Cell-free protein synthesis system based on ribozyme regulation and application thereof

Abstract

The invention discloses a cell-free protein synthesis system based on ribozyme regulation and application thereof, the cell-free protein synthesis system comprises an RNA report chain and a ribozyme inhibition chain, and when a pathogen target does not exist, the ribozyme inhibition chain can be specifically combined with a ribozyme sequence on the RNA report chain and inhibit the cleavage activity of ribozyme. When a pathogen target exists, the ribozyme inhibition chain is specifically combined with the pathogen target, the cleavage activity of ribozyme and the translation activity of the RNA report chain are activated, and report protein is expressed, so that rapid field detection of pathogens is realized, and detection of different pathogens can be realized by changing the sequence of the inhibition chain. And the cell-free protein synthesis system is more convenient to detect various high-pathogenicity pathogens.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a cell-free protein synthesis system based on ribozyme regulation, and also to an application of the system in preparing a highly pathogenic pathogen detection kit. Background Art

[0002] In the severe challenges of biosafety prevention and control, on-site rapid detection of highly pathogenic pathogens has become a crucial link. Traditional detection methods often rely on complex laboratory environments and living cell culture technology, which not only limits the timeliness of detection, but also increases the difficulty and cost of operation. With the rapid development of synthetic biology technology, cell-free protein synthesis system (CFPS) has gradually emerged as an innovative biotechnology platform, providing new ideas for solving this problem. With its ability to directly synthesize biologically active recombinant proteins in the extracellular environment, the CFPS system greatly simplifies the protein production process and reduces the dependence on living cells. In the field of pathogen detection, the CFPS system has shown great application potential. It can design and synthesize specific antibodies or detection proteins for specific pathogens to achieve efficient and specific target recognition. However, the traditional CFPS system is highly dependent on complex algorithm screening when designing specific detection proteins. The process is cumbersome and difficult to be widely applied to a variety of pathogens, which limits its versatility and practicality. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a cell-free protein synthesis system based on ribozyme regulation. As a type of RNA molecule with catalytic activity, ribozymes can specifically cleave the phosphodiester bond in the RNA chain of the target site, thereby achieving precise regulation of specific RNA molecules. By introducing ribozymes into the CFPS system, we aim to build a new detection platform that can utilize the specific cutting ability of ribozymes to achieve sensitive detection of multiple highly pathogenic pathogen targets. This design not only simplifies the detection process, improves detection efficiency and accuracy, but also significantly enhances the versatility and flexibility of the system, and is expected to bring new ideas to the field of biosafety prevention and control.

[0004] The cell-free protein synthesis system based on ribozyme regulation includes an RNA reporter chain and a ribozyme inhibitory chain. When the pathogen target is not present, the ribozyme inhibitory chain binds to the ribozyme on the RNA reporter chain, making it unable to perform the function of cutting the ribozyme substrate, and the ribosome binding site (RBS) cannot be recognized by the ribosome, so the RNA reporter chain cannot express the reporter protein in the cell-free protein synthesis system; when the pathogen target is present, the ribozyme inhibitory chain complementarily binds to the pathogen target and undergoes a chain displacement reaction, the ribozyme successfully hydrolyzes the ribozyme substrate, and the specific cutting of the ribozyme activates the translation activity of the RNA reporter chain. The RNA reporter chain expresses the HiBiT reporter protein in the cell-free protein expression system, which can be combined with the LgBiT protein to generate active Nano-Luc luciferase, which can catalyze the substrate to emit light and be detected by the instrument. By detecting the luminescence value, sensitive detection of highly pathogenic pathogens can be achieved. This design greatly improves the specificity and sensitivity of the detection.

[0005] The second purpose of the present invention is to provide an application of a cell-free protein synthesis system based on ribozyme regulation in the preparation of a highly pathogenic pathogen detection kit. The cell-free protein synthesis system regulated by the above ribozyme is the technical core, and a highly pathogenic pathogen detection technology and product with on-site rapid detection capability is developed. This technology can not only significantly improve the detection efficiency and accuracy, but also has a high degree of versatility and flexibility. Under simulated field conditions, different types of highly pathogenic pathogens are detected to evaluate the accuracy, stability and practicality of the cell-free protein synthesis system based on ribozyme regulation.

