Construction method and application of oncolytic vaccinia virus vector with C2L gene deletion

Abstract

The invention relates to a construction method and application of a C2L gene-deleted oncolytic vaccinia virus vector, the virus vector is Lister strain vaccinia virus, a C2L gene is deleted on the basis that a J2R gene is deleted, and the vector can be inserted into any antigen gene beneficial to tumor treatment or used for vaccines for infectious diseases. Wherein the VV [delta] TK [delta] C2L has specificity, safety and high efficiency, can carry various antigen genes for treating tumors, has targeting property, and can be used for treating various solid tumors. The VV [delta] TK [delta] C2L-LO uses an LO gene as a therapeutic gene, and the vector can selectively kill tumor cells, has tumor targeting and anti-tumor effects, lays a foundation for clinical application of tumor targeting gene engineering drugs, and provides an effective new method for tumor treatment.

Description

Technical Field

[0001] The present invention relates to a construction method and application of a C2L gene-deficient oncolytic vaccinia virus vector, belonging to the field of biotechnology and gene therapy. Background Art

[0002] Over the past 20 years, vaccinia virus has been systematically studied as an oncolytic virus (OV). The vaccinia virus Pexa-Vec has been clinically tested as a representative oncolytic agent. This virus is a Wyeth strain of vaccinia virus with a TK gene deletion and expression of human GM-CSF. Its tumor selectivity, viral replication, secretion of GM-CSF by infected cancer cells, and induction of anti-tumor immune responses have been confirmed. It can also induce antibody-mediated, complement-dependent tumor cell lysis in tumor patients, showing good anti-tumor efficacy and safety. Unfortunately, the Phase III clinical trial of Pexa-Vec for advanced liver cancer was terminated, and the interim results showed that it was difficult to achieve the primary goal of overall survival at the time of the final analysis. Therefore, it is necessary to optimize and modify the oncolytic vaccinia virus vector based on the latest research to enhance the safety and practicality of the oncolytic vaccinia virus vector and improve its anti-tumor ability.

[0003] Vaccinia virus has a huge DNA genome that encodes many proteins dedicated to evading host immunity. Some of these proteins are secreted from infected cells, where they bind and neutralize complement factors, interferons, cytokines, and chemokines. Other VACV proteins act intracellularly to inhibit apoptosis or signaling pathways that lead to the production of interferons, proinflammatory cytokines, and chemokines. Studies have shown that the C2L gene in vaccinia virus (VV) is not essential for viral replication in vitro. C2L is a 56kDa intracellular BTB-Kelch protein whose presence contributes to the formation of VV-induced cell protrusions and the Ca2+ uptake of the extracellular matrix by infected cells. 2+ The development of independent adhesion can be reduced and the activation of NF-kB can be reduced by reducing the translocation of p65 into the nucleus. Animal experiments using VACV strains lacking C2L can induce stronger CD8+T cell responses. Therefore, it is possible to try to delete the C2L gene to construct a more efficient and safe oncolytic vaccinia virus vector.

[0004] Lactate oxidase (LO) has a wide range of biological functions. As a natural enzyme that effectively consumes lactate, it can catalyze lactate to produce pyruvate and hydrogen peroxide. This process can alleviate the immunosuppressive state of the tumor microenvironment, enhance the effectiveness of immunotherapy, and thus improve the anti-tumor immune response. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a method for constructing a tumor-targeted vaccinia virus vector VVΔTKΔC2L that simultaneously deletes the J2R (thymidine kinase, TK) and C2L genes. The viral vector carries genes for treating tumors and has the characteristics of targeting, safety, and strong anti-tumor ability.

[0006] The present invention also provides a method for constructing a tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO. The vector uses LO as a therapeutic gene, which can improve the tumor microenvironment, alleviate its immunosuppressive state, and enhance the anti-tumor effect.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] A method for constructing an oncolytic vaccinia virus vector, wherein the vaccinia virus is a Lister strain vaccinia virus, two intrinsic genes J2R and C2L of the virus are deleted, and any gene that helps treat tumors or is used for infectious disease vaccines is inserted.

[0009] The gene for treating tumors is lactate oxidase gene.

