Polynucleotides, pharmaceutical compositions and uses thereof

Abstract

The invention discloses polynucleotide, a pharmaceutical composition and application of the polynucleotide. In the application, a plurality of polynucleotide sequences targeting the 3'untranslated region of the nuclear fiber layer protein A mutant mRNA are newly designed, the expression level of the nuclear fiber layer protein A mutant (such as premature protein) can be reduced in the Lamin AmRNA stage, and meanwhile, the normal transcription of Lamin C is not influenced, so that the toxic and side effects are lower; the compound has a wide prospect in the aspect of preventing or treating diseases (especially progeria) related to mutation of the nuclear fiber layer protein A.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to polynucleotides, pharmaceutical compositions and uses thereof. Background Art

[0002] Lamin A protein is part of the scaffold structure connecting the cell nucleus and plays an important role in the structure and function of the cell nucleus. It has been reported in the literature that Lamin A mutations can destroy peripheral chromatin with specific epigenetic and molecular characteristics, thereby causing the incorrect expression of genes that are usually expressed in other cell types, causing congenital diseases such as progeria, familial dilated cardiomyopathy, muscular dystrophy, and lipotrophy syndrome.

[0003] Hutchinson-Gilford Syndrome, also known as Hutchinson-Gilford Progeria syndrome (HGPS), is a rare and fatal genetic disease. According to statistics, one in every 4 to 8 million newborns suffers from progeria. Progeria is characterized by a body aging process that is 5 to 10 times faster than normal. The patient looks like an old man, and his organs also decline quickly, resulting in a decline in physiological functions. Symptoms include thin stature, hair loss, and late teething. Children with the disease generally only live to 7 to 20 years old, and most of them die from aging diseases such as cardiovascular disease.

[0004] Existing studies have documented the possible cause of progeria, which is caused by a mutation in the LMNA gene encoding lamin A, which results in a 150-nucleotide deletion in exon 11 containing the zinc metalloproteinase 24 (ZMPSTE24) cleavage site, preventing the farnesylated C-terminus of Lamin A from being properly cleaved, resulting in the production of permanently farnesylated progerin, which is also the cause of the gradual degeneration of cell structure and function in children with progeria. Gene mutations in ZMPSTE24 also lead to the formation of permanently farnesylated Lamin A proteins, causing similar aging symptoms.

[0005] Currently, there is only one drug approved worldwide for the treatment of progeria, Lonafarnib (trade name: Zokinvy). Lonafarnib is an oral farnesyl transferase inhibitor that participates in the protein isoprenylation modification process. By inhibiting the isoprenylation of progerin, Zokinvy can reduce the accumulation of progerin in the cell nucleus. However, clinical studies have shown that the drug cannot enable patients to achieve a normal lifespan and has serious safety issues. Therefore, there is still a need to develop safer and more effective drugs for the treatment of progeria in this field. Summary of the invention

[0006] The object of the present invention is to provide a polynucleotide.

[0007] Another object of the present invention is a pharmaceutical composition.

[0008] Another object of the present invention is the use of the above polynucleotide or pharmaceutical composition.

[0009] Another object of the present invention is a method for preventing and / or treating diseases associated with lamin A mutation.

[0010] In order to solve the above technical problems, the present invention provides an isolated polynucleotide in a first aspect, wherein the isolated polynucleotide comprises the following sequence or a polynucleotide fragment complementary to a fragment thereof:

[0011] (i) the sequence shown in SEQ ID NO: 11; and / or

[0012] (ii) A polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO: 11.

[0013] In some preferred embodiments, the isolated polynucleotide comprises a polynucleotide fragment complementary to the following sequence or a fragment thereof:

[0014] (i) the sequence shown in SEQ ID NO: 1; and / or

[0015] (ii) A polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO: 1.

[0016] In some preferred embodiments, the isolated polynucleotide comprises a polynucleotide fragment complementary to the following sequence or a fragment thereof:

[0017] (i) the sequence shown in SEQ ID NO: 10; and / or

[0018] (ii) A polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO: 10.

[0019] In some preferred embodiments, the isolated polynucleotide comprises at least one polynucleotide fragment selected from the group consisting of:

[0020] (i) a polynucleotide fragment as shown in SEQ ID NO: 2-9; and

[0021] (ii) a polynucleotide fragment having no less than 80% homology to SEQ ID NO: 2-9.

[0022] In some preferred embodiments, the isolated polynucleotide is selected from at least one of the following groups:

[0023] (i) a polynucleotide as shown in SEQ ID NO: 2-9; and

[0024] (ii) a polynucleotide having no less than 80% homology to SEQ ID NO: 2-9.

[0025] In some preferred embodiments, the isolated polynucleotide is a polynucleotide as shown in SEQ ID NO:5 or SEQ ID NO:7.

[0026] In some preferred embodiments, the length of the isolated polynucleotide is not less than 10 bp, further preferably not less than 15 bp, more preferably 18-22 bp, for example 20 bp.

[0027] In some preferred embodiments, the length of the isolated polynucleotide is no more than 100 bp.

[0028] The second aspect of the present invention provides a small nucleic acid molecule containing the polynucleotide described in the first aspect of the present invention, wherein the small nucleic acid molecule is siRNA, ASO, shRNA or miRNA.

[0029] The third aspect of the present invention provides a pharmaceutical composition, which comprises the polynucleotide described in the first aspect of the present invention or the small nucleic acid molecule described in the second aspect of the present invention, and a pharmaceutically acceptable carrier.

[0030] The fourth aspect of the present invention provides the use of the polynucleotide according to the first aspect of the present invention, or the small nucleic acid molecule according to the second aspect of the present invention, or the pharmaceutical composition according to the third aspect of the present invention, for:

[0031] (i) preventing and / or treating diseases associated with lamin A mutation;

[0032] (ii) preparing drugs for preventing and / or treating diseases associated with lamin A mutation;

[0033] (iii) reducing the expression level of a lamin A mutant (preferably reducing the expression level of a progerin protein);

[0034] (iv) reducing the number of senescence-positive cells; and / or

[0035] (v) Reduce the number of abnormal nuclear cells.

[0036] In some preferred embodiments, the lamin A mutation is a mutation in exon 11 and / or exon 12 of lamin A mRNA.

[0037] In some preferred embodiments, the lamin A mutation-related disease is a disease caused by mutations in exon 11 and / or 12 of lamin A mRNA.

[0038] In some preferred embodiments, the lamin A mutation-related disease is a disease caused by a mutation in lamin A mRNA at one or more positions selected from the following: c.1711; c.1713; c.1714; c.1718; c.1733; c.1744; c.1745; c.1748; c.1751; c.1756; c.1762; c.1772; c.1774; c.1786; c.1804; c.1821; c.1822;c.1824;c.1851;c.1868;c.1871;c.1892;c.1904;c.1916;c.1928;c.1930; c.1931; c.1940; c.1960; c.1961; c.1968; c.1968+1; c.1968+2; c.1968+5; and c.1975.

[0039] In some preferred embodiments, the lamin A mutation-related disease is a disease caused by one or more mutations in lamin A mRNA selected from the following: c.1711A>T; c.1713C>A; c.1714A>T; c.1714insCTGC; c.1718C>T; c.1733A>T; c.1744C>T; c.1745G>A; c.1748C>T; c.1751G>A; c.1756G>A; c.1762T>C; c.1772G>T; c.1774G>A; c.1786G>A; c.1804G>A; c.1821G>A; c.182 2G>A; c.1824C>T; c.1851C>T; c.1868C>G; c.1871G>A; c.1892G>A; c.1904G>A; c.1916A>G; c.1928C>A; c.1930C>T; c.1931G >A; c.1940T>G; c.1960C>T; c.1961dup; c.1968G>A; c.1968+1G>A; c.1968+2T>C; c.1968+5G>A; c.1968+5G>C; and c.1975dup.

