Dual-fluorescence-labeled living cell sample of human-derived TREM2 protein as well as preparation method and application of dual-fluorescence-labeled living cell sample

Abstract

The invention provides a dual fluorescence labeled living cell sample of human-derived TREM2 protein as well as a preparation method and application thereof, and relates to the technical field of biomarkers, the preparation method comprises the following steps: S1, gene expansion and fusion: sequentially connecting a red fluorescent protein sequence, a TREM2 gene coding sequence and a green fluorescent protein sequence to obtain a recombinant gene; s2, inserting the recombinant gene into a lentiviral vector, and transferring the lentiviral vector into a plasmid to obtain a recombinant plasmid; s3, mixing the recombinant plasmids with the packaging plasmids to obtain mixed plasmids, transfecting a cell line with the mixed plasmids, culturing, centrifugally filtering, and taking supernate to obtain a lentivirus mixed solution; and S4, carrying out mixed infection on the lentivirus mixed solution and a target cell line to be infected to obtain the dual fluorescence labeled living cell sample fused with the human-derived TREM2 protein. According to the technical scheme provided by the invention, lentivirus infection is adopted, so that the distribution condition of TREM2 protein in a subcellular structure can be simultaneously observed in a living cell sample.

Description

Technical Field

[0001] The present invention relates to the field of biomarker technology, and in particular to a dual-fluorescence-labeled living cell sample of human TREM2 protein and a preparation method and application thereof. Background Art

[0002] With the development of fluorescent tracing and genetic engineering technology, researchers can use fluorescent microscopy to monitor relevant information of molecules in living cells in real time. The dual fluorescent protein labeling system is a commonly used technology in biological research. It uses two fluorescent dyes of different wavelengths to label two proteins or two different domains, thereby achieving the observation and analysis of the co-localization, interaction or dynamic process of these proteins.

[0003] At present, in the dual fluorescent labeling protein system, the fluorescent marker cannot efficiently bind to the target molecule, and there is a problem of non-specific binding. The fluorescent signal caused by non-specific binding will produce background noise, covering up the real signal, and the signal-to-noise ratio is low, making it impossible to accurately observe the dynamic process of subcellular structures. Summary of the invention

[0004] The main purpose of the present invention is to propose a dual fluorescence labeled living cell sample of human TREM2 protein and its preparation method and application, aiming to simultaneously observe the distribution of TREM2 protein in subcellular structures.

[0005] To achieve the above object, the present invention proposes a method for preparing a dual fluorescently labeled living cell sample of human TREM2 protein, comprising the following steps: S1. Gene expansion and fusion: The red fluorescent protein sequence, the TREM2 gene coding sequence and the green fluorescent protein sequence are sequentially connected to obtain a recombinant gene, wherein the TREM2 gene coding sequence is shown in SEQ ID NO.1; S2, inserting the recombinant gene into a lentiviral vector and then transferring it into a plasmid to obtain a recombinant plasmid; S3, mixing the recombinant plasmid with the packaging plasmid to obtain a mixed plasmid, transfecting the mixed plasmid into the HEK-293T cell line, culturing, centrifuging and filtering to obtain the supernatant, and obtaining a lentiviral mixed solution; S4. Infect the target cell line to be infected by mixing the lentiviral mixture to obtain a dual fluorescently labeled living cell sample fused with human TREM2 protein.

[0006] In one embodiment, step S2 includes the following steps: connecting the 5' end of the recombinant gene to the 3' end 32 bases downstream of the CMV promoter of the lentivirus insertion plasmid, inserting a Kozak sequence upstream of the 5' end of the recombinant gene, and connecting the 3' end of the recombinant gene to the 5' end of the WPRE sequence of the lentivirus insertion plasmid to obtain a recombinant plasmid.

[0007] In one embodiment, the red fluorescent protein includes mCherry protein, whose gene coding sequence is shown in SEQ ID NO.2; and / or, The green fluorescent protein includes copGFP protein, and its gene coding sequence is shown in SEQ ID NO.3.