[0010] The method for constructing the oncolytic vaccinia virus vector VVΔTKΔC2L comprises the following steps:

[0011] (1) The upstream sequence of the C2L gene SEQ ID NO: 1, the reporter gene red fluorescent protein SEQ ID NO: 3, and the downstream sequence of the C2L gene SEQ ID NO: 2 were sequentially connected to the plasmid vector pUC57 by gene synthesis to construct the shuttle vector pUC-C2L;

[0012] (2) Designing the sequence gRNA according to the C2L gene sequence: SEQ ID NO: 4, and connecting the gRNA to the PB-gRNA vector to construct PB-gRNA-C2L;

[0013] (3) CV1 cells were inoculated onto a six-well plate. When the cells reached a confluence of more than 90%, the CRASPR / Cas9 and PB-gRNA-C2L mixed plasmids were transfected simultaneously. After 24 hours, the J2R gene-deleted VVΔTK was infected, and after 2 hours, pUC-C2L was transfected. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After the monoclonal solution was frozen and thawed, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔC2L.

[0014] The oncolytic vaccinia virus vector is a method for constructing VVΔTKΔC2L-LO, comprising the following steps:

[0015] (1) The upstream sequence of the C2L gene SEQ ID NO: 1, the reporter gene red fluorescent protein SEQ ID NO: 3, and the downstream sequence of the C2L gene SEQ ID NO: 2 were sequentially connected to the plasmid vector pUC57 by gene synthesis to construct the shuttle vector pUC-C2L;

[0016] (2) Designing the gRNA sequence SEQ ID NO: 4 according to the C2L gene sequence, and connecting the gRNA sequence to the PB-gRNA vector to construct PB-gRNA-C2L;

[0017] (3) synthesizing the bacterial LO gene sequence SEQ ID NO:5 to obtain the pUC-LO gene fragment, double-digesting the pUC-LO and pUC-C2L plasmids with Sal I and Nhe I, purifying the LO and pUC-C2L fragments respectively, and then ligating the excised LO gene fragment and pUC-C2L with T4 DNA polymerase to construct pUC-C2L-LO;

[0018] (4) CV1 cells were inoculated into a six-well plate. When the cells reached a confluence of more than 90%, the CRASPR / Cas9 and PB-gRNA-C2L mixed plasmids were transfected at the same time. After 24 hours, VVΔTK with the J2R gene deleted was infected, and pUC-C2L-LO was transfected after 2 hours. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After the monoclonal solution was frozen and thawed, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔC2L-LO.

[0019] The use of the oncolytic vaccinia virus vector VVΔTKΔC2L in the preparation of drugs for treating tumors or infectious diseases.

[0020] The use of the oncolytic vaccinia virus vector VVΔTKΔC2L-LO in the preparation of drugs for treating tumors or infectious diseases.

[0021] The tumor is a solid tumor, and the infectious disease is a viral, bacterial or fungal infectious disease; solid tumors include pancreatic cancer, lung cancer, ovarian cancer, colon cancer, esophageal cancer, liver cancer or cervical cancer.

[0022] Beneficial effects of the present invention:

[0023] (1) The tumor-targeted vaccinia virus vector VVΔTKΔC2L provided by the present invention has two vaccinia virus intrinsic genes J2R and C2L deleted, can carry various tumor-treating genes, has targeting properties, and can be used to treat various cancers (such as pancreatic cancer, lung adenocarcinoma, ovarian cancer, colon cancer, esophageal cancer, etc.). Therefore, VVΔTKΔC2L can be used as an efficient and safe vector system for treating tumors.

[0024] (2) The tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO of the present invention uses LO as a therapeutic gene. VVΔTKΔC2L-LO expresses LO at a high level, thereby aggregating immune cells in the tumor lesion area, improving the immunosuppressive environment, and enhancing the anti-tumor effect. Animal experiments have shown that the vector can selectively kill tumor cells and eliminate some tumor-bearing mice.

[0025] (3) The tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO of the present invention has tumor targeting and anti-tumor effects, laying a foundation for the clinical application of tumor-targeted genetic engineering drugs and providing an effective method for tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the structure of tumor-targeted vaccinia virus vectors VVΔTKΔC2L and VVΔTKΔC2L-LO. Figure 2 Effects of tumor-targeted vaccinia virus vector VVΔTKΔC2L and control virus VVΔTK on common human tumors

[0027] Schematic diagram of cell killing ability.

