Application of glycyrrhizic