[0006] In order to achieve the above object, the present invention provides the following technical solutions: A cell-free protein synthesis system based on ribozyme regulation, characterized in that it comprises an RNA reporter chain and a ribozyme inhibitory chain; the RNA reporter chain is a translation template, comprising a ribosome binding site complementary sequence UCUCCUCU, a ribozyme sequence GGCGACCCUGAUGAGGCCGAAAGGCCGAAACGGU (SEQ ID No. 1), a ribozyme substrate sequence ACCGUAGGUUGCC (SEQ ID No. 2), a ribosome binding site AGAGGAGA, a start codon AUG, and a HiBiT reporter protein coding sequence GUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGC; the ribozyme can act on the ribozyme substrate, and achieve specific cleavage of the ribozyme substrate by catalyzing the cleavage of the phosphodiester bond; The base sequence of the RNA reporter strand is as follows: UCUCCUCUGGCGACCCUGAUGAGGCCGAAAGGCCGAAACGGUAUCGACCGUAGGUUGCCAGAACAGAGGAGAUAAAGAUGGUGAGCGGCCGGCGGCUGUUCAAGAAGAUUAGC (SEQ ID No. 30); The ribozyme inhibitory strand can specifically bind to the ribozyme sequence on the RNA reporter strand and regulate the cleavage activity of the ribozyme.

[0007] Preferably, the base sequence of the ribozyme inhibitory chain is as follows: I20':GAGGGGGCCUGACGGGAUGAUAGAAAGAACGUACGUUUCGGUUUCCCGGAAUCGGCCUCAUCAG (SEQ ID No. 32); I22':GAGGGGGCCUGACGGGAUGAUAGAAAGAACGUACGUUUCGGUUUCCCGCUUAGCGCCUCAUCAG (SEQ ID No. 33); I24':GAGGGGGCCUGACGGGAUGAUAGAAAGAACGUACGUUUCGGUUUCAAAAAAUCGGCCUCAUCAG (SEQ ID No. 34); RSVA-inhibitor: GGGAUGUGUGUAAUUUCCAACAAGGUGUAUCUAUCACACCGUUUCCCGCUUAGCGCCUCAUCAG (SEQID No. 39); RSVB-inhibitor: CUUUGAUGUUGGUGGUGCACAGAGGUGAUGUGUGUAAUUUGUUUCCCGCUUAGCGCCUCAUCAG (SEQID No. 40); Influenza B-inhibitor: UUGUCUCCAUUAGGGUGCUUGAGGAAGGUUCCGUUCACCAGUUUCCCGCUUAGCGCCUCAUCAG (SEQID No. 41); Parainfluenza-inhibitor: UUGUUUUAUAAUCAGGUCAAUGCAUAAGAUCAUGAUAAUGGUUUCCCGCUUAGCGCCUCAUCAG (SEQ ID No. 42).

[0008] Preferably, the cell-free protein synthesis system based on ribozyme regulation of the present invention also comprises all necessary enzymes, cofactors and substrates to support RNA translation and subsequent protein folding.

[0009] Preferably, the enzyme comprises at least RNA polymerase, and the substrate comprises at least nucleoside triphosphates, amino acids and a luminescent substrate.

[0010] The present invention preferably uses a transcription template for the RNA reporter strand prepared by in vitro transcription, wherein the transcription template is a linear double-stranded DNA sequence, and its base sequence is as follows: GCTAATCTTCTTGAACAGCCGCCAGCCGCTCACCATCTTTATCTCCTCTGTTCTGGCAACCTACGGTCGATACCGTTTCGGCCTTTCGGCCTCATCAGGGTCGCCAGAGGAGACCCTATAGTGAGTCGTATTA (SEQ ID No. 29).