[0028] Figure 3 Effects of tumor-targeted vaccinia virus vector VVΔTKΔC2L and control virus VVΔTK on common mouse tumors

[0029] Schematic diagram of the killing ability of tumor cells.

[0030] Figure 4 Effects of tumor-targeted vaccinia virus vectors VVΔTKΔC2L and VVΔTK on tumor-bearing C57BL / 6 mice

[0031] Comparison of treatment effects and tumor growth curves (DT6606 cells).

[0032] Figure 5 Tumor-targeted vaccinia virus vectors VVΔTKΔC2L and VVΔTK for the treatment of tumor-bearing C57BL / 6 mice

[0033] Comparison of therapeutic efficacy and tumor clearance rate (DT6606 cells).

[0034] Figure 6Effects of tumor-targeted vaccinia virus vectors VVΔTKΔC2L and VVΔTK on tumor-bearing C57BL / 6 mice

[0035] Comparison of treatment effects and tumor growth curves (TB11381 cells).

[0036] Figure 7 Comparison of the therapeutic effects of tumor-targeted vaccinia virus vectors VVΔTKΔC2L and VVΔTK on tumor-bearing C57BL / 6 mice and mouse survival curves (TB11381 cells).

[0037] Figure 8 Tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO and control virus VVΔTKΔC2L have a positive effect on normal

[0038] See the schematic diagram of the killing ability of human tumor cells.

[0039] Fig. 9 Tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO and control virus VVΔTKΔC2L have a positive effect on normal

[0040] See the schematic diagram of the killing ability of mouse tumor cells.

[0041] Fig.10 Tumor-targeted vaccinia virus vectors VVΔTKΔC2L-LO and VVΔTKΔC2L

[0042] Comparison of therapeutic effects and tumor growth curves in C57BL / 6 mice (DT6606 cells)

[0043] Fig.11 Tumor-targeted vaccinia virus vectors VVΔTKΔC2L-LO and VVΔTKΔC2L

[0044] Comparison of treatment effects and mouse survival curves in C57BL / 6 mice (DT6606 cells). DETAILED DESCRIPTION

[0045] The specific implementation modes of the present invention are further described in detail below in conjunction with the embodiments.

[0046] The vaccinia virus used in the embodiments of the present invention is a Lister strain, and vaccinia virus strains such as WR strain, Copenhagen strain, Weyth strain or Tiantan strain may also be used.

[0047] Example 1. Construction of tumor-targeted vaccinia virus vector VVΔTKΔC2L

[0048] (1) First, the gene fragments on both sides of the sequence C2L to be modified and the reporter gene red fluorescent protein (RFP) were obtained by gene synthesis. The upstream sequence of the C2L gene was called the left arm, and the downstream sequence was called the right arm. The left arm, the reporter gene, and the right arm were sequentially connected to the plasmid vector pUC57 by genetic engineering methods to construct the shuttle vector pUC-C2L.

[0049] The upstream sequence, downstream sequence, and red fluorescent protein reporter gene of C2L gene are SEQ ID NO: 1-SEQ ID NO: 3 respectively;

[0050] (2) gRNA was designed according to the C2L gene sequence (SEQ ID NO: 4), and the gRNA was connected to the PB-gRNA vector (Nucleic Acids Res (2014) 42: e155) to construct PB-gRNA-C2L;

[0051] (3) CV1 cells were seeded onto six-well plates. On the second day, when the cells reached a confluency of more than 90%, they were transfected with a mixed plasmid of CRASPR / Cas9 and PB-gRNA-C2L. After 24 hours, the cells were infected with VVΔTK (Gene Therapy (2015) 22, 476–484) that deleted the J2R gene of the VV wild-type vaccinia virus, and then transfected with pUC-C2L 2 hours later. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at a rate of 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After freezing and thawing the monoclonal solution, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope. This was the vaccinia virus vector VVΔTKΔC2L that deleted both the J2R and C2L genes (see Figure 1 ).

[0052] Depend on Figure 1 It can be seen that compared with the wild-type vaccinia virus (VV wild-type, GenBank: DQ121394.1), VVΔTKΔC2L has deleted both the J2R and C2L genes.