[0040] In some preferred embodiments, the lamin A mutation-related disease is selected from at least one of dilated cardiomyopathy and conduction disorders (DCM-CD), muscular dystrophy, Charcot-Marie-Tooth disease type 2 (CMT2), familial lipodystrophy (FPLD), AStriated muscle laminopathy, progeroid syndrome, Emery-Dreyfus muscular dystrophy (EDMD), insulin resistance syndrome (IRS), progeria, limb-girdle muscular dystrophy (LGMD), congenital muscular dystrophy (L-CMD) and Werner's syndrome, preferably progeria.

[0041] A fifth aspect of the present invention provides a method for preventing and / or treating a disease associated with lamin A mutation, the method comprising the steps of:

[0042] A therapeutically effective amount of the polynucleotide according to the first aspect of the present invention, or the small nucleic acid molecule according to the second aspect of the present invention, or the pharmaceutical composition according to the third aspect of the present invention is administered to the subject.

[0043] The sixth aspect of the present invention provides a method for non-therapeutic in vitro (i) reducing the expression level of lamin A mutant, or (ii) reducing the number of senescence-positive cells, or (iii) reducing the number of abnormal nuclear cells, the method comprising the steps of:

[0044] The biological tissue is contacted with the polynucleotide according to the first aspect of the present invention in vitro non-therapeutically.

[0045] In some preferred embodiments, the biological tissue is a population of cardiomyocytes from patients with progeria.

[0046] Compared with the prior art, the present invention has at least the following advantages:

[0047] The present invention newly designs a variety of polynucleotide sequences targeting the 3' untranslated region of lamin A mutant mRNA, which can reduce the expression level of lamin A mutant (such as progerin) at the Lamin A mRNA stage without affecting the normal transcription of Lamin C. Therefore, the toxic side effects are lower, and the method has broad prospects for preventing or treating diseases related to lamin A mutation (especially progeria).

[0048] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] One or more embodiments are exemplarily described by the pictures in the corresponding drawings, and these exemplary descriptions do not constitute limitations on the embodiments.

[0050] Figure 1 is a schematic diagram of the genotype identification results of HGPS children according to an embodiment of the present invention;

[0051] Figure 2 This is a schematic diagram of detecting the progerin expression level in fibroblasts of children by qRT-PCR according to an embodiment of the present invention;

[0052] Figure 3 is a diagram of PBMC reprogramming pattern according to an embodiment of the present invention;

[0053] Figure 4 is a schematic diagram of detecting iPSCs cell phenotype by IFA according to an embodiment of the present invention, ns, indicates P>0.05; *, indicates P<0.05; ***, indicates P<0.001;

[0054] Figure 5 is a schematic diagram of the myocardial cell differentiation process according to an embodiment of the present invention;

[0055] Figure 6 is a graph showing the mRNA expression levels of genes related to myocardial differentiation at different stages detected by qRT-PCR according to an embodiment of the present invention;

[0056] Figure 7 This is a result diagram of IFA detection of cTnT (observation of myocardial fiber length) on the 11th day of myocardial differentiation according to an embodiment of the present invention;

[0057] Figure 8 This is a result diagram of Lamin A / C (karyotype observation) on the 11th day of myocardial differentiation detected by IFA according to an embodiment of the present invention;

[0058] Fig. 9 is a schematic diagram of the myocardial cell passage process according to an embodiment of the present invention;

[0059] Fig.10 3. The morphological diagram of myocardial cells of different generations observed by bright field microscope according to an embodiment of the present invention;

[0060] Fig.11: SA-β-Gal senescence staining diagram of cardiomyocytes of different passages according to an embodiment of the present invention, the percentage value represents the positive rate of senescence staining cells, and P (Passage) represents the number of passages;

[0061] Fig.12 1 is a schematic diagram of detecting cTnT (observing myocardial fiber length) of different batches of myocardial passages by IFA according to an embodiment of the present invention, where P (Passage) represents the number of passages;

[0062] Fig.13 1 is a schematic diagram of IFA detection of Lamin A / C (observation of karyotype) of different batches of myocardial passages according to an embodiment of the present invention, where P (Passage) represents the number of passages;

[0063] Fig.14 Schematic diagram of the design of ASO targeting progerin gamper form according to an embodiment of the present invention;

[0064] Fig.15 is a graph showing the effect of transfection of ASO_U5-U8 on the expression of progerin mRNA in c.1822G>A cardiomyocytes according to qRT-PCR detection in an embodiment of the present invention, ***, indicates P<0.001;

[0065] Fig.16 is a graph showing the effect of transfection of ASO_U5-U8 on the expression of progerin mRNA in c.1824C>T cardiomyocytes according to qRT-PCR detection in an embodiment of the present invention, ***, indicates P<0.001;

[0066] Fig.17 is a graph showing the effect of the dose of transfected ASO_U7 and U9 on the expression of progerin mRNA in c.1822G>A cardiomyocytes detected by qRT-PCR in an embodiment of the present invention, ***, indicating P<0.001;

[0067] Fig.18 is a graph showing the effect of the dose of transfected ASO_U7 and U9 on the expression of progerin mRNA in c.1824C>T cardiomyocytes detected by qRT-PCR according to an embodiment of the present invention, ***, indicating P<0.001;

[0068] Fig.19 This is a graph showing the effect of the dose of transfected ASO_U7 and U9 on the expression of progerin protein in c.1822G>A cardiomyocytes detected by Western blot according to an embodiment of the present invention;

[0069] Fig. 20This is a graph showing the effect of the dose of transfected ASO_U7 and U9 on the expression of progerin protein in c.1824C>T cardiomyocytes detected by Western blot according to an embodiment of the present invention;

[0070] Fig.21 According to an embodiment of the present invention, IFA detected the effects of ASO U7 and U9 on myocardial fibers and karyotypes of classic c.1824C>T and non-classical c.1822G>A (MNA / C staining method);

[0071] Fig. 22 According to the embodiment of the present invention, IFA detected the effects of ASO U7 and U9 on the myocardial fibers and karyotypes of the classical c.1824C>T and the non-classical c.1822G>A (cTnT staining method);

[0072] Fig.23 This is a diagram of SA-β-Gal cell senescence staining according to an embodiment of the present invention;

[0073] Fig.24 is a statistical diagram of the proportion of abnormal nuclei in myocardial cells according to an embodiment of the present invention, ***, indicates P<0.001;

[0074] Fig.25 It is the statistics of the proportion of SA-β-Gal positive cells according to the embodiment of the present invention; ***, indicates P<0.001.