[0011] The invention relates to an application of a ribozyme-regulated cell-free protein synthesis system in the preparation of a highly pathogenic pathogen detection kit, wherein the highly pathogenic pathogens are influenza A virus H1N1 subtype, respiratory syncytial virus type A, respiratory syncytial virus type B, influenza B virus and parainfluenza virus.

[0012] In some embodiments of the present invention, when the pathogen target is not present, the ribozyme inhibitory chain binds to the ribozyme sequence on the RNA reporter chain, making it unable to perform the function of cutting the ribozyme substrate, and the ribosome binding site (RBS) cannot be recognized by the ribosome, so the reporter protein cannot be expressed on the RNA reporter chain in the cell-free protein synthesis system; when the pathogen target is present, the ribozyme inhibitory chain complementarily binds to the pathogen target and a chain displacement reaction occurs, the ribozyme successfully hydrolyzes the ribozyme substrate, and the specific cutting of the ribozyme activates the translation activity of the RNA reporter chain. The RNA reporter chain expresses the HiBiT reporter protein in the cell-free protein expression system, which can combine with the LgBiT protein to generate active Nano-Luc luciferase, which can catalyze the substrate to emit light and be detected by the instrument. By detecting the luminescence value, sensitive detection of highly pathogenic pathogens can be achieved.

[0013] In some embodiments of the present invention, during the detection process, the ribozyme inhibitory chain and the RNA reporter chain are first slowly annealed at 95°C to 25°C for 1 hour to allow the ribozyme inhibitory chain to tightly bind to the RNA reporter chain; then the sample to be tested is added to the complex of the ribozyme inhibitory chain and the RNA reporter chain and incubated at 31°C for 1 hour; finally, the complex is added to the cell-free protein synthesis system and reacted for a period of time, and the change in luminescence value is detected to determine whether the virus is present in the sample.

[0014] In some embodiments of the present invention, the reaction temperature in the cell-free protein synthesis system is 25° C. and the reaction time is 40 minutes.

[0015] The beneficial effects of the present invention are as follows: the present invention successfully constructs a reporter protein coding sequence that can be regulated by ribozymes, and the sequence can express the reporter protein in the cell-free protein synthesis system when the target is present, thereby realizing rapid on-site detection of highly pathogenic pathogens. In addition, the present invention also constructs an inhibitory chain that can inhibit the activity of ribozymes, and the detection of different pathogens can be realized by changing the inhibitory chain, making the cell-free protein synthesis system more convenient for the detection of multiple highly pathogenic pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 This is a technical principle diagram of the present invention (the orange line represents the RBS Complementary sequence, the light blue line represents the ribozyme, the green line represents the ribozyme substrate, the yellow line represents the RBS, the red line represents the reporter gene, the dark blue line represents the ribozyme inhibitor, and the purple line represents the target).

[0017] Figure 2 For the screening effect of ribozyme inhibitory chain.

[0018] Figure 3 Specific sequence composition of the RNA reporter strand.

[0019] Figure 4 The changes in luminescence values ​​of the three inhibitory chains I20', I22', and I24' that are preferred for this experiment before and after binding to the target H1N1.

[0020] Figure 5 The luminescence value changes of influenza A virus H1N1 subtype, respiratory syncytial virus type A, respiratory syncytial virus type B, influenza B virus and parainfluenza virus before and after binding with the inhibitory chain. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0022] Attached Figure 1 This is a technical principle diagram of the present invention. When the target does not exist, the ribozyme cannot perform the function of cutting the substrate under the action of the inhibitory chain, and the ribosome binding site (RBS) cannot be recognized by the ribosome, so the RNA chain cannot express the reporter protein in the cell-free protein synthesis system; when the target exists, the inhibitory chain is complementary to the target and a chain displacement reaction occurs, the ribozyme successfully hydrolyzes the substrate, and the RNA chain expresses the HiBiT reporter protein in the cell-free protein expression system. It can combine with the LgBiT protein to generate active Nano-Luc luciferase, which can catalyze the substrate to emit light and be detected by the instrument. By detecting the luminescence value, sensitive detection of highly pathogenic pathogens can be achieved.