[0053] Example 2. Construction of tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO

[0054] (1) The LO gene sequence (SEQ ID NO: 5) was synthesized and ligated to form a pUC-LO gene fragment. The pUC-LO and pUC-C2L (Example 1) plasmids were double-digested with Sal I and Nhe I, and the LO and pUC-C2L fragments were purified respectively. Then, the excised LO gene fragment and pUC-C2L were ligated with T4 DNA polymerase to construct pUC-C2L-LO.

[0055] (2) On the first day, CV1 cells were inoculated into a six-well plate. On the second day, when the cells reached a confluence of more than 90%, they were transfected with a mixed plasmid of CRASPR / Cas9 and PB-gRNA-C2L at the same time. After 24 hours, VVΔTK, which deleted the J2R gene of the VV wild-type vaccinia virus, was infected. Two hours later, pUC-C2L-LO was transfected. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After the monoclonal solution was frozen and thawed, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the vaccinia virus vector VVΔTKΔC2L-LO (see Figure 1 ).

[0056] Depend on Figure 1 It can be seen that compared with the wild-type vaccinia virus (VV wild type), VVΔTKΔC2L-LO deleted the J2R and C2L genes and inserted the LO gene at the C2L position.

[0057] Example 3. Cytotoxicity of tumor-targeted vaccinia virus vector VVΔTKΔC2L and control virus VVΔTK against common human tumor cells

[0058] A549 (lung adenocarcinoma) cells and SKOV3 (ovarian cancer) cells in the logarithmic growth phase were collected, counted, and inoculated in 96-well plates at 2000 cells / well; HCT116 (colon cancer) cells were collected, counted, and inoculated in 96-well plates at 1000 cells / well. When cell adhesion was observed after 12 hours, the virus VVΔTKΔC2L and the control virus VVΔTK were diluted. The highest concentration of 100 pfu / cell was added to the 96-well plate, and each column decreased by 10 times, with the 10th column as a blank control. Six days later, the cell activity was detected by the MTS method, and then the cell activity was converted into EC 50 (i.e., the amount of virus required for each virus to kill 50% of tumor cells, EC 50 The lower the value, the stronger the killing ability of the virus).

[0059] Depend on Figure 2 It can be seen that compared with the control virus VVΔTK, VVΔTKΔC2L has a stronger killing ability against common human tumor cells.

[0060] Example 4. Detection of the killing ability of tumor-targeted vaccinia virus vector VVΔTKΔC2L and its control virus VVΔTK on common mouse tumor cells

[0061] DT6606 (pancreatic cancer) cells, mEC25 (esophageal cancer) cells, and TB11381 (pancreatic cancer) cells in the logarithmic growth phase were collected, counted, and inoculated into 96-well plates at 2000 cells / well. After 12 hours, when the cells adhered to the wall, the virus VVΔTKΔC2L and the control virus VVΔTK were diluted. The highest concentration of 100 pfu / cell was added to the 96-well plate, and each column decreased by 10 times, with the 10th column as a blank control. Six days later, the cell activity was detected by the MTS method, and then the cell activity was converted into EC 50 .

[0062] Depend on Figure 3 It can be seen that compared with the control virus VVΔTK, VVΔTKΔC2L has a stronger killing ability against common mouse tumor cells.

[0063] Example 5. Therapeutic effects of tumor-targeted vaccinia virus vector VVΔTKΔC2L and control virus VVΔTK on tumor-bearing C57BL / 6 mice

[0064] Pancreatic cancer cell line DT6606 (mouse pancreatic cancer cell line) was subcutaneously inoculated on the right back of 6-7 week-old male C57BL / 6 mice. Each C57BL / 6 mouse was inoculated with 2×10 6 cells, and the tumor reached 100 mm after 5 days 3 The mice were divided into three groups: treatment group, control group 1, and control group 2, with 6 mice in each group.

[0065] The treatment group was injected with 1×10 8 pfu / mouse VVΔTKΔC2L, control group 1 was injected with phosphate buffered saline (PBS), and control group 2 was injected with VVΔTK. The mice were treated once on the 1st, 2nd, and 4th day, and the tumor volume of the mice was measured regularly. The results are shown in Figure 4 , Figure 5 shown.