[0075] Fig.26 : is a graph showing the effect of subcutaneous injection of ASO_U7 and U9 on the expression of progerin mRNA in the heart of G608G progeria mice detected by qRT-PCR in an embodiment of the present invention, wherein the three bars in the abscissa PBS, U7 and U9 represent LMNA, LMNC and progerin respectively, ***, indicating P<0.001;

[0076] Fig. 27 : is a graph showing the effect of subcutaneous injection of ASO_U7 and U9 on the expression of progerin mRNA in the liver of G608G premature aging mice according to qRT-PCR detection in an embodiment of the present invention, wherein the three bars in the abscissa PBS, U7 and U9 represent LMNA, LMNC and progerin respectively, ***, indicating P<0.001;

[0077] Fig.28 This is a diagram showing the effect of subcutaneous injection of ASO_U7 and U9 on the expression of cardiac progerin protein in G608G premature aging mice according to Western blot detection in an embodiment of the present invention;

[0078] Fig.29This is a diagram showing the effect of subcutaneous injection of ASO_U7 and U9 on the expression of progerin protein in the liver of G608G premature aging mice detected by Western blot according to an embodiment of the present invention;

[0079] Fig.30 The ELISA method was used to detect the effect of subcutaneous injection of ASO_U7 and U9 on the expression of alanine aminotransferase, i.e., alanine aminotransferase (ALT), in the liver of G608G premature aging mice. The two bars in the horizontal axis PBS, U7 and U9 represent Male and Female respectively;

[0080] Fig.31 The ELISA method was used to detect the effect of subcutaneous injection of ASO_U7 and U9 on the expression of aspartate aminotransferase, i.e., aspartate aminotransferase (AST), in the liver of G608G premature aging mice. The two bars in the horizontal axis PBS, U7, and U9 represent Male and Female respectively;

[0081] Fig.32 The effect of subcutaneous injection of ASO_U7 and U9 on the expression of uric acid (UA) in the kidneys of G608G premature aging mice was detected by ELISA method. The two bars in the horizontal axis PBS, U7 and U9 represent Male and Female respectively;

[0082] Fig.33 The effect of subcutaneous injection of ASO_U7 and U9 on the expression of creatinine (Crea) in the kidneys of G608G premature aging mice was detected by ELISA method. The two bars in the horizontal axis PBS, U7 and U9 represent Male and Female respectively;

[0083] Fig.34 The ELISA method was used to detect the effect of subcutaneous injection of ASO_U7 and U9 on the expression of urea nitrogen (Urea) in the kidneys of G608G premature aging mice. The two bars in the horizontal axis PBS, U7 and U9 represent Male and Female respectively. DETAILED DESCRIPTION

[0084] LMNA gene mutations can lead to abnormal shearing of pre-Lamin A mRNA, resulting in the accumulation of lamin A mutants (such as progerin or other Lamin A mutants), causing congenital diseases such as progeria, familial dilated cardiomyopathy, muscular dystrophy, and lipoatrophy syndrome. The inventors found in their research that while Lamin A mRNA was reduced in mice, the level of Lamin C mRNA was retained, and all indicators of the mice were normal, and no abnormal symptoms occurred. Therefore, Lamin C can partially compensate for the function of Lamin A in cells. In particular, in tissues where Lamin A is normally expressed at a relatively low level, such as brain tissue, the main form of Lamin C is present. Therefore, reducing the expression of Lamin A mutants will not affect the level of Lamin C, will not affect the normal function of brain tissue, and will improve the symptoms and development of the disease.

[0085] On the basis of the above findings, the inventors have designed a variety of antisense oligonucleotide sequences targeting the 3' untranslated region of lamin A mutant mRNA (such as presenilin mRNA) through extensive and in-depth research, which can reduce the expression of lamin A mutants at the Lamin A mRNA stage, and therefore can be used to prevent or treat various diseases directly or indirectly caused by lamin A mutations, such as dilated cardiomyopathy and conduction disorders, muscular dystrophy, Charcot-Marie-Tooth disease type 2, familial lipodystrophy, rhabdomyosarcoma, progeroid syndrome, Emery-Dreyfus muscular dystrophy, insulin resistance syndrome, progeria, limb-girdle muscular dystrophy, congenital muscular dystrophy and Werner syndrome, etc., while not affecting the level of Lamin C, improving safety. In a preferred example of the present invention, the newly designed antisense oligonucleotide sequence of the present invention can reduce the expression of presenilin, significantly inhibit the occurrence of premature aging, and does not affect the level of Lamin C, and does not affect the normal function of brain tissue. Compared with previous treatments, such as Zokinvy and other methods of reducing Lamin A mutants, it has higher safety and shows great promise as a drug for preventing or treating progeria.

[0086] Polynucleotide

[0087] The present invention relates to polynucleotides. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or artificially synthesized DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand. The polynucleotides of the present invention are designed to include polynucleotide fragments complementary to the target gene or its fragments. As used herein, the term "a certain polynucleotide / gene includes an X gene fragment" means that in addition to the X gene sequence, other polynucleotide fragments / gene fragments / bases are provided before and / or after the X gene sequence in the entire polynucleotide sequence / gene sequence, for example, the polynucleotide sequence ATCG-X-CCTC includes the X gene as a fragment, and the sequence also includes other fragments such as ATCG and CCTC.

[0088] As used herein, the term "polynucleotide fragment" or "fragment" or "gene fragment" refers to a partial sequence of the polynucleotide / gene, that is, the fragment sequence of the polynucleotide should be the same as the original polynucleotide portion. For example, the original polynucleotide sequence is AAAGGGTTT, and the polynucleotide sequence can be any of AAAGGG, AAAG, AGGGTTT, etc.

[0089] As used herein, the term "gene is within XX" refers to a gene sequence that is a gene sequence in the XXX region or a partial fragment thereof. In one embodiment of the present invention, the target gene is within the 3' untranslated region (3'UTR) of lamin A mRNA or lamin mutant mRNA (e.g., presenilin mRNA), that is, the target gene is the 3' untranslated region (3'UTR) of lamin A mRNA or a partial fragment thereof, or the target gene is the 3' untranslated region (3'UTR) of lamin mutant mRNA or a partial fragment thereof. In one embodiment of the present invention, the target gene is (i) a sequence as shown in SEQ ID NO: 11; and / or (ii) a polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides of the sequence shown in SEQ ID NO: 11. In one embodiment of the present invention, the target gene is within the sequence as shown in SEQ ID NO: 11.

[0090] As used in the present invention, the term "mutation" refers to the substitution, deletion and / or addition of one or more amino acids in an amino acid sequence, or the substitution, deletion and / or addition of one or more polynucleotides in a polynucleotide sequence. As used in the present invention, the term "mutant" refers to an amino acid sequence obtained by mutation of the amino acid sequence of a certain protein at any position, or an amino acid sequence obtained by translation of the mRNA of a mutated protein. In the present invention, "lamin A mutant" refers to an amino acid sequence obtained by substitution, deletion and / or addition of one or more amino acids at any position in the amino acid sequence of lamin, or an amino acid sequence obtained by translation of mutated lamin A mRNA. In a preferred embodiment of the present invention, "lamin A mutant" is an amino acid sequence obtained by translation of a sequence obtained by mutation of lamin A mRNA in exons 11 and / or 12. In a preferred embodiment of the present invention, "lamin A mutant" is a lamin A. The amino acid sequence obtained by translating the sequence obtained by mutation of one or more positions selected from the following mRNAs: c.1711; c.1713; c.1714; c.1718; c.1733; c.1744; c.1745; c.1748; c.1751; c.1756; c.1762; c.1772; c.1774; c.1786; c.1804; c. 1821;c.1822;c.1824;c.1851;c.1868;c.1871;c.1892;c.1904;c.1916;c.1928;c.19 30; c.1931; c.1940; c.1960; c.1961; c.1968; c.1968+1; c.1968+2; c.1968+5; and c.1975. In a preferred embodiment of the present invention, the "lamin A mutant" is an amino acid sequence obtained by translating the sequence obtained by mutation of one or more positions selected from the following positions of lamin A mRNA: c 1821; c.1822; c.1824; c.1968; c.1968+1; c.1968+1G>A; c1968+2; C1968+2; c.1968+5; and C.1968+5, and one or more mutations selected from these positions will lead to diseases associated with progerin.