[0008] The present invention also proposes a dual fluorescence-labeled living cell sample of human TREM2 protein, including a dual fluorescence-labeled living cell sample of fused human TREM2 protein prepared according to the preparation method as described above.

[0009] The present invention also provides a DNA molecule, comprising a red fluorescent protein sequence, a TREM2 gene coding sequence and a green fluorescent protein sequence sequentially connected in the 5' to 3' direction; The TREM2 gene coding sequence is shown in SEQ ID NO.1; The red fluorescent protein sequence is shown in SEQ ID NO.2; The green fluorescent protein sequence is shown in SEQ ID NO.3.

[0010] In one embodiment, the 5' end of the red fluorescent protein sequence is also connected to the secretory signal peptide gene coding sequence of the TREM2 protein; The secretory signal peptide gene coding sequence of the TREM2 protein is shown in SEQ ID NO.4.

[0011] The present invention also proposes an application of a dual fluorescently labeled living cell sample of human TREM2 protein in exploring the localization of TREM2 in different subcellular structures, characterized in that the subcellular structure includes at least one of an endoplasmic reticulum, a Golgi apparatus, a vesicle, a cell membrane, and a lysosome; The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described above.

[0012] The present invention also proposes the use of a dual fluorescently labeled living cell sample of human TREM2 protein in exploring the activation of TREM2 protein in integrated cells when a TREM2 ligand is applied and the loss level after enzyme cleavage, wherein the TREM2 ligand includes at least one of endotoxin, cell debris and amyloid protein; The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described above.

[0013] The present invention also proposes an application of a dual fluorescence-labeled living cell sample of human TREM2 protein in exploring the mechanism of TREM2 point mutation, wherein the dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described above.

[0014] The present invention also proposes an application of a dual fluorescence-labeled living cell sample of human TREM2 protein in exploring the circulation level of TREM2 protein in different organelles after recognizing different ligands, characterized in that the dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as mentioned above.

[0015] In the technical scheme of the present invention, exogenous recombinant genes are introduced into cells by lentiviral infection, so that the host cells express dual-fluorescence-labeled TREM2 proteins, so that the distribution of TREM2 proteins in the endoplasmic reticulum, Golgi apparatus, vesicles, cell membranes, and lysosomes can be simultaneously observed in living cell samples, and the level of enzymatic loss of the extracellular immunoglobulin domain when the TREM2 protein on the membrane surface is activated by the ligand can also be observed, and the circulation levels of TREM2 proteins in different membrane structures after different treatments can also be compared; by adopting the HEK-293T cell line, which is a human embryonic kidney cell line derived from HEK 293 cells and can continuously express mutants of SV40 large T antigen, this cell line is widely used in protein expression and virus packaging due to its high-efficiency transfection ability and ability to maintain a high copy number of exogenous genes, especially in the production of recombinant retroviruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 This is a fusion pattern diagram of the mCherry fluorescent protein, TREM2 protein and copGFP fluorescent protein encoding gene in Example 1 of the present invention; Figure 2 This is the expression and localization diagram of the fluorescent marker protein after HEK293T cells were infected by the lentivirus carrying the recombinant gene in Example 1 of the present invention; Figure 3 The cell morphology changes and the expression and location changes of the fluorescent protein after the application of endotoxin in Example 2 of the present invention; Figure 4 This is a schematic diagram of the loss of red fluorescence on the cell membrane due to the TREM2 point mutation in Example 3 of the present invention.

[0018] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings in conjunction with the embodiments. DETAILED DESCRIPTION

[0019] To make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them.

[0020] It should be noted that, in the embodiments, those without specifying specific conditions are carried out according to normal conditions or conditions recommended by the manufacturer. Those without specifying the manufacturer of reagents or instruments used are conventional products that can be purchased commercially. In addition, the meaning of "and / or" appearing in the full text includes three parallel schemes, and "A and / or B" is taken as an example, including schemes A, B, or A and B that meet the same time. In addition, the technical schemes between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in the field to achieve. When the combination of the technical schemes is contradictory or cannot be achieved, it should be considered that the combination of such technical schemes does not exist, and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work, all belong to the scope of protection of the present invention.