[0023] Example 1: Screening of target-specific ribozyme inhibitory chains In order to achieve efficient and specific pathogen detection, the present invention focuses on screening and optimizing the HH15 ribozyme inhibitory chain for specific targets. The HH15 ribozyme sequence is: 5'-GGCGACCCUGAUGAGGCCGAAAGGCCGAAACGGU-3' (the underlined part is the conserved region, the bold part is the hammerhead region, SEQ ID No.1), and the substrate sequence is: 5'-ACCGUAGGUUGCC-3' (SEQ ID No.2). A total of 26 inhibitory chains I1~I26 were designed for the HH15 ribozyme sequence. These chains are completely complementary to HH15 in the conserved region and partially complementary in the hammerhead region to ensure that they can specifically bind to and regulate the cleavage activity of the ribozyme. The specific sequences are shown in the following sequence table SEQ ID No.3~28.

[0024] Through in vitro RNA cleavage experiments, the cleavage efficiency of each inhibitory chain in the presence of fluorescent groups is tested. Fluorescent groups and quenching groups are added to both ends of the substrate chain using fluorescent labeling technology. For example, the substrate chain is designed as: 5'- / 6-FAM / ACCGUAGGUUGCC / BHQ1 / -3'. When cleavage occurs, it separates from the quenching group and generates a detectable fluorescent signal, thereby intuitively evaluating the cleavage effect. The specific reaction system is as follows: HH15 ribozyme chain (2μM, 5μL), substrate chain labeled with fluorescent groups and quenching groups at both ends (2μM, 5μL), Tris-HCL (2μM, 5μL) and 26 inhibitory chains (2μM, 5μL) were incubated at 90℃ for 3 minutes, and then MgCl2 (100mM, 10μL) was added respectively. The fluorescence changes were recorded at 37℃ on a constant temperature fluorescence instrument for 1 hour, and the fluorescence ratio before and after adding the inhibitory chain was used to screen out the inhibitory chain with the best inhibitory effect. The lower the ratio, the better the inhibitory effect of the inhibitory chain. The specific results are shown in the attached figure. Figure 2 As shown, numbers 1 to 26 represent 26 inhibitory chains I1 to I26, respectively, indicating that I20, I22, and I24 have better inhibitory effects.

[0025] Example 2: Construction of RNA strands encoding HH15 SWITCH reporter proteins GCTAATCTTCTTGAACAGCCGCCAGCCGCTCACCATCTTTATCTCCTCTGTTCTGGCAACCTACGGTCGATACCGTTTCGGCCTTTCGGCCTCATCAGGGTCGCCAGAGGAGACCCTATAGTGAGTCGTATTA is the transcription template strand (the underlined part is T7 promoter, SEQ ID No. 29), and the in vitro transcription kit containing T7 promoter is added to transcribe the double-stranded DNA into mRNA. The obtained RNA reporter strand (i.e., HH15 SWITCH sequence) includes the ribosome binding site complementary sequence UCUCCUCU, the ribozyme GGCGACCCUGAUGAGGCCGAAAGGCCGAAACGGU, the ribozyme substrate ACCGUAGGUUGCC, the ribosome binding site AGAGGAGA, the start codon AUG, the HiBiT reporter protein coding sequence GUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGC (see Appendix Figure 3 ), the base sequence of the RNA reporter strand is as follows: UCUCCUCUGGCGACCCUGAUGAGGCCGAAAGGCCGAAACGGUAUCGACCGUAGGUUGCCAGAACAGAGGAGAUAAAGAUGGUGAGCGGCCGGCGGCUGUUCAAGAAGAUUAGC (SEQ ID No. 30).