[0066] Depend on Figure 4 It can be seen that after three treatments, the tumor volumes of both the control group 2 (VVΔTK) and the treatment group (VVΔTKΔC2L) gradually decreased; after the 18th day, the tumor volume of the control group 2 (VVΔTK) gradually increased, while the tumor volume of the treatment group (VVΔTKΔC2L) increased, but the progression was relatively slow. It can be seen that VVΔTKΔC2L can inhibit the increase of mouse tumor volume better than VVΔTK, and has a better therapeutic effect.

[0067] Depend on Figure 5It can be seen that VVΔTKΔC2L can significantly inhibit tumor growth more than VVΔTK. Treatment with VVΔTKΔC2L vaccinia virus vector alone can completely eliminate 50% of tumors in C57BL / 6 mice, while VVΔTK can only eliminate 16.7% of tumors in C57BL / 6 mice (mouse cure rate).

[0068] Using the same experimental method as above, 6-7 week-old female C57BL / 6 mice were subcutaneously inoculated with pancreatic cancer cell line TB11381 (mouse pancreatic cancer cell line) on the right back. Each C57BL / 6 mouse was inoculated with 2×10 6 cells, and the tumor reached 100 mm after 5 days 3 The mice were divided into 3 groups, with 5 mice in each group. The treatment group was injected with 1×10 8 pfu / mouse VVΔTKΔC2L, control group 1 was treated with phosphate buffered saline (PBS), and control group 2 was treated with VVΔTK. The mice were treated once on the 1st, 2nd, and 4th day, and the tumor volume of the mice was measured regularly. The experimental results are shown in Figure 6 , Figure 7 shown.

[0069] Depend on Figure 6 It can be seen that after three treatments, the tumor volumes of both the control group 2 (VVΔTK) and the treatment group (VVΔTKΔC2L) gradually decreased, but 18 days later, the tumors of some mice in the control group 2 (VVΔTK) recurred, while the tumor volume of the mice in the treatment group (VVΔTKΔC2L) gradually shrank until it disappeared, that is, all were cured. This shows that VVΔTKΔC2L has a better therapeutic effect than VVΔTK.

[0070] Depend on Figure 7 It can be seen that as of the 100th day after the first treatment, the survival rate of mice in the treatment group (VVΔTKΔC2L) was as high as 100%, and the mouse tumors were completely eliminated, while some mice in the control group 2 (VVΔTK) had tumor recurrence, with a survival rate of 60%, and all mice in the control group 1 (PBS) died. This shows that VVΔTKΔC2L has a better therapeutic effect than VVΔTK and can prolong the survival time of mice.

[0071] Example 6. Detection of the killing ability of tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO and control virus VVΔTKΔC2L on common human tumor cells

[0072] HepG2 (liver tumor) cells, SUIT2 (pancreatic cancer) cells and Hela (cervical cancer) cells in the logarithmic growth phase were collected, counted, and inoculated in 96-well plates at 2000 cells / well; HCT116 (colon cancer) cells were collected, counted, and inoculated in 96-well plates at 1000 cells / well. After 12 hours, cell adhesion was observed, and the virus VVΔTKΔC2L-LO and control virus VVΔTKΔC2L were diluted. The highest concentration of 100 pfu / cell was added to a 96-well plate, and each column decreased by 10 times. The 10th column was a blank control. Six days later, the cell activity was detected by the MTS method, and then the cell activity was converted into EC 50 .

[0073] Depend on Figure 8 It can be seen that compared with the control virus VVΔTKΔC2L, VVΔTKΔC2L-LO has a stronger killing ability against common human tumor cells.

[0074] Example 7. Detection of the killing ability of tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO and control virus VVΔTKΔC2L on common mouse tumor cells

[0075] DT6606 (pancreatic cancer) cells and TB11381 (pancreatic cancer) cells in the logarithmic growth phase were collected, counted, and inoculated into 96-well plates at 2000 cells / well. After 12 hours, cell adhesion was observed, and the virus VVΔTKΔC2L-LO and the control virus VVΔTKΔC2L were diluted. The highest concentration of 100 pfu / cell was added to the 96-well plate, and each column decreased by 10 times, with the 10th column as a blank control. Six days later, the cell activity was detected by the MTS method, and then the cell activity was converted into EC 50 .