[0021] With the development of fluorescent tracing and genetic engineering technology, researchers can use fluorescent microscopy to monitor relevant information of molecules in living cells in real time. The dual fluorescent protein labeling system is a commonly used technology in biological research. It uses two fluorescent dyes of different wavelengths to label two proteins or two different domains, thereby achieving the observation and analysis of the co-localization, interaction or dynamic process of these proteins.

[0022] At present, in the dual fluorescent labeling protein system, the fluorescent marker cannot efficiently bind to the target molecule, and there is a problem of non-specific binding. The fluorescent signal caused by non-specific binding will produce background noise, covering up the real signal, and the signal-to-noise ratio is low, making it impossible to accurately observe the dynamic process of subcellular structures.

[0023] For this reason, please see Figures 1 to 4 The present invention provides a method for preparing a dual fluorescently labeled living cell sample of human TREM2 protein, comprising the following steps: S1. Gene expansion and fusion: The red fluorescent protein sequence, the TREM2 gene coding sequence and the green fluorescent protein sequence are sequentially connected to obtain a recombinant gene, wherein the TREM2 gene coding sequence is shown in SEQ ID NO.1; S2, inserting the recombinant gene into a lentiviral vector and then transferring it into a plasmid to obtain a recombinant plasmid; S3, mixing the recombinant plasmid with the packaging plasmid to obtain a mixed plasmid, transfecting the mixed plasmid into the HEK-293T cell line, culturing, centrifuging and filtering to obtain the supernatant, and obtaining a lentiviral mixed solution; S4. Infect the lentiviral mixture with the target cell line to be infected to obtain a dual fluorescently labeled living cell sample fused with human TREM2 protein.

[0024] In the technical scheme of the present invention, exogenous recombinant genes are introduced into cells by lentiviral infection, so that the host cells express dual-fluorescence-labeled TREM2 proteins, so that the distribution of TREM2 proteins in the endoplasmic reticulum, Golgi apparatus, vesicles, cell membranes, and lysosomes can be simultaneously observed in living cell samples, and the level of enzymatic loss of the extracellular immunoglobulin domain when the TREM2 protein on the membrane surface is activated by the ligand can also be observed, and the circulation levels of TREM2 proteins in different membrane structures after different treatments can also be compared; by adopting the HEK-293T cell line, which is a human embryonic kidney cell line derived from HEK 293 cells and can continuously express mutants of SV40 large T antigen, this cell line is widely used in protein expression and virus packaging due to its high-efficiency transfection ability and ability to maintain a high copy number of exogenous genes, especially in the production of recombinant retroviruses.

[0025] The advantages of the dual fluorescent protein labeling system mainly include: 1. Accurate co-localization analysis: Through dual fluorescent labeling, it is possible to accurately determine whether two proteins appear in the same location in the cell, which is crucial for studying the interaction between proteins or the biological processes in which they participate together; 2. Real-time dynamic monitoring: Dual fluorescent labeling allows researchers to track protein movement and distribution changes in real time, which is very useful for understanding the dynamic behavior of proteins in the cell cycle, signal transduction or disease development; 3. High sensitivity and specificity: Each fluorescent dye has its own unique excitation and emission spectrum, which allows them to be detected individually in a complex cellular environment, reducing background interference and improving the sensitivity and specificity of the experiment; 4. Multi-parameter analysis: Dual fluorescent labeling can provide information about two proteins at the same time, which makes multi-parameter analysis possible and helps to reveal more complex biological phenomena; 5. Strong compatibility: This technology can be used in combination with a variety of microscopy techniques (such as confocal laser scanning microscopy, super-resolution microscopy, etc.), expanding its application range in different research fields; 6. Quantitative analysis: The dual fluorescence labeling system can be used for quantitative analysis. By measuring the intensity ratio of the two fluorescences, quantitative data on protein expression levels or interaction strength can be obtained. 7. Reduce false positive results: Since two independent labeling methods are used, false positive results caused by failure of a single labeling can be reduced, thus improving the reliability of the experiment.