[0091] As used herein, the terms "presenilin," "progerin," and "progerin" are used interchangeably.

[0092] In a preferred embodiment of the present invention, the "lamin A mutant" is an amino acid sequence obtained by translating the sequence obtained by lamin A mRNA undergoing one or more mutations selected from the following: c.1711A>T; c.1713C>A; c.1714A>T; c.1714insCTGC; c.1718C>T; c.1733A>T; c.1744C>T; c.1745G>A; c.1748C>T; c.1751G>A; c.1756G>A; c.1762T>C; c.1772G>T; c.1774G>A; c.1786G>A; c.1804G>A; c.1821G>A; c .1822G>A; c.1824C>T; c.1851C>T; c.1868C>G; c.1871G>A; c.1892G>A; c.1904G>A; c.1916A>G; c.1928C>A; c.1930C>T; c.193 1G>A; c.1940T>G; c.1960C>T; c.1961dup; c.1968G>A; c.1968+1G>A; c.1968+2T>C; c.1968+5G>A; c.1968+5G>C; and c.1975dup. In a preferred embodiment of the present invention, the "lamin A mutant" is an amino acid sequence obtained by translating the sequence obtained by lamin A mRNA undergoing one or more mutations selected from the following: c 1821G>A; c.1822G>A; c.1824C>T; c.1968G>A; c.1968+1G>C; c.1968+1G>A; c1968+2T>C; C1968+2T>A; c.1968+5G>A; and C.1968+5G>C.

[0093] In a preferred embodiment of the present invention, the target gene is (i) the sequence shown in SEQ ID NO: 1; and / or (ii) a polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO: 1.

[0094] In a more preferred embodiment of the present invention, the target gene is (i) a sequence as shown in SEQ ID NO: 10; and / or (ii) a polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides of the sequence as shown in SEQ ID NO: 10. The polynucleotide designed by targeting the sequence as shown in SEQ ID NO: 10 more significantly reduces the expression of lamin A mutant (preferably presenilin) ​​mRNA and protein.

[0095] As used herein, the terms "sequence complement" and "reverse sequence complement" are used interchangeably and refer to a sequence that is in the opposite direction to the original polynucleotide sequence and is complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is ACTGAAC, its reverse complementary sequence is GTTCAGT. In one embodiment of the present invention, the polynucleotide sequence is reverse complementary to the sequence shown in SEQ ID NO: 1. In one embodiment of the present invention, the polynucleotide sequence is reverse complementary to the sequence shown in a fragment of SEQ ID NO: 1. In one embodiment of the present invention, the polynucleotide sequence is reverse complementary to a polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO: 1. In one embodiment of the present invention, the polynucleotide sequence is reverse complementary to a fragment of a polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO: 1. In one embodiment of the present invention, the polynucleotide sequence is reverse complementary to the sequence shown in SEQ ID NO: 10. In one embodiment of the present invention, the polynucleotide sequence is reverse complementary to the sequence shown in a fragment of SEQ ID NO: 10. In one embodiment of the present invention, the polynucleotide sequence is reversely complementary to a polynucleotide sequence formed by substitution, deletion or addition of one or several nucleotides of the sequence shown in SEQ ID NO: 10. In one embodiment of the present invention, the polynucleotide sequence is reversely complementary to a fragment of a polynucleotide sequence formed by substitution, deletion or addition of one or several nucleotides of the sequence shown in SEQ ID NO: 10.

[0096] In a preferred embodiment of the present invention, the polynucleotide comprises at least one polynucleotide fragment selected from the following groups: (i) a polynucleotide fragment as shown in SEQ ID NO:2-9; and (ii) a polynucleotide fragment having a homology of not less than 80% (preferably not less than 90%, more preferably not less than 95%, more preferably not less than 98%, and more preferably not less than 99%) to SEQ ID NO:2-9.

[0097] In another preferred embodiment of the present invention, the polynucleotide is selected from at least one of the following groups: (i) a polynucleotide as shown in SEQ ID NO: 2-9; and (ii) a polynucleotide having a homology of not less than 80% (preferably not less than 90%, more preferably not less than 95%, more preferably not less than 98%, and more preferably not less than 99%) to SEQ ID NO: 2-9.

[0098] In another preferred embodiment of the present invention, the polynucleotide is at least one selected from the following groups: (i) a polynucleotide as shown in SEQ ID NO: 3-7; and (ii) a polynucleotide having a homology of not less than 80% (preferably not less than 90%, more preferably not less than 95%, more preferably not less than 98%, more preferably not less than 99%) to SEQ ID NO: 3-7. Compared with other polynucleotide sequences, these polynucleotide sequences have higher knockdown efficiency for lamin A mutant (preferably presenilin) ​​mRNA and lamin A mutant.

[0099] In another preferred embodiment of the present invention, the polynucleotide is a polynucleotide as shown in SEQ ID NO: 5; or a polynucleotide as shown in SEQ ID NO: 7. The polynucleotides shown in SEQ ID NO: 5 and 7 have good specificity and low toxicity, and reduce the expression of progerin mRNA and protein in cardiomyocytes by at least 50% (preferably 70% or more, and more preferably 80% or more) without targeting other genomes, and are suitable for subsequent human trials.

[0100] In the present invention, polynucleotides are preferably provided in an isolated form, more preferably purified to homogeneity. As used herein, the term "isolated" refers to a nucleic acid separated from at least one other component (e.g., nucleic acid) present in the nucleic acid's natural source. In one embodiment, the nucleic acid is found only in the presence of (if any) solvents, buffers, ions or other components normally present in its solution. The terms "isolated" and "purified" do not include nucleic acids present in their natural sources.

[0101] As used herein, the terms "homology" and "identity" are used interchangeably and refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be measured by the following method. The nucleotide or amino acid sequence of the polynucleotide or polypeptide is arranged, and the number of positions containing the same nucleotide or amino acid residue in the arranged polynucleotide or polypeptide is scored and compared with the number of positions containing different nucleotides or amino acid residues in the arranged polynucleotide or polypeptide. The polynucleotide can be different in one position, for example, according to the presence of different nucleotides (i.e., substitutions or variations) or nucleotide deletions (i.e., insertion or deletion of one or two nucleotides in the polynucleotide). The polypeptide can be different in one position, for example, by containing an amino acid (i.e., substitutions or variations) or an amino acid deletion (i.e., insertion of an amino acid or amino acid deletion in one or two polypeptides). The sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and then multiplying by 100.

[0102] In the present invention, the above-mentioned polynucleotide or its fragment can be prepared using conventional methods in the art. For example, it can be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the disclosed relevant nucleotide sequences, especially the open reading frame sequences, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified each time together in the correct order. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombination. This is usually done by cloning it into a vector, then transferring it into a cell, and then isolating the relevant sequence from the host cell after proliferation by conventional methods. Artificial synthesis of the relevant sequence is particularly suitable for when the fragment length is short. Usually, a fragment with a very long sequence can be obtained by first synthesizing a plurality of small fragments and then connecting them.