[0076] Depend on Fig. 9 It can be seen that compared with the control virus VVΔTKΔC2L, VVΔTKΔC2L-LO has a stronger killing ability against common mouse tumor cells.

[0077] Example 8 Comparison of therapeutic effects of tumor-targeted vaccinia virus vector VVΔTKΔC2L-LO and control virus VVΔTKΔC2L on tumor-bearing C57BL / 6 mice

[0078] Pancreatic cancer cell line DT6606 (mouse pancreatic cancer cell line) was subcutaneously inoculated on the right back of 6-7 week-old male C57BL / 6 mice. Each C57BL / 6 mouse was inoculated with 2×10 6 cells, and the tumor reached 120 mm after 5 days 3 The mice were divided into 3 groups, with 7 mice in each group. The treatment group was injected with VVΔTKΔC2L-LO, 5×10 7pfu / mouse, control group 1 was injected with phosphate buffered saline (PBS), and control group 2 was injected with VVΔTKΔC2L. The mice were treated once on the 1st, 2nd, and 4th day, and the tumor volume of the mice was measured regularly. The results are shown in Fig.10 shown.

[0079] Depend on Fig.10 It can be seen that the tumors in both the control group 2 and the treatment group gradually shrank in the first 6 days. After 9 days, the tumor in the control group 2 (VVΔTKΔC2L) grew rapidly, while the tumor in the treatment group (VVΔTKΔC2L-LO) grew slowly. It can be seen that VVΔTKΔC2L-LO can significantly inhibit tumor growth more than VVΔTKΔC2L, and has a better therapeutic effect.

[0080] Depend on Fig.11 It can be seen that on the 46th day after the first treatment, all the mice in the control group 1 (PBS) died; on the 66th day after the first treatment, all the mice in the control group 2 (VVΔTKΔC2L) died; as of the 73rd day when observation was stopped, about 71.4% of the mice in the treatment group (VVΔTKΔC2L-LO) were still alive; it can be seen that the treatment group (VVΔTKΔC2L-LO) can prolong the survival time of mice than the control group 2 (VVΔTKΔC2L) and has a better therapeutic effect.

[0081] The sequences SEQ ID NO:1-SEQ ID NO:5 involved in the present invention are as follows:

[0082] SEQ ID NO:1

[0083] TGGTGTTAGATAAAGACATAGATGTAGATATAGAAACTAAACTAAAGCCTAA

[0084] ACCCGCAGTTAGATTTGCCATTCTAGACAAGATGACTGCGGATATTAAACTA

[0085] ACGGATCTAGTCAGACATTATTTTAGATACATAGAACAAGATATACCACTAG

[0086] GTCCGTTGTTCAAAAAAATAGATTCGTACAGAACAAGAGCCATTAATAAGT

[0087] ATTCGAAAGAGTTAGGATTGGCTACTGAATACTTTAATAAGTACGGACATTT

[0088] AATGTTTTATACTCTCCCTATACCATATAACAGATTCTTTTGTAGAAATTCAAT

[0089] AGGCTTTTTAGCGGTTCTATCGCCTACGATAGGACACGTAAAAGCATTTTAT

[0090] AAATTCATAGAATATGTTTCTATAGATGATAGACGGAAATTTAAAAGGAAT

[0091] TAATGTCAAAATGATTTTTATAAAAATATTGAATATATAAACGTTTACATTATA

[0092] CTATAATTACTTATAGTACTTTAAGA

[0093] SEQ ID NO:2

[0094] ACGCGTCGAACATATATGGGCTTTTTATTATTTGTACGATGTCCAGGATAACA

[0095] TTTTTACGGATAAATAATATGAAGGTGGAGAGCGTGACGTTCCTGACATTG

[0096] TTGGGAATAGGATGCGTTCTATCATGCTGTACTATTCCGTCACGACCCATTAA

[0097] TATGAAATTTAAGAATAGTGTGGAGACTGATGCTAATGCTAATTACAACATA

[0098] GGAGACACTATAGAATATCTATGTCTACCTGGATACAGAAAGCAAAAAATG

[0099] GGACCTATATATGCTAAATGTACAGGTACTGGATGGACACTCTTTAATCAAT

[0100] GTATTAAACCGGAGATGCCCATCGCCTCGAGATATCGATAATGGCCAACTTGA

[0101] TATTGGTGGAGTAGACTTTGGCTCTAGTATAACGTACTCTTGTAATAGCGGA

[0102] TATCATTTGATCGGTGAATCTAAATCGTATTGTGAATTAGGATCTACTGGATC

[0103] TATGGTATGGAATCCCGAGGCACCTATTTGTGAATCTG

[0104] SEQ ID NO:3

[0105] ATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCG

[0106] CATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGC

[0107] GAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCA

[0108] AGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGT

[0109] ACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAG

[0110] AAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGA

[0111] GGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTTCAGGACGGCT

[0112] CCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCC

[0113] CCGTAATGCAGAAGAAGACTATGGGCTGGGAGGCCTCCACCGAGCGCCTG

[0114] TACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCT

[0115] GAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCA

[0116] AGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGAC

[0117] ATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGC

[0118] CGAGGGCCGCCACCACCTGTTCCTGTAG

[0119] SEQ ID NO:4: gRNA

[0120] CACATAGATCTACTACAGG

[0121] SEQ ID NO:5 LO gene sequence

[0122] ATGACCCACTACTACGAGGGCTTCCCTCAGAGCGACAGAGACGAGAAGAT

[0123] CAAGATGGTGAACGTGGACGAGCTGGAGGAGAGAGTGAAGAAGGTGATG

[0124] CCCGAGGGCGCCTACTATTACATCGCCTCCGGCGCCGAGAACGAGTGGACC

[0125] TGGAGAAACAACACCGCCGCCTTCAACCACTTTCAGATCGTGCCTAGAGC

[0126] CCTGACCGAGATGGCCGACCCTCAGACCGACACCGACTTCATGGGCATGC

[0127] ACCTGAAGACCCCCATCATGATCGCCCCCATCGCCTGCCACGGCATCGCTC

[0128] ACAAGGATGCCGAGGTGGCCACCCAAAAGGGCGCTGCCATGGCCGGCGCC

[0129] CTGTTCAGCAGCAGCACCTACGCCAACAAGAGCGTGGAGGAGATCGCCGC

[0130] TGCCGCCCCCGAGGCCCCTAGATTCTTTCAGCTGTACCTGAGCAAGGACTG

[0131] GAACTTCAACAAGATGGTGTTCGACGCCGTGAAGAAGGCCGGCTACCAAG

[0132] GCATCTTCCTGACCGTGGACGCCCTGGTGAGCGGCTACAGAGAGGCCAAC

[0133] CTGAGAACCAACTTCACCTACCCCGTGCCCCTGGACTTCTTCAAGAGATAC

[0134] CTGGGCGCCAAGGGCAAGGGGCAGAGCGTGGCTCAGATGTACGCCTCCTC

[0135] CGCTCAGAAGATCGGCCCCGAGGACGTGAAGAGAATCAAGAAGGAGAGC

[0136] GGCCTGCCCGTGTTCGTGAAGGGCGTGATGTGCGCCGAGGACGCCTACAA

[0137] GGCCATCGGCGCCGGCGCCGACGGCATCTACGTGACAAACCACGGCGGCA

[0138] GAGAAGTGGACGGCGCTCCCGCCACCATCGACGTGCTGCCCGAGATCGCC

[0139] CAAGCCGTGAACCACAGAGTGCCCATCATCTTCGACAGCGGCGTGAGAAG

[0140] AGGCAGCCACATCTTCAAGGCCCTCGCCCTGGGCGCCGATATCGTGGGCAT

[0141] TGGGAGACCCTATCTCTATGGGCTGGCCCTCGGCGGCGCCCACGGCGTGGC

[0142] CTCCGTGATCGAGCAGCTGAACGACGAGCTGAAGATCGACATGCAGCTGA

[0143] CCGGCTGCAAGACCATCGACGACGTGAAGCACGCCAAGCTGACCCACATC

[0144] GCCTACACCGCCGACAACCTGCCTAGCAACACCGACCCTAGCAGAAGAAA

[0145] GGAGTACCCCGTGACCGACGAGAACCAAGTGAAGCAGACCGACGCCGTG

[0146] TCCGGCGCCTCCAAGCTGGAGGGGAAGCCTGCTCCCGAACCCGAGGCCGA

[0147] CACCACAACCGGCGCCTCCGTGAGATGA。

Claims