[0026] It should be noted that TREM2 protein is a receptor for amyloid β protein 42, lipoprotein particles and apolipoproteins. TREM2 protein participates in cell proliferation, apoptosis, etc. through Wnt / β, MTOR, PI3K and NF-kappa-B signaling pathways. TREM2 protein is expressed by macrophages, immature monocyte-derived dendritic cells, osteoclasts and microglia, and can activate immune response.

[0027] Lentiviruses can infect many types of cells, including dividing and non-dividing cells, so the cell lines suitable for lentivirus infection are very wide. Therefore, in this protocol, the target cell line can be most cell lines. For example, if you want to observe the level of TREM2 cleavage by metalloproteins (ADAM10 / 17), you need to use cells expressing this protease. It is reported that ADAM10 / 17 is expressed in a variety of cell types and is involved in regulating the shearing and dissociation of cell surface molecules. It is common in digestive system tumors, such as esophageal cancer, gastric cancer, colorectal cancer, liver cancer, pancreatic cancer, and gallbladder cancer; neuroblastoma, such as human neuroblastoma cells (SH-SY5Y); breast cancer.

[0028] The sequence SEQ ID NO. 1 is as follows: .

[0029] In one embodiment, step S2 includes the following steps: connecting the 5' end of the recombinant gene to the 3' end 32 bases downstream of the CMV promoter of the lentivirus insertion plasmid, inserting a Kozak sequence upstream of the 5' end of the recombinant gene, and connecting the 3' end of the recombinant gene to the 5' end of the WPRE sequence of the lentivirus insertion plasmid to obtain a recombinant plasmid.

[0030] The Kozak sequence is shown in SEQ ID NO.5: GCCGCCATGG; The sequence of the lentiviral vector is shown in SEQ ID NO.6: aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttac gctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttg tataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgt ttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccct ccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgac aattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcg gcctcttccgcgtctccgccttcgccctcagacgagtcggatctccctttggccgcctccccgcgtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggattt ccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgta acaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct ctctggctaactagagaacccactgcGCCGCC (SEQ ID NO. 6).

[0031] Wherein, the CMV promoter sequence is shown in SEQ ID NO.7: aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttac gctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttg tataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgt ttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccct ccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgac aattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcg gcctcttccgcgtctccgccttcgccctcagacgagtcggatctccctttggccgcctccccgc (SEQ ID NO.7); The WPRE sequence is shown in SEQ ID NO.8: gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtct ccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactcc gccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct( SEQ ID NO.8).

[0032] In one embodiment, the red fluorescent protein includes mCherry protein, whose gene coding sequence is shown in SEQ ID NO.2; and / or, The green fluorescent protein includes copGFP protein, and its gene coding sequence is shown in SEQ ID NO.3.

[0033] The present invention also proposes a dual fluorescence-labeled living cell sample of human TREM2 protein, including a dual fluorescence-labeled living cell sample of fused human TREM2 protein prepared according to the preparation method as described above.

[0034] The present invention also provides a DNA molecule, comprising a red fluorescent protein sequence, a TREM2 gene coding sequence and a green fluorescent protein sequence sequentially connected in the 5' to 3' direction; The TREM2 gene coding sequence is shown in SEQ ID NO.1; The red fluorescent protein sequence is shown in SEQ ID NO.2; The green fluorescent protein sequence is shown in SEQ ID NO.3.

[0035] The sequence SEQ ID NO. 2 is as follows: GTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCtGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG; The sequence SEQ ID NO.3 is as follows: .

[0036] In one embodiment, the 5' end of the red fluorescent protein sequence is also connected to the secretory signal peptide gene coding sequence of the TREM2 protein; The secretory signal peptide gene coding sequence of the TREM2 protein is shown in SEQ ID NO.4.