[0026] Example 3: Detection of target influenza A virus The influenza A virus H1N1 fragment CGAAACGUACGUUCUUUCUAUCAUCCCGUCAGGCC CCCUC (SEQ ID No. 31) was used as a simulated target, and the sequences complementary to the simulated target were added to the inhibitory chains I20, I22, and I24 sequences screened in Example 1 to design ribozyme inhibitory chains I20', I22', and I24' (SEQ ID No. 32-34) that can specifically bind to the target. The three inhibitory chains (10 μL, 400 nM) were respectively mixed with the RNA chain of HH15 SWICTH (i.e. Figure 3 HS) (10μL, 400nM) was slowly annealed at 95℃ to 25℃ for 1 hour to allow the inhibitory chain to bind tightly to the HH15 SWITCH RNA chain. Then the target H1N1 (10μL, 400nM) was added to the complex of 20μL HH15 SWITCH and the ribozyme inhibitory chain, and 20μL 100mM MgCl2 solution was added and incubated at 31℃ for 1 hour. 13μL of this complex was added to 37μL cell-free protein synthesis reagent and reacted at 25℃ for 40 minutes. The system contains all the necessary enzymes, cofactors and substrates to support RNA transcription, translation and subsequent protein folding, and HiBiT protein can be expressed. It can be combined with LgBiT protein to generate active Nano-Luc luciferase, which can catalyze the substrate to emit light and be detected by the instrument. Sensitive detection of influenza A virus can be achieved by detecting the luminescence value, such as the attached Figure 4 shown.

[0027] Example 4: Versatility of the highly pathogenic pathogen identification technology of the ribozyme-regulated cell-free protein synthesis system The five most common respiratory viruses were selected as simulation targets, including influenza A virus H1N1 subtype, respiratory syncytial virus A (RSVA), respiratory syncytial virus B (RSVB), influenza B virus (Influenza B), and parainfluenza virus (Parainfluenza). Based on the specific sequences of these five targets (SEQ ID No.31, SEQ ID No.35~38), complementary ribozyme inhibitor chains (SEQ ID No.33, SEQ ID No.39~42) were designed to achieve sensitive detection of different targets, such as the attached Figure 5 shown.

[0028] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A cell-free protein synthesis system based on ribozyme regulation, characterized in that: It comprises an RNA reporter chain and a ribozyme inhibitory chain; the RNA reporter chain comprises a ribosome binding site complementary sequence UCUCCUCU, a ribozyme sequence GGCGACCCUGAUGAGGCCGAAAGGCCGAAACGGU (SEQ ID No.1), a ribozyme substrate sequence ACCGUAGGUUGCC (SEQ ID No.2), a ribosome binding site AGAGGAGA, a start codon AUG, and a HiBiT reporter protein coding sequence GUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGC; the ribozyme can act on the ribozyme substrate and achieve specific cleavage of the ribozyme substrate by catalyzing the cleavage of the phosphodiester bond; The base sequence of the RNA reporter strand is as follows: UCUCCUCUGGCGACCCUGAUGAGGCCGAAAGGCCGAAACGGUAUCGACCGUAGGUUGCCAGAACAGAGGAGAUAAAGAUGGUGAGCGGCCGGCGGCUGUUCAAGAAGAUUAGC (SEQ ID No. 30); The ribozyme inhibitory strand can specifically bind to the ribozyme sequence on the RNA reporter strand and regulate the cleavage activity of the ribozyme.