1. A method for constructing an oncolytic vaccinia virus vector, characterized in that: The vaccinia virus is a Lister strain vaccinia virus, in which two intrinsic genes J2R and C2L of the virus are deleted, and any gene that is helpful for treating tumors or a gene used for infectious disease vaccines is inserted.

2. The method for constructing an oncolytic vaccinia virus vector according to claim 1, characterized in that: The gene for treating tumors is lactate oxidase gene.

3. The method for constructing an oncolytic vaccinia virus vector according to claim 1, characterized in that: The oncolytic vaccinia virus vector is VVΔTKΔC2L, and the construction method comprises the following steps: (1) The upstream sequence of the C2L gene SEQ ID NO: 1, the reporter gene red fluorescent protein SEQ ID NO: 3, and the downstream sequence of the C2L gene SEQ ID NO: 2 were sequentially connected to the plasmid vector pUC57 by gene synthesis to construct the shuttle vector pUC-C2L; (2) Designing the sequence gRNA according to the C2L gene sequence: SEQ ID NO: 4, and connecting the gRNA to the PB-gRNA vector to construct PB-gRNA-C2L; (3) CV1 cells were inoculated onto a six-well plate. When the cells reached a confluence of more than 90%, the CRASPR / Cas9 and PB-gRNA-C2L mixed plasmids were transfected simultaneously. After 24 hours, the J2R gene-deleted VVΔTK was infected, and after 2 hours, pUC-C2L was transfected. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After the monoclonal solution was frozen and thawed, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔC2L.

4. The method for constructing an oncolytic vaccinia virus vector according to claim 1 or 2, characterized in that: The oncolytic vaccinia virus vector is VVΔTKΔC2L-LO, and the construction method comprises the following steps: (1) The upstream sequence of the C2L gene SEQ ID NO: 1, the reporter gene red fluorescent protein SEQ ID NO: 3, and the downstream sequence of the C2L gene SEQ ID NO: 2 were sequentially connected to the plasmid vector pUC57 by gene synthesis to construct the shuttle vector pUC-C2L; (2) Designing the gRNA sequence SEQ ID NO: 4 according to the C2L gene sequence, and connecting the gRNA sequence to the PB-gRNA vector to construct PB-gRNA-C2L; (3) synthesizing the bacterial LO gene sequence SEQ ID NO:5 to obtain the pUC-LO gene fragment, double-digesting the pUC-LO and pUC-C2L plasmids with Sal I and Nhe I, purifying the digested LO and pUC-C2L fragments respectively, and then ligating the excised LO gene fragment and pUC-C2L with T4 DNA polymerase to construct pUC-C2L-LO; (4) CV1 cells were inoculated into a six-well plate. When the cells reached a confluence of more than 90%, the CRASPR / Cas9 and PB-gRNA-C2L mixed plasmids were transfected at the same time. After 24 hours, VVΔTK with the J2R gene deleted was infected, and pUC-C2L-LO was transfected after 2 hours. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After the monoclonal solution was frozen and thawed, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the oncolytic vaccinia virus vector VVΔTKΔC2L-LO.

5. Use of the oncolytic vaccinia virus vector VVΔTKΔC2L obtained by the construction method according to claim 3 in the preparation of a drug for treating tumors or infectious diseases.

6. Use of the oncolytic vaccinia virus vector VVΔTKΔC2L-LO obtained by the construction method according to claim 4 in the preparation of a drug for treating tumors or infectious diseases.

7. The use according to any one of claims 5 to 6, characterized in that: The tumor is a solid tumor, and the infectious disease is a viral, bacterial or fungal infectious disease.

8. The use according to claim 7, characterized in that The solid tumor includes pancreatic cancer, lung cancer, ovarian cancer, colon cancer, esophageal cancer, liver cancer or cervical cancer.

Images