[0037] The sequence SEQ ID NO.4 is as follows: ATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAAC.

[0038] It should be noted that in the signal peptide (SPP) gene coding sequence, the "ATGG" sequence at the 5' end is repeated with the "ATGG" sequence at the 3' end of the Kozak sequence, and only one of them can be removed during the connection.

[0039] The present invention also proposes an application of a dual fluorescently labeled living cell sample of human TREM2 protein in exploring the localization of TREM2 in different subcellular structures, characterized in that the subcellular structure includes at least one of an endoplasmic reticulum, a Golgi apparatus, a vesicle, a cell membrane, and a lysosome; The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described above.

[0040] The present invention also proposes the use of a dual fluorescently labeled living cell sample of human TREM2 protein in exploring the activation of TREM2 protein in integrated cells when a TREM2 ligand is applied and the loss level after enzyme cleavage, wherein the TREM2 ligand includes at least one of endotoxin, cell debris and amyloid protein; The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described above.

[0041] The present invention also proposes an application of a dual fluorescence-labeled living cell sample of human TREM2 protein in exploring the mechanism of TREM2 point mutation, wherein the dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described above.

[0042] The present invention also proposes an application of a dual fluorescence-labeled living cell sample of human TREM2 protein in exploring the circulation level of TREM2 protein in different organelles after recognizing different ligands, characterized in that the dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the aforementioned method for preparing the dual fluorescence-labeled living cell sample of human TREM2 protein, or the dual fluorescence-labeled living cell sample of human TREM2 protein as mentioned above.

[0043] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only used to explain the present invention, and are not used to limit the present invention.

[0044] Experimental Materials Unless otherwise specified, the reagents and materials used in the examples of the present invention are commercially available.

[0045] Among them, PEI (polyethyleneimine) used polyethylene infection / transfection reagent (TR-1003, Sigma), and the specific configuration method of the transfection reagent refers to the product instructions; reduced serum culture medium Opti-MEM (51985091, ThermoFisher); the lentiviral vector used was pCDH-CMV-MCS-EF1-Hygro, and the packaging plasmids were psPAX2 and pMD2.G.

[0046] Example 1 The method for preparing a live cell sample with dual fluorescence labeling of human TREM2 protein includes the following steps: 1. Gene expansion and fusion: Amplify the green fluorescent protein copGFP, the red fluorescent protein mCherry and the TREM2 protein from the cell sample cDNA library or plasmid respectively, separate the secretion signal peptide encoding gene of the TREM2 protein and connect it to the 5' end of the mCherry coding sequence after removing the start codon, connect the TREM2 gene coding sequence after removing the secretion signal peptide to the 3' end of the mCherry coding sequence after removing the 3' end stop codon, connect the 5' end of the copGFP coding sequence after removing the start codon to the TREM2 coding sequence after removing the 3' end stop codon, and retain the 3' end stop codon of the copGFP coding sequence (see Figure 1 ).

[0047] 2. Construct a plasmid: insert the recombinant gene into a lentiviral vector. Specifically, connect the 5' end of the recombinant gene to the 3' end 32 bases downstream of the CMV promoter of the lentiviral insertion plasmid, insert a Kozak sequence upstream of the 5' end of the recombinant gene to increase the expression level of the fusion protein, connect the 3' end of the recombinant gene to the 5' end of the WPRE sequence of the lentiviral insertion plasmid, and construct a plasmid for stable and high-quantity expression of the above-mentioned dual-fluorescence-labeled TREM2 protein.