2. The cell-free protein synthesis system based on ribozyme regulation according to claim 1, characterized in that: The base sequence of the ribozyme inhibitory chain is as follows: I20':GAGGGGGCCUGACGGGAUGAUAGAAAGAACGUACGUUUCGGUUUCCCGGAAUCGGCCUCAUCAG (SEQ ID No. 32); I22':GAGGGGGCCUGACGGGAUGAUAGAAAGAACGUACGUUUCGGUUUCCCGCUUAGCGCCUCAUCAG (SEQ ID No. 33); I24':GAGGGGGCCUGACGGGAUGAUAGAAAGAACGUACGUUUCGGUUUCAAAAAAUCGGCCUCAUCAG (SEQ ID No. 34); RSVA-inhibitor: GGGAUGUGUGUAAUUUCCAACAAGGUGUAUCUAUCACACCGUUUCCCGCUUAGCGCCUCAUCAG (SEQ ID No. 39); RSVB-inhibitor: CUUUGAUGUUGGUGGUGCACAGAGGUGAUGUGUGUAAUUUGUUUCCCGCUUAGCGCCUCAUCAG (SEQ ID No. 40); Influenza B-inhibitor: UUGUCUCCAUUAGGGUGCUUGAGGAAGGUUCCGUUCACCAGUUUCCCGCUUAGCGCCUCAUCAG (SEQ IDNo. ​​41); Parainfluenza-inhibitor: UUGUUUUAUAUCAGGUCAAUGCAUAAGAUCAUGAUAAUGGUUUCCCGCUUAGCGCCUCAUCAG (SEQ ID No. 42).

3. The cell-free protein synthesis system based on ribozyme regulation according to claim 1, characterized in that: The ribozyme-regulated cell-free protein synthesis system also contains all necessary enzymes, cofactors and substrates to support RNA translation and subsequent protein folding.

4. The cell-free protein synthesis system based on ribozyme regulation according to claim 3, characterized in that: The enzyme at least comprises RNA polymerase, and the substrate at least comprises nucleoside triphosphates, amino acids and a luminescent substrate.

5. The cell-free protein synthesis system based on ribozyme regulation according to claim 1, characterized in that: The transcription template used for in vitro transcription to prepare the RNA reporter chain is a linear double-stranded DNA sequence, and its base sequence is as follows: GCTAATCTTCTTGAACAGCCGCCAGCCGCTCACCATCTTTATCTCCTCTGTTCTGGCAACCTACGGTCGATACCGTTTCGGCCTTTCGGCCTCATCAGGGTCGCCAGAGGAGACCCTATAGTGAGTCGTATTA (SEQ ID No. 29).

6. The use of the cell-free protein synthesis system based on ribozyme regulation according to claim 2 in the preparation of a highly pathogenic pathogen detection kit, characterized in that: The highly pathogenic pathogens are influenza A virus, respiratory syncytial virus type A, respiratory syncytial virus type B, influenza B virus and parainfluenza virus.

7. The use according to claim 6, characterized in that: When the pathogen target does not exist, the ribozyme inhibitory chain binds to the ribozyme on the RNA reporter chain, making it unable to perform the function of cutting the ribozyme substrate, and the ribosome binding site cannot be recognized by the ribosome, so the RNA reporter chain cannot express the reporter protein in the cell-free protein synthesis system; when the pathogen target exists, the ribozyme inhibitory chain complementarily binds to the pathogen target and a chain displacement reaction occurs, the ribozyme successfully hydrolyzes the ribozyme substrate, and the specific cutting of the ribozyme activates the translation activity of the RNA reporter chain. The RNA reporter chain expresses the HiBiT reporter protein in the cell-free protein expression system, which can combine with the LgBiT protein to generate active Nano-Luc luciferase, which can catalyze the substrate to emit light and be detected by the instrument. By detecting the luminescence value, sensitive detection of highly pathogenic pathogens can be achieved.

8. The use according to claim 6, characterized in that: During the detection process, the ribozyme inhibitor chain and the RNA reporter chain first need to be slowly annealed at 95°C to 25°C for 1 hour to allow the ribozyme inhibitor chain and the RNA reporter chain to be tightly bound; then the sample to be tested is added to the complex of the ribozyme inhibitor chain and the RNA reporter chain and incubated at 31°C for 1 hour; finally, this complex is added to the cell-free protein synthesis system and reacted for a period of time, and the change in fluorescence value is detected to determine whether the virus is present in the sample.

9. The use according to claim 8, wherein the reaction temperature in the cell-free protein synthesis system is 25°C and the reaction time is 40 minutes.

Images