[0103] The length of the polynucleotide in the present invention is preferably not less than 10 bp, more preferably not less than 15 bp, more preferably 18-22 bp, for example 20 bp, and the best effect is achieved when the length is 20 bp.

[0104] Small nucleic acid molecules

[0105] The present invention also relates to small nucleic acid molecules comprising the above polynucleotides, wherein the small nucleic acid molecules are siRNA, ASO, shRNA or miRNA, preferably ASO.

[0106] As used herein, the term "antisense oligonucleotide" or "ASO (antisense oligonucleotide)" refers to a polynucleotide or fragment thereof complementary to a specific target gene according to the principle of base complementarity to inhibit or block the expression of a specific target gene, and the target gene can be a DNA or RNA sequence. In order to enhance the stability, targeting, and improve metabolic capacity of antisense oligonucleotides, the antisense oligonucleotides herein may also include chemical modifications, such as modification of the oxygen atom of the phosphate bond by phosphorothioate, modification of the 2' position of the ribose by alkyl (e.g., methyl), LNA modification, etc. In order to promote the entry of ASO into cells or improve the targeting of ASO to organs or tissues in vivo, the antisense oligonucleotides herein may also include terminal Chol and GalNAc modifications. The front end and / or rear end of the polynucleotide or fragment thereof complementary to the target gene in the antisense oligonucleotides herein may optionally include 1-5 (more preferably 3-5) short sequences of arbitrary bases, and the bases in these short sequences are preferably chemically modified. Those skilled in the art can obtain the antisense oligonucleotides of the present invention by conventional methods in the art, such as chemical synthesis.

[0107] As used herein, the term "siRNA" (Small interfering RNA, siRNA) refers to a small RNA molecule (about 21-25 nucleotides), which can be processed by Dicer (an enzyme in the RNase III family that is specific to double-stranded RNA) from its precursor (such as dsRNA, shRNA, etc.), or can be synthesized by chemical methods or produced by other protein processing. siRNA is a major member of siRISC, which stimulates the rapid cleavage and degradation of target RNA with complementary sequence, resulting in the silencing of target genes, and thus becomes a key functional molecule in RNAi. Given a specific gene target sequence, those skilled in the art can design and obtain siRNA targeting the target sequence by conventional methods.

[0108] As used herein, the term "miRNA" (microRNA) is a class of non-coding single-stranded RNA molecules with a length of about 20-24 nucleotides encoded by endogenous genes, which participate in the expression regulation of a large number of genes in animals and plants. So far, more than 4,000 miRNA molecules have been found in animals, plants and viruses. Most miRNA genes exist in the genome in the form of single copies, multiple copies or gene clusters. Each miRNA can regulate multiple target genes, and several miRNAs can also participate in the regulation of the same gene together to form a complex regulatory network. It is speculated that miRNA regulates the expression of more than half of human genes. There are many forms of miRNA, the most primitive of which is pri-miRNA; after pri-miRNA is processed by Drosha, it becomes pre-miRNA, i.e., miRNA precursor, with a length of about 50-90 nucleotides; after pre-miRNA is cleaved by Dicer enzyme, it becomes a mature miRNA of about 20-24 nucleotides. MiRNA mainly inhibits the expression of target genes by inhibiting translation and accelerating the deadenylation of mRNA, and its mechanism is different from siRNA-mediated mRNA degradation.

[0109] One way to produce "small interfering RNA" (siRNA) in vivo is to clone the siRNA sequence into a plasmid vector as part of a "short hairpin". When delivered into an animal, the hairpin sequence is expressed to form a "double-stranded RNA" (shRNA) with a top loop structure, which is recognized and processed by the Dicer protein in the cell to produce a functional siRNA.

[0110] As used herein, a precursor is used as a special shRNA constructed as a backbone. The shRNA is composed of, from the 5′ end to the 3′ end, (a) a 5′ end flanking sequence region; (b) a 5′ end pairing siRNA region; (c) a top loop region; (d) a 3′ end pairing siRNA region, and the 5′ end pairing siRNA region and the 3′ end pairing siRNA region form a double-stranded region; (e) a 3′ end flanking sequence region; the shRNA produces siRNA, and the nucleotide sequence of the siRNA corresponds to the 3′ end pairing siRNA region or the 5′ end pairing siRNA region.

[0111] In a broad sense, shRNA is the abbreviation of short hairpin RNA, i.e., "short hairpin RNA". shRNA consists of two short reverse complementary sequences separated by a top loop sequence in the middle, forming a hairpin structure. The transcription is usually controlled by the endogenous RNA polymerase III promoter of the cell, and 5-6 Ts are connected to the end of the shRNA sequence as the transcription terminator of RNA polymerase III. shRNA can also be transcribed by the promoter of other RNA polymerases.

[0112] Pharmaceutical composition

[0113] The present invention also relates to a pharmaceutical composition containing the polynucleotide of the present invention. The pharmaceutical composition of the present invention includes the polynucleotide of the present invention and a pharmaceutically acceptable carrier. In order to better enable the polynucleotide of the present invention to be accurately delivered to a specific part of a subject, or to improve the bioavailability of the polynucleotide of the present invention relative to the subject, or to reduce the toxicity of the polynucleotide of the present invention relative to the subject, the pharmaceutically acceptable carrier may optionally be a liposome, a lipid nanoparticle (LNP, lipid nanoparticle), protamine, a high molecular polymer (such as polyethyleneimine), an inorganic nanoparticle, an exosome, a polymer matrix, etc.

[0114] In some other preferred embodiments of the present invention, the pharmaceutical composition comprises: the polynucleotide of the present invention and a lipid nanoparticle shell wrapped thereon. Preferably, the lipid nanoparticle shell is composed of at least one selected from PEG lipids, cholesterol, ionizable cationic lipids, and auxiliary lipids. To increase targeting, the lipid nanoparticle shell may be optionally modified with a surface modifier.

[0115] In some other preferred embodiments of the present invention, the polynucleotide sequence is conjugated with asialoglycoprotein receptor ligand (GalNAc) to form GalNac-X, wherein X represents the polynucleotide of the present invention.

[0116] Use or indications

[0117] The present invention also relates to the use of polynucleotides or pharmaceutical compositions for (i) preventing and / or treating diseases associated with lamin A mutations; (ii) preparing drugs for preventing and / or treating diseases associated with lamin A mutations; (iii) reducing the expression level of lamin A mutants; (iv) reducing the number of senescence-positive cells; and / or (v) reducing the number of abnormal nuclear cells.

[0118] In the present invention, any mRNA sequence that can specifically bind to the polynucleotide sequence of the present invention can be cleaved by RNase H1, resulting in a decrease in the protein expression level obtained by translating the mRNA sequence. Therefore, the polynucleotide sequence of the present invention targets the 3'UTR region of the lamin A mutant mRNA, degrades the lamin A mutant mRNA, and thus reduces the expression level of the lamin A mutant, thereby being able to treat diseases associated with lamin A mutations.

[0119] As used in the present invention, the term "lamin A mutation-related disease" may include any disease directly or indirectly caused by lamin A or lamin A mRNA mutation. Preferably, lamin A mutation is a mutation of lamin A mRNA in exon 11 and / or 12. Lamin A mutation-related diseases are preferably diseases caused by lamin A mRNA mutation in exon 11 and / or 12. In a preferred embodiment of the present invention, "lamin A mutation-related diseases" are diseases caused by lamin A mRNA mutation in exon 11 and / or 12. Diseases caused by mutations in one or more positions of mRNA selected from the group consisting of: c.1711; c.1713; c.1714; c.1718; c.1733; c.1744; c.1745; c.1748; c.1751; c.1756; c.1762; c.1772; c.1774; c.1786; c.1804; c.1821; The positions of the aforementioned mutations can be found on the website http: / / www.umd.be / LMNA / In a preferred embodiment of the present invention, "lamin A mutation-related diseases" are diseases caused by one or more mutations in lamin A mRNA selected from the following: c.1711A>T; c.1713C>A; c.1714A>T; c.1714insCTGC; c.1718C>T; c.1733A>T; c.1744C>T; c.1745G>A; c.1748C>T; c.1751G>A; c.1756G>A; c.1762T>C; c.1772G>T; c.1774G>A; c.1786G>A; c.1804G>A; c.1821G>A; c.182 2G>A; c.1824C>T; c.1851C>T; c.1868C>G; c.1871G>A; c.1892G>A; c.1904G>A; c.1916A>G; c.1928C>A; c.1930C>T; c.1931G >A; c.1940T>G; c.1960C>T; c.1961dup; c.1968G>A; c.1968+1G>A; c.1968+2T>C; c.1968+5G>A; c.1968+5G>C; and c.1975dup. Exemplarily, the disease associated with lamin A mutation is selected from at least one of the lamin A mutation-associated diseases selected from dilated cardiomyopathy and conduction disorders, muscular dystrophy, Charcot-Marie-Tooth disease type 2, familial lipodystrophy, rhabdomyosarcoma, progeroid syndrome, Emery-Dreyfus muscular dystrophy, insulin resistance syndrome, progeria, limb-girdle muscular dystrophy, congenital muscular dystrophy and Werner syndrome, preferably progeria.

[0120] Treatment

[0121] The present invention also relates to a method for preventing and / or treating a lamin A mutation-related disease, comprising the steps of administering a therapeutically effective amount of the polynucleotide of the present invention or the pharmaceutical composition of the present invention to a subject. As a mode of administration, the polynucleotide of the present invention can be directly administered to a subject as an ASO, or can be administered to a subject in the form of a pharmaceutical composition.

[0122] As used herein, the term "subject" is defined herein to include animals, such as mammals, including, but not limited to, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, etc. In a specific embodiment, the subject is a human.

[0123] As used herein, the term "therapeutically effective amount" refers to the amount of active ingredient sufficient to provide a therapeutic effect in the treatment or control of a disease or disorder, or sufficient to delay or minimize one or more symptoms associated with the disease or disorder. The therapeutically effective amount of a compound refers to the amount of a therapeutic agent that can provide a therapeutic effect in the treatment or control of a disease or disorder when used alone or in combination with other therapies. The term "therapeutically effective amount" may include an amount that improves overall therapy, reduces or avoids symptoms or causes of a disease or disorder, or enhances the therapeutic efficacy of another therapeutic agent. In a preferred embodiment of the present invention, the dosage of the polynucleotide or pharmaceutical composition of the present invention is preferably 1 to 500 mg / kg (the subject is a human), for example 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / g / kg, 4.5mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, .6mg / kg, 7mg / kg, 8mg / kg, 9mg / kg, 10mg / kg, 20mg / kg, 30mg / kg, 40mg / kg, 50mg / kg or 100mg / kg. When the subject is other non-human mammals, the corresponding dosage can be obtained according to the dosage conversion method well known in the art.

[0124] The dosage of the polynucleotide or pharmaceutical composition of the present invention is preferably 1 to 500 mg / kg (the subject is a mouse), for example 10 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg or 100 mg / kg.

[0125] As used herein, the term "treat" refers to eradicating or ameliorating a disease or condition, or one or more symptoms associated with the disease or condition. In one embodiment, such symptoms are known to those skilled in the art to be associated with the disease or condition to be treated. In specific embodiments, the term refers to minimizing the spread or worsening of a disease or condition by administering one or more preventive or therapeutic agents to a subject suffering from the disease or condition. In some embodiments, the term refers to administering a polynucleotide of the present invention, in combination with or without other additional active agents, after the onset of symptoms of a particular disease.

[0126] As used herein, the term "prevention" refers to the prevention of a disease or condition, or the onset, recurrence or spread of one or more symptoms associated with the disease or condition. In one embodiment, it is known to those skilled in the art that such symptoms are associated with the disease or condition to be prevented. In a specific embodiment, the term refers to the use of the polynucleotides provided herein in conjunction with or without other additional active agents before the onset of symptoms for patients with a risk of suffering from a disease or disorder described herein. The term includes the suppression and reduction of the symptoms of a particular disease. In a specific embodiment, patients with a family history of a disease are specifically selected as candidates. In addition, patients with a history of recurrent symptoms are also potential candidates for prevention. In this regard, the term "prevention" can be used interchangeably with the term "preventive treatment".

[0127] The administration route of the polynucleotide or pharmaceutical composition of the present invention is not limited, and is preferably intramuscular, subcutaneous, oral, intravenous, cutaneous, intramucosal (eg, enteral), intranasal or intraperitoneal.

[0128] The administration frequency of the polynucleotide or pharmaceutical composition of the present invention is preferably once a day, twice a day, three times a day, once every two days, once every three days, once every five days, once every week, twice every week, once every month, twice every month, three times every month, once every two months, once every three months, once every four months, once every five months, once every six months or once every year.

[0129] Other in vitro application methods

[0130] The present invention also relates to a method for non-therapeutic in vitro (i) reducing the expression level of lamin A mutants, or (ii) reducing the number of senescence-positive cells, or (iii) reducing the number of abnormal nuclear cells, comprising the step of non-therapeutic in vitro contacting biological tissues with the polynucleotides of the present invention. As non-therapeutic application examples, it can be applied to scientific research and laboratory drug screening.

[0131] In some preferred embodiments, the biological tissue is a myocardial cell group of a progeria patient. In one embodiment of the present invention, when the polynucleotide of the present invention is used to contact a myocardial cell group of a progeria patient in vitro, the expression level of lamin A mutant (e.g., progerin) is significantly reduced. In one embodiment of the present invention, when the polynucleotide of the present invention is used to contact a myocardial cell group of a progeria patient in vitro, the number of senescence-positive cells is significantly reduced. In one embodiment of the present invention, when the polynucleotide of the present invention is used to contact a myocardial cell group of a progeria patient in vitro, the number of malformed nuclear cells is significantly reduced. In one embodiment of the present invention, when the polynucleotide of the present invention is used to contact a myocardial cell group of a progeria patient in vitro, the expression level of progerin is significantly reduced.

[0132] To make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified.

[0133] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by ordinary technicians in the technical field to which the application belongs. It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present application.

[0134] Example 1

[0135] Identification of multi-genotype HGPS genotypes and acquisition of reprogrammed iPSCs

[0136] After collecting and isolating PBMC from HGPS children, DNA was extracted, LMNA and ZMPSTE24 genes were amplified, and the pathogenic genotype of the children was determined by comparing with the normal human genome. Most children had the classic HGPS genotype (c.1824C>T), and some non-classic LMNA mutation HGPS were also detected, such as c.1579C>T, c.1822G>A and c.168C>G, and ZMPSTE24 mutation c.469C>T ( Figure 1 ). The expression of progerin mRNA in the children was detected by qRT-PCR, and the results showed that progerin mRNA was highly expressed only in the classic c.1824C>T and non-classical c.1822G>A cells ( Figure 2 Finally, we selected children with classic c.1824C>T, nonclassic c.1822G>A, and ZMPSTE24 mutant c.469C>T for follow-up study.