[0048] 3. Lentivirus packaging: Culture HEK-293T cell lines in 10cm cell culture dishes until the cell density reaches 70%; pipette 20μg of the correctly sequenced plasmids and packaging plasmids (psPAX2 and pMD2.G) together in a ratio of 4:3:1, add the mixed plasmids to a 1.5ml centrifuge tube containing 500μl opti-DMEM and mix well; add 20μl PEI transfection reagent to a 1.5ml centrifuge tube containing 500μl opti-DMEM and mix well, let stand at room temperature for 3-5 min, transfer the liquid in the PEI tube to the plasmid tube, mix well, and let stand at room temperature for 15 min; mix the above mixture with freshly prepared DMEM culture medium containing 10% FBS and add it to a 10cm culture dish, place the culture dish in an incubator for 12 hours, replace with fresh culture medium, and collect the culture supernatant after 48 hours for centrifugation (4000 rpm / 10 The culture medium was drawn up using a 10 ml syringe and filtered through a 0.45 μm filter to obtain the lentiviral supernatant to obtain a crude lentiviral product.

[0049] 4. Cell infection: Add the crude lentiviral solution and freshly prepared cell culture medium in a 1:1 volume ratio to the target cell line culture dish to be infected. Replace the fresh culture medium 24 hours after infection, and observe the expression and localization of the dual fluorescent marker protein under a fluorescence microscope with an excitation wavelength of 488 nm and 562 nm after 48 hours (see Figure 2 ).

[0050] Example 2 The preparation and observation of dual fluorescent labeled live cell samples of endotoxin-treated human TREM2 protein include the following steps: 1. Preparation of dual-fluorescence-labeled TREM2-expressing cells; the method is the same as Example 1.

[0051] 2. Endotoxin treatment: Purchase Lipopolysaccharides, from E. coli O55:B5 (MCE), and prepare the storage solution according to the product instructions; subculture the stably transfected cells into new culture dishes, and keep the cell density at a moderate level for easy handling; divide the cells into a control group and a treatment group. The control group is added with an equal volume of sterile culture medium without endotoxin, and the treatment group is added with culture medium containing a predetermined concentration (10 ng / ml) of endotoxin. The culture dishes are placed in an incubator and cultured for 48 hours.

[0052] 3. Transfer the culture dish to a fluorescence microscope and observe the fluorescence distribution at excitation wavelengths of 488 nm and 562 nm respectively.

[0053] The fluorescence distribution diagram of Example 2 is as follows Figure 3As shown, it can be found that the cells grow synapse-like structures, indicating cytoskeleton remodeling; bright clusters appear in the cells, indicating that the cell's phagocytic ability is improved.

[0054] Example 3 The preparation and observation of dual fluorescent labeled live cell samples of human TREM2 point mutation protein include the following steps: 1. Construction of a dual fluorescent labeled living cell sample of human TREM2 point mutation protein: The method is the same as Example 1, except that the original gene sequence of TREM2 is subjected to point mutation treatment.

[0055] 2. Cell culture: Because gene point mutations may reduce the stability of protein structure and expose protease recognition sites, the cell line stably expressing the TREM2 (H157A) point mutation gene is placed in an incubator and cultured for 48 hours or longer.

[0056] 3. Transfer the culture dish to a fluorescence microscope and detect the fluorescence distribution at excitation wavelengths of 488 nm and 562 nm respectively.

[0057] The fluorescence distribution diagram of Example 3 is as follows Figure 4 As shown, it can be found that before the protein is localized to the cell membrane, that is, in the endoplasmic reticulum, Golgi apparatus and vesicle stages, the dual-color fluorescence overlap is high, indicating that the fluorescence has not yet been separated; while the dual-color fluorescence overlap on the cell membrane is low, showing high green fluorescence signals and low red fluorescence signals, indicating that the red fluorescence connected to the extracellular end of TREM2 is lost, which may be due to the enzymatic cleavage of the TREM2 protein.

[0058] The above description is only a preferred embodiment of the present invention, and does not limit the patent scope of the present invention. All equivalent structural changes made by using the contents of the present invention specification under the inventive concept of the present invention, or directly / indirectly applied in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. A method for preparing a dual fluorescently labeled living cell sample of human TREM2 protein, characterized in that: The steps include: S1. Connect the red fluorescent protein sequence, the TREM2 gene coding sequence and the green fluorescent protein sequence in sequence to obtain a recombinant gene, wherein the TREM2 gene coding sequence is as shown in SEQ ID NO.1; S2, inserting the recombinant gene into a lentiviral vector and then transferring it into a plasmid to obtain a recombinant plasmid; S3, mixing the recombinant plasmid with the packaging plasmid to obtain a mixed plasmid, transfecting the mixed plasmid into the HEK-293T cell line, culturing, centrifuging and filtering to obtain the supernatant, and obtaining a lentiviral mixed solution; S4. Infect the lentiviral mixture with the target cell line to be infected to obtain a dual fluorescently labeled living cell sample fused with human TREM2 protein.

