary of the invention

[0006] In view of this, the object of the present invention is to provide a monkey varicella virus TaqMan fluorescent quantitative PCR primer set and application, wherein the primer set has good sensitivity, specificity and repeatability, and can be used for the rapid detection of monkey varicella virus.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a TaqMan fluorescent quantitative PCR primer set for detecting monkey varicella virus, wherein the primer set comprises an upstream primer, a downstream primer and a fluorescent probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.3.

[0009] Preferably, the 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0010] The present invention also provides a TaqMan fluorescent quantitative PCR kit for detecting monkey varicella virus, wherein the kit contains the TaqMan fluorescent quantitative PCR primer set.

[0011] Preferably, the kit further comprises TaqMan fluorescent quantitative PCR reaction solution Premix Ex Taq, a positive control substance and a negative control substance.

[0012] More preferably, the positive control substance is a pMD19-T vector plasmid containing monkey varicella virus; and the negative control substance is sterile water for injection.

[0013] The present invention also provides an application of the TaqMan fluorescent quantitative PCR primer set or the TaqMan fluorescent quantitative PCR kit in preparing a product for detecting monkey varicella virus.

[0014] The present invention also provides a TaqMan fluorescent quantitative PCR method for detecting monkey varicella virus for non-diagnostic purposes, comprising the following steps:

[0015] Target DNA was extracted from positive simian varicella virus samples, and the target gene was obtained by conventional PCR amplification using the extracted target DNA as a template;

[0016] Connect the target gene to the pMD19-T vector to obtain a positive recombinant plasmid;

[0017] The positive recombinant plasmid was diluted in series to establish a standard curve;

[0018] DNA is extracted from the sample to be tested, and the extracted DNA is used as a template to perform fluorescent quantitative PCR amplification using the TaqMan fluorescent quantitative PCR primer set, and the monkey varicella virus in the sample to be tested is calculated according to the result.

[0019] Preferably, the primers for conventional PCR amplification include an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO.4; the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5.

[0020] Preferably, the reaction system of TaqMan fluorescent quantitative PCR amplification includes, in 20 μL, 10 μL of 2×Premix ExTaq, 0.8 μL of fluorescent probe, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 2 μL of DNA template, and 8.4 μL of RNase Free H2O.

[0021] Preferably, the reaction procedure of the TaqMan fluorescent quantitative PCR amplification is as follows: 95°C for 30s; 95°C for 5s, 60°C for 30s, and 40 cycles.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention designs a specific primer set and a fluorescent probe for monkey varicella virus (SVV), and develops a TaqMan fluorescent quantitative PCR method that can qualitatively and quantitatively detect monkey varicella virus. The primer set has good sensitivity, specificity and repeatability, and can be used for rapid detection of monkey varicella virus. The present invention uses TaqMan fluorescent quantitative PCR to perform real-time and accurate quantitative detection of SVV, which can meet the urgent need for early, accurate, and clinical diagnosis of SVV infection, and provide a basis for epidemiological investigation and targeted treatment of SVV infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the result of conventional PCR amplification of SVV;

[0025] Figure 2 The results of constructing the recombinant positive plasmid vector;

[0026] Figure 3 This is the amplification curve of monkey varicella virus TaqMan fluorescence quantitative PCR;

[0027] Figure 4 This is the standard curve of simian varicella virus TaqMan fluorescence quantitative PCR;

[0028] Figure 5 This is the specific result of TaqMan fluorescent quantitative PCR for simian varicella virus;

[0029] Figure 6 It is the viral load of visceral tissue after simian varicella virus infection. DETAILED DESCRIPTION

[0030] The invention provides a TaqMan fluorescent quantitative PCR primer set for detecting monkey varicella virus. The primer set comprises an upstream primer, a downstream primer and a fluorescent probe; the nucleotide sequence of the upstream primer is CACCTCGCAAAGCAGATTT (SEQ ID NO.1); the nucleotide sequence of the downstream primer is AATGTACGAGAGCGTATATCATATGT (SEQ ID NO.2); and the nucleotide sequence of the fluorescent probe is TTTCAGCTTCGTTGGTTGGTGCTACTA (SEQ ID NO.3).

[0031] In the present invention, the 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. In the present invention, the fluorescent reporter group preferably includes FAM, TET, and HEX. In a specific embodiment of the present invention, the fluorescent reporter group is more preferably FAM. In the present invention, the fluorescent quencher group is preferably BHQ. That is, the nucleotide sequence of the fluorescent probe of the present invention is 5'-FAM-TTTCAGCTTCGTTGGTTGGTGCTACTA (SEQ ID NO.3)-BHQ-3'.

[0032] The present invention also provides a TaqMan fluorescent quantitative PCR kit for detecting monkey varicella virus, wherein the kit preferably contains the TaqMan fluorescent quantitative PCR primer set.

[0033] In the present invention, the kit also preferably includes TaqMan fluorescent quantitative PCR reaction solution Premix Ex Taq, a positive control substance and a negative control substance. In the present invention, the positive control substance is preferably a pMD19-T vector plasmid containing monkey varicella virus; and the negative control substance is preferably sterile water for injection.

[0034] The present invention also provides an application of the TaqMan fluorescent quantitative PCR primer set or the TaqMan fluorescent quantitative PCR kit in preparing a product for detecting monkey varicella virus.

[0035] The present invention also provides a TaqMan fluorescent quantitative PCR method for detecting monkey varicella virus for non-diagnostic purposes, comprising the following steps:

[0036] Target DNA was extracted from positive simian varicella virus samples, and the target gene was obtained by conventional PCR amplification using the extracted target DNA as a template;

[0037] Connect the target gene to the pMD19-T vector to obtain a positive recombinant plasmid;

[0038] The positive recombinant plasmid was diluted in series to establish a standard curve;

[0039] DNA is extracted from the sample to be tested, and the extracted DNA is used as a template to perform fluorescent quantitative PCR amplification using the TaqMan fluorescent quantitative PCR primer set, and the monkey varicella virus in the sample to be tested is calculated according to the result.

[0040] In the present invention, the pMD19-T vector can be purchased through conventional channels. In a specific embodiment of the present invention, the pMD19-T vector is purchased from Takara Company with a product number of D102A.

[0041] The present invention uses the conserved region of DNA polymerase in the whole genome of monkey varicella virus type 9 as the target gene, designs conventional PCR primers, performs PCR amplification to obtain an amplified product, and the size of the amplified product is 558bp. The primers for conventional PCR amplification include an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is TACCTTGAACGTCACCTCGC (SEQ ID NO.4); the nucleotide sequence of the downstream primer is CTTGCGCACTGTTTCACTCC (SEQ ID NO.5). In the present invention, the amplification reaction system of the conventional PCR is preferably PrimeS, and the amplification reaction procedure of the conventional PCR is preferably pre-denaturation at 94°C for 2min, 94°C for 30s, 56°C for 30s, 72°C for 45s for a total of 30 cycles, and then extension at 72°C for 2min.

[0042] In the present invention, the accession number of the whole genome sequence of simian varicella virus type 9 is NC_002686 in the NCBI database. In the present invention, the nucleotide sequence of the target gene is (SEQ ID NO.6).

[0043] In the present invention, the amplified product obtained above was subjected to an "A" tailing reaction, and the reaction system was: 10*A-Tailing Buffer 5μL, A-Tailing Enzyme 0.5μL, dNTP Mixture 4μL, target gene DNA 10μL (>50ng / μL), ddH2O 0.5μL, total volume 50μL; reaction conditions were: 72℃ 20min, and then placed on ice for 2min. The A-tailed product was connected to the pMD19-T vector and transformed into E.coil DH5α competent cells were cultured on plates and colony PCR was performed to identify positive colonies. Positive colonies were amplified by shaking and positive recombinant plasmids were extracted. The concentration of positive recombinant plasmid DNA was determined by UV spectrophotometer. The DNA copy number was calculated according to the formula: copy number (copy / mL) = (Xg / ml) / (DNA base number × 660) × 6.02 × 10 23 .

[0044] In the present invention, the TaqMan fluorescent quantitative PCR amplification detection is performed on a dual-color (or more) fluorescent quantitative PCR instrument. In the present invention, the reaction system of the TaqMan fluorescent quantitative PCR amplification preferably includes 2×PremixEx Taq 10μL, fluorescent probe 0.8μL, upstream primer 0.4μL, downstream primer 0.4μL, DNA template 2μL, RNase FreeH2O 6.4μL in 20μL. The reaction program of the TaqMan fluorescent quantitative PCR amplification is preferably as follows: 95℃ 30s; 95℃ 5s, 60℃ 30s, 40 cycles. Three wells are set as no-template controls for each reaction. In the present invention, the probe detection mode of the TaqMan fluorescent quantitative PCR amplification preferably uses the FAM channel for detection, and the PCR reaction conditions are preferably: 95℃ 30s pre-denaturation; 95℃ 5s, 60℃ 30s, a total of 40 cycles. After the settings are completed, save the file and run the program.

[0045] In the present invention, the standard curve is preferably established by diluting the positive recombinant plasmid obtained above as a DNA standard to an initial concentration of 117 ng / μL, corresponding to a content of 10 11 The recombinant positive plasmid standard DNA was diluted 10 times using EASY Dilution as a template, with the contents of 1×10 11 -1×10 1Copies / μL. TaqMan fluorescence quantitative PCR reaction was performed according to the above system and conditions. Within the detection limit, the standard curve was generated according to the logarithm of the copy number and the Ct value in the reaction system. The fluorescence quantitative instrument was CFX96 (BIO-RAD, USA), and the amplification curve and standard curve were exported by Bio-Rad CFX Manager 3.1 software.

[0046] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0047] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0048] Example 1

[0049] 1. Primer design and synthesis

[0050] Refer to the whole genome sequence of simian varicella virus type 9 in the NCBI database (NC_002686), take the conserved DNA polymerase region of the whole genome of simian varicella virus type 9 as the target gene, design TaqMan fluorescent quantitative PCR upstream primers and downstream primers, design conventional PCR upstream primers and downstream primers, the primer sequences are as follows:

[0051] TaqMan fluorescence quantitative PCR upstream primer:

[0052] 5'-CACCTCGCAAAGCAGATTT-3' (SEQ ID NO. 1);

[0053] TaqMan fluorescent quantitative PCR downstream primers:

[0054] 5'-AATGTACGAGAGCGTATATCATATGT-3' (SEQ ID NO. 2);

[0055] TaqMan fluorescent quantitative PCR fluorescent probe:

[0056] 5'-FAM-TTTCAGCTTCGTTGGTTGGTGCTACTA-BHQ-3' (SEQ ID NO. 3).

[0057] Upstream primer for conventional PCR:

[0058] 5'-TACCTTGAACGTCACCTCGC-3' (SEQ ID NO. 4);

[0059] Downstream primers for conventional PCR:

[0060] 5'-CTTGCGCACTGTTTCACTCC-3' (SEQ ID NO. 5).

[0061] 2. Preparation of recombinant positive plasmid standards

[0062] Strictly follow the commercial virus DNA extraction kit (AxyPrep Body Fluid Viral DNA / RNA Miniprep Kit, Axygen, USA) to extract simian varicella virus DNA from non-human primate diseased monkey samples or virus isolation cultures. Using the extracted simian varicella virus DNA as a template, PCR amplification was performed using the above conventional PCR upstream primers and downstream primers, and 1.5% agarose gel electrophoresis was performed ( Figure 1 ), identify the fragments and purify them by gel excision. The obtained products were subjected to "A" tailing reaction, connected to pMD19-T vector and transformed into E.coil DH5α competent cells were cultured on plates and colony PCR was performed to identify positive colonies ( Figure 2 ). Positive colonies were amplified by shaking, and the recombinant positive plasmid was extracted and used as a standard. The concentration of plasmid DNA was determined by ultraviolet spectrophotometer. The DNA copy number was calculated according to the formula: copy number (copy / mL) = (Xg / ml) / (DNA base number × 660) × 6.02 × 10 23 Sterile water for injection was used as a negative control in the experiment.

[0063] according to Figure 1-2 It can be seen that the DNA sequence obtained using SVV DNA polymerase specific primers contains 558 bp ( Figure 1 ), the cloned gene fragment was connected to the T vector and transformed to obtain a 3250 bp recombinant positive plasmid standard DNA.

[0064] 3. Establishment of TaqMan fluorescence quantitative PCR detection method

[0065] Performed on a dual-color (or above) fluorescence quantitative PCR instrument. The optimal reaction system determined by the present invention includes, based on a total volume of 20 μL: 10 μL of 2×Premix Ex Taq, 0.8 μL of fluorescence probe, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 2 μL of DNA template, and 6.4 μL of RNase Free H2O. The optimal reaction program for TaqMan fluorescence quantitative PCR amplification is: 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, for 40 cycles. Each reaction is set with 3 wells as no-template controls. The FAM channel is used for detection, and the PCR reaction conditions are: pre-denaturation at 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, for a total of 40 cycles. After setting, save the file and run the program.

[0066] 4. Establishment of standard curve:

[0067] Dilute the recombinant positive plasmid standard obtained above to an initial concentration of 117 ng / μL, corresponding to a content of 10 11 copies / μL. Use EASY Dilution to perform 10-fold serial dilution of the recombinant positive plasmid standard DNA as a template, with contents of 1×10 11 -1×10 1 copies / μL, setting 11 gradients. Perform TaqMan fluorescence quantitative PCR reaction according to the above system and conditions. Within the detection limit range, generate a standard curve based on the logarithm of the copy number and the Ct value in the reaction system.

[0068] According to Figure 3-4 the results, after fluorescence quantitative PCR of the recombinant positive plasmid standard DNA diluted 10-fold, an amplification curve ( Figure 3 ) and a standard curve ( Figure 4 ) are obtained. The standard DNA shows good amplification curves within the range of 10 1 -10 11 copies / μL and has a good linear relationship. The standard curve equation is Y = -2.475X + 40.039 (R 2 = 1.000), and the amplification efficiency E = 153.5%. The determination of the qualitative results in the present invention is as follows: ① If the amplification curve of the detected sample has no logarithmic growth phase or the CT (threshold cycle) values of both probes are ≥ 40, it is negative; ② If the CT value of the detected sample is ≤ 38, the sample is determined to be SVV positive; ③ If 38 < CT value < 40 for the detected sample, the sample needs to be re-extracted and quantitatively detected for DNA.

[0069] Example 2

[0070] The selected pathogenic microorganisms include: experimental group: SVV strains were screened from clinical samples of the Laboratory Animal Department of the Institute of Medical Biology, Chinese Academy of Medical Sciences; control group: EB virus, HSV-1, HSV-2, VZV, CVA6, CVB1 strains were preserved and provided by the Laboratory Animal Department of the Institute of Medical Biology, Chinese Academy of Medical Sciences. The above virus DNA was extracted and stored at -80℃ for future use.

[0071] The obtained pathogenic microorganisms were detected using the primer set and detection method of TaqMan fluorescent quantitative PCR in Example 1. The virus detection results of the experimental group were positive, and the detection results of EB virus, HSV-1, HSV-2, VZV, CVA6, CVB1 strains, etc. in the control group were all negative, with a specificity of 100% ( Figure 5 ). To evaluate the stability of the method, 1×10 8 copies / μL, 1×10 6 copies / μL and 1×10 4 The recombinant positive plasmid standards with 3 concentrations were tested 4 times in each group. SPSS 23 software was used to perform statistical analysis on the fluorescence quantitative Ct values ​​of the 4 repetitions of the 3 concentrations of the recombinant positive plasmid standards, and the CV of the Ct value was calculated (see Table 1), showing good stability.

[0072] Table 1 Results of repeated experiments of simian varicella virus TaqMan fluorescence quantitative PCR

[0073]

[0074] Example 3

[0075] Tissues of a monkey that died of herpes caused by SVV infection in the wild were taken to extract viral DNA from various tissues, throat swabs, nasal swabs, blood, urine, cerebrospinal fluid, amniotic fluid, placenta, etc., and the monkey varicella virus was quantified using the primer set and detection method of TaqMan fluorescent quantitative PCR in Example 1.

[0076] The results of the test on the viral copy number of tissues of a monkey that died of spontaneous infection with SVV in the wild showed that after SVV infection, high viral loads were detected in the heart, liver, spleen, lung, kidney, and pancreas tissues of the rhesus monkeys, and they remained at a high level (10 5 ~10 5.5 copies / ml), and a lower viral load of 10 2.5 copies / ml, see Figure 6 . And the number of virus copies can be detected in samples such as throat swabs, nasal swabs, blood, urine, cerebrospinal fluid, amniotic fluid, and placenta.

[0077] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A TaqMan fluorescent quantitative PCR primer set for detecting monkey varicella virus, characterized in that: The primer set includes an upstream primer, a downstream primer and a fluorescent probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.

3.

2. The TaqMan fluorescent quantitative PCR primer set according to claim 1, characterized in that: The 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

3. A TaqMan fluorescent quantitative PCR kit for detecting monkey varicella virus, characterized in that: The kit contains the TaqMan fluorescent quantitative PCR primer set according to claim 1 or 2.

4. The TaqMan fluorescent quantitative PCR kit according to claim 3, characterized in that: The kit also includes TaqMan fluorescent quantitative PCR reaction solution Premix Ex Taq, a positive control substance and a negative control substance.

5. The TaqMan fluorescent quantitative PCR kit according to claim 4, characterized in that: The positive control substance is the pMD19-T vector plasmid containing monkey varicella virus; the negative control substance is sterile water for injection.

6. Use of the TaqMan fluorescent quantitative PCR primer set according to claim 1 or 2 or the TaqMan fluorescent quantitative PCR kit according to any one of claims 3 to 5 in the preparation of a product for detecting monkey varicella virus.

7. A TaqMan fluorescent quantitative PCR method for detecting monkey varicella virus for non-diagnostic purposes, characterized in that: The steps include: Target DNA was extracted from positive simian varicella virus samples, and the target gene was obtained by conventional PCR amplification using the extracted target DNA as a template; Connect the target gene to the pMD19-T vector to obtain a positive recombinant plasmid; The positive recombinant plasmid was used as a standard for serial dilution to establish a standard curve; Extract the DNA of the sample to be tested, use the extracted DNA as a template, and use the TaqMan fluorescent quantitative PCR primer set described in claim 1 or 2 to perform fluorescent quantitative PCR amplification, and calculate the monkey varicella virus in the sample to be tested based on the result.

8. The method according to claim 7, characterized in that The primers for conventional PCR amplification include an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

5.

9. The method according to claim 7, characterized in that: The reaction system of the fluorescent quantitative PCR amplification includes, in 20 μL, 10 μL of 2×Premix Ex Taq, 0.8 μL of fluorescent probe, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 2 μL of DNA template, and 6.4 μL of RNase Free H2O.

10. The method according to claim 7, characterized in that The reaction procedure of the fluorescent quantitative PCR amplification was as follows: 95°C for 30s; 95°C for 5s, 60°C for 30s, and 40 cycles.

Images