[0137] To obtain the above genotype iPSCs, the reprogramming plasmids pCXLE-hSK, pCXLE-hUL and pCXLE-hOCT3 / 4 were transferred into PMBC separated from the blood of the children by electroporation, and iPSCss single clones were picked on the 20th day ( Figure 3 The iPSCss were continuously passaged and the karyotype and stemness of the cells were detected by IFA ( Figure 4The results showed that PBMCs of various HGPS genotypes could be reprogrammed into iPSCss cells. After continuous passage, the karyotype and stemness of the cells were not significantly different from those of normal human iPSCss. The iPSCss of HGPS patients did not show obvious DNA damage (p-γHA2X staining), which was consistent with previous reports. The cells at the iPSCss stage of HGPS did not have obvious aging phenotypes.

[0138] Example 2

[0139] Construction and detection of HGPS cardiomyocyte differentiation model

[0140] By controlling the Wnt pathway, iPSCs can be quickly and effectively induced to differentiate into cardiomyocytes. However, there is no reported method for HGPS multi-genotype cardiomyocyte differentiation. We established a universal cardiomyocyte differentiation method for HGPS multi-genotypes by optimizing the cell starting density, the concentration of GSK-3 inhibitor CHIR99021, and the concentration of Wnt pathway inhibitor Wnt-C59 during the experiment. Figure 5 ). On the 7th day after differentiation (cardiac progenitor period), some cells began to beat, and on the 9th day, 95% of the cells began to beat rhythmically. qRT-PCR detection found that c.1824C>T and c.1822G>A cells began to express progerin on the 7th day, and the expression level continued to increase with the extension of differentiation time ( Figure 6 ). At the same time, the expression of OCT4 gene, which represents cell stemness, gradually decreased, while the expression of cardiac troponin T (cTnT) began to increase rapidly on the fifth day. The statistical results of cardiomyocyte beating frequency showed that the beating frequency of the WT group was significantly higher than that of the HGPS group. LaminA / C and cTnT IFA staining results showed that HGPS did not show obvious nuclear deformity in the early stage of cardiomyocyte differentiation, and there was no significant difference in myocardial fiber length ( Figure 7 and 8 ).

[0141] Example 3

[0142] Phenotypic identification of HGPS cultured cardiomyocytes and detection of senescence indicators

[0143] To further explore the phenotypic changes of HGPS cardiomyocytes of different genotypes during the passage process, we continuously passaged the differentiated cardiomyocytes and detected them by SA-β-Gal staining, qRT-PCR, IFA, statistical beating frequency and cell proliferation rate. The results showed that HGPS cardiomyocytes of different genotypes began to show different degrees of aging phenotypes compared with the WT group as the number of passages increased, especially the classic c.1824C>T phenotype ( Figures 9 to 13).

[0144] Example 4

[0145] Design of progerin-targeted ASO

[0146] As the main form of nucleic acid drug development in clinical practice, antisense oligonucleotides (ASOs) have made important progress in the treatment of rare diseases with the innovation of gene sequencing, chemical modification and delivery systems. Considering that the FDA-approved HGPS small molecule drug Zokinvy has serious safety issues, ASOs are expected to become a new option for clinical treatment. In this example, some ASO sequences targeting 3'UTR are designed, and 3'UTR is shown in SEQ ID NO: 11. They reduce the expression level of progerin protein by targeting progerin mRNA, reduce the damage caused by progerin to cells, and thus slow down the process of premature aging (schematic diagram of the design of progerin-targeted ASO is shown in Fig.14 ).

[0147] First, target gene sequences suitable for designing ASOs are determined. These target genes target partial fragments of the 3'UTR, as shown in SEQ ID NO:1.

[0148] SEQ ID NO: 1:

[0149] CACATCTGCCTTAAAACCAAAGAGGGCTT

[0150] Furthermore, the sequence suitable for designing ASO is the sequence shown in SEQ ID NO: 10.

[0151] SEQ ID NO:10:

[0152] CATCTGCCTTAAAACCAAAGAGGGC

[0153] SEQ ID NO:11:

[0154] ATCTGGGACCTGCCAGGCAGGGGTGGGGGTGGAGGCTTCCTGCGTCCTCCTCACCTCATGCCCACCCCCTGCCCTGCACG

[0155] TCATGGGAGGGGGCTTGAAGCCAAAGAAAAATAACCCTTTGGTTTTTTTCTTCTGTATTTTTTTTTCTAAGAGAAGTTAT

[0156] TTTCTACAGTGGTTTTATACTGAAGGAAAAACACAAGCAAAAAAAAAAAAAAGCATCTATCTCATCTATCTCAATCCTAA

[0157] TTTCTCCTCCCTTCCTTTTCCCTGCTTCCAGGAAACTCCACATCTGCCTTAAAACCAAAGAGGGCTTCCTCTAGAAGCCA

[0158] AGGGAAAGGGGTGCTTTTATAGAGGCTAGCTTCTGCTTTTCTGCCCTGGCTGCTGCCCCCACCCCGGGGACCCTGTGACA

[0159] TGGTGCCTGAGAGGCAGGCATAGAGGCTTCTCCGCCAGCCTCCTCTGGACGGCAGGCTCACTGCCAGGCCAGCCTCCGAG

[0160] AGGGAGAGAGAGAGAGAGAGGACAGCTTGAGCCGGGCCCCTGGGCTTGGCCTGCTGTGATTCCACTACACCTGGCTGAGG

[0161] TTCCTCTGCCTGCCCCGCCCCCAGTCCCCACCCCTGCCCCCAGCCCCGGGGTGAGTCCATTCTCCCAGGTACCAGCTGCG

[0162] CTTGCTTTTCTGTATTTTATTTAGACAAGAGATGGGAATGAGGTGGGAGGTGGAAGAAGGGAGAAGAAAGGTGAGTTTGA

[0163] GCTGCCTTCCCTAGCTTTAGACCCTGGGTGGGCTCTGTGCAGTCACTGGAGGTTGAAGCCAAGTGGGGTGCTGGGAGGAG

[0164] GGAGAGGGAGGTCACTGGAAAGGGGAGAGCCTGCTGGCACCCACCGTGGAGGAGGAAGGCAAGAGGGGGTGGAGGGGTGT

[0165] GGCAGTGGTTTTGGCAAACGCTAAAGAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAAT

[0166] ACACTAGTTGTTTCTACCCCT

[0167] The inventors designed multiple ASO sequences targeting 3'UTR fragments as shown in Table 1 below, and commissioned a company to synthesize the corresponding fragments, which were then dissolved in sterile water for later use. Cardiomyocytes differentiated from iPSCss of patients with progeria of different genotypes were cultured at a rate of 5x10 5 / well concentration was evenly spread into a 6-well plate. After 48 hours, the cardiomyocytes began to beat and were ready for transfection with ASO. Using Lip3000 transfection reagent, different ASOs were transfected into the corresponding cardiomyocytes at a concentration of 50nM or 100nM. Mock cell group and transfection reagent negative control group were set up at the same time. After transfection, the cardiomyocytes were cultured for 48 hours to prepare for cell samples. RNA sample collection: aspirate the supernatant in the 6-well plate, wash gently with PBS twice, then add 350ulTRK cell lysate to each well, and then extract total cell RNA by using OMEGA RNA extraction kit (R6824-02) for detection. Protein sample collection: aspirate the supernatant in the 6-well plate, wash gently with PBS twice, then add 200ul Biyuntian protein special cell lysis buffer RIPA (P0013B) to each well, lyse on ice for 15 minutes, centrifuge at 12000rpm at 4 degrees, take the supernatant, detect the protein concentration, and then detect it. Real-time fluorescence quantitative PCR was used to detect the expression of mRNA such as progerin. Detection primers were designed according to the sequences of genes such as progerin. Then, the total RNA was reverse transcribed into cDNA using the Novagen reverse transcription kit (R223-01). Then, the expression of mRNA such as progerin was quantitatively detected using the Novagen dye method fluorescence quantitative kit (Q711-03), and the statistical data was plotted. Western blot was used to detect protein expression: ACE gradient protein separation gel (B221212) was used for protein electrophoresis. The amount of sample protein added to each well was 30ug / well, the voltage was 160V, and the electrophoresis time was 90 minutes. Then semi-dry transfer was performed, the corresponding antibodies were incubated, the protein was exposed using a chemiluminometer, and the protein expression was recorded.

[0168] Table 1

[0169] Sequence number ASO name Sequence information SEQ ID NO:2 U4 TTGGTTTTAAGGCAGATGTG SEQ ID NO:3 U5 CTTTGGTTTTAAGGCAGATG SEQ ID NO:4 U6 CTCTTTGGTTTTAAGGCAGA SEQ ID NO:5 U7 CCTCTTTGGTTTTAAGGCAG SEQ ID NO:6 U8 CCCTCTTTGGTTTTAAGGCA SEQ ID NO:7 U9 GCCCTCTTTGGTTTTAAGGC SEQ ID NO:8 U10 AGCCCTCTTTGGTTTTAAGG SEQ ID NO:9 U11 AAGCCCTCTTTGGTTTTAAG

[0170] Example 5

[0171] Verification of the effect of ASO on reducing progerin mRNA expression

[0172] To explore the effects of different ASOs on premature aging cardiomyocyte models, the inventors transfected different types of ASOs into classical c.1824C>T and non-classical c.1822G>A cardiomyocytes. qRT-PCR results showed that ASO_U5-U11 (100nM) could significantly reduce the expression of progerin mRNA in cardiomyocytes, and ASO_U5-U9 reduced the expression of progerin mRNA in cardiomyocytes by more than 70% ( Fig.15 and 16 ). Taking ASO_U7 and ASO_U9 as examples, dose-dependent experiments have shown that 50nM ASO_U7 and ASO_U9 can effectively reduce the expression levels of progerin mRNA and protein ( Figure 17-20 ). IFA test results showed that the number of abnormal nuclei was significantly reduced after transfection with ASO_U7 and U9, and SA-β-Gal staining results also proved that transfection with U7 and U9 could reduce the number of senescence-positive cells ( Figure 21-25 ), the above results prove that ASO U7 and U9 targeting progerin can significantly reduce the expression of progerin mRNA and slow down the process of cell aging.

[0173] To further explore the effect of ASO progeria mouse model, we screened the ASO sequences designed above. We injected ASO_U5-U9 (50 mg / kg) subcutaneously once a week in the G608G progeria mouse model, and set up a PBS group as a control group. After one month of continuous injection, the expression of progerin mRNA and protein in the heart and liver tissues of the mice was detected. It was found that they all showed a certain inhibitory effect on the expression of progerin mRNA and protein (exemplarily as Figure 26-29 , qRT-PCR and Western blot results showed that both ASO_U7 and ASO_U9 could significantly reduce the expression of progerin mRNA and protein in the heart and liver of progeria mice).

[0174] Example 6

[0175] ASO specificity and toxicity

[0176] The study found that U5, U9, and U11 designed in the above embodiments had the best specificity, while U8 had relatively poor specificity and higher toxicity.

[0177] The inventors collected serum from mice injected with PBS and ASO_U5-U9, and tested liver and kidney related biochemical indicators. Through experiments, it was found that ASO_U7 and ASO_U9 had the best specificity and the lowest toxicity, and were more suitable for subsequent human trials. Figure 30-34As shown, ASO_U7 and ASO_U9 groups did not cause obvious liver and kidney damage compared with the PBS injection group.

[0178] Those skilled in the art will appreciate that the above-mentioned embodiments are specific examples for implementing the present invention, and in actual applications, various changes may be made thereto in form and detail without departing from the spirit and scope of the present invention.

Claims

1. An isolated polynucleotide, characterized in that The length of the polynucleotide is not less than 10 bp, and the isolated polynucleotide comprises a polynucleotide fragment complementary to the following sequence or a fragment thereof: (i) the sequence shown in SEQ ID NO: 11; and / or (ii) A polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO:

11.

2. The isolated polynucleotide according to claim 1, characterized in that The isolated polynucleotide comprises a polynucleotide fragment complementary to the following sequence or a fragment thereof: (i) the sequence shown in SEQ ID NO: 1; and / or (ii) A polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO:

1.

3. The isolated polynucleotide according to claim 1, characterized in that The isolated polynucleotide comprises a polynucleotide fragment complementary to the following sequence or a fragment thereof: (i) the sequence shown in SEQ ID NO: 10; and / or (ii) A polynucleotide sequence formed by substitution, deletion or addition of one or more nucleotides in the sequence shown in SEQ ID NO:

10.

4. The isolated polynucleotide according to claim 1, characterized in that The isolated polynucleotide comprises at least one polynucleotide fragment selected from the group consisting of: (i) a polynucleotide fragment as shown in SEQ ID NO: 2-9; and (ii) a polynucleotide fragment having no less than 80% homology to SEQ ID NO: 2-9.

5. The isolated polynucleotide according to claim 1, characterized in that The isolated polynucleotide is selected from at least one of the following groups: (i) a polynucleotide as shown in SEQ ID NO: 2-9; and (ii) a polynucleotide having no less than 80% homology to SEQ ID NO: 2-9.

6. The isolated polynucleotide according to claim 5, characterized in that The isolated polynucleotide is the polynucleotide shown in SEQ ID NO:5 or SEQ ID NO:

7.

7. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the polynucleotide according to any one of claims 1 to 6, and a pharmaceutically acceptable carrier.

8. Use of the polynucleotide according to any one of claims 1 to 6 or the pharmaceutical composition according to claim 7, characterized in that: Used for: (i) preventing and / or treating diseases associated with lamin A mutation; (ii) preparing drugs for preventing and / or treating diseases associated with lamin A mutation; (iii) reducing the expression level of lamin A mutants; (iv) reducing the number of senescence-positive cells; and / or (v) Reduce the number of abnormal nuclear cells.

9. The use according to claim 8, characterized in that The lamin A mutation-related disease is selected from at least one of dilated cardiomyopathy and conduction disorders, muscular dystrophy, Charcot-Marie-Tooth disease type 2, familial lipodystrophy, rhabdomyosarcoma, progeroid syndrome, Emery-Dreyfus muscular dystrophy, insulin resistance syndrome, progeria, limb-girdle muscular dystrophy, congenital muscular dystrophy and Werner syndrome.

10. A method for preventing and / or treating a disease associated with lamin A mutation, characterized in that: The method comprises the steps of: A therapeutically effective amount of the polynucleotide of any one of claims 1 to 6, or the pharmaceutical composition of claim 7 is administered to a subject.

Images