2. The method for preparing a dual fluorescently labeled living cell sample of human TREM2 protein according to claim 1, characterized in that: Step S2 includes: connecting the 5' end of the recombinant gene to the 3' end 32 bases downstream of the CMV promoter of the lentivirus insertion plasmid, inserting a Kozak sequence upstream of the 5' end of the recombinant gene, and connecting the 3' end of the recombinant gene to the 5' end of the WPRE sequence of the lentivirus insertion plasmid to obtain a recombinant plasmid.

3. The method for preparing a dual fluorescently labeled living cell sample of human TREM2 protein according to claim 1, characterized in that: In step S1, the red fluorescent protein includes mCherry protein, and its gene coding sequence is shown in SEQ ID NO.2; and / or, In step S1, the green fluorescent protein includes copGFP protein, and its gene coding sequence is shown in SEQ ID NO.

3.

4. A dual fluorescent labeled living cell sample of human TREM2 protein, characterized in that: It comprises a dual fluorescence labeled living cell sample fused with human TREM2 protein prepared by the preparation method as described in any one of claims 1 to 3.

5. A DNA molecule, characterized in that It includes a red fluorescent protein sequence, a TREM2 gene coding sequence and a green fluorescent protein sequence connected in sequence from 5' to 3' direction; The TREM2 gene coding sequence is shown in SEQ ID NO.

1.

6. The DNA molecule according to claim 5, characterized in that The 5' end of the red fluorescent protein sequence is also connected to a secretory signal peptide gene coding sequence of the TREM2 protein, and the secretory signal peptide gene coding sequence of the TREM2 protein is shown in SEQ ID NO.4; The red fluorescent protein sequence is shown in SEQ ID NO.2; The green fluorescent protein sequence is shown in SEQ ID NO.

3.

7. Application of a dual fluorescently labeled living cell sample of human TREM2 protein to explore the localization of TREM2 in different subcellular structures, characterized in that: The subcellular structure includes at least one of an endoplasmic reticulum, a Golgi apparatus, a vesicle, a cell membrane, and a lysosome; The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the dual fluorescence-labeled living cell sample preparation method of human TREM2 protein as described in any one of claims 1 to 3, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described in claim 4.

8. Application of a dual fluorescently labeled living cell sample of human TREM2 protein in exploring the activation of TREM2 protein in integrated cells when a TREM2 ligand is applied and the loss level after enzyme cleavage, characterized in that: The TREM2 ligand comprises at least one of endotoxin, cell debris and amyloid protein; The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the dual fluorescence-labeled living cell sample preparation method of human TREM2 protein as described in any one of claims 1 to 3, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described in claim 4.

9. Application of a dual fluorescently labeled living cell sample of human TREM2 protein in exploring the mechanism of TREM2 point mutation, characterized in that: The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the dual fluorescence-labeled living cell sample preparation method of human TREM2 protein as described in any one of claims 1 to 3, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described in claim 4.

10. An application of a dual fluorescently labeled living cell sample of human TREM2 protein in exploring the circulation level of TREM2 protein in different organelles after recognizing different ligands, characterized in that: The dual fluorescence-labeled living cell sample of human TREM2 protein includes the dual fluorescence-labeled living cell sample of human TREM2 protein prepared by the dual fluorescence-labeled living cell sample preparation method of human TREM2 protein as described in any one of claims 1 to 3, or the dual fluorescence-labeled living cell sample of human TREM2 protein as described in claim 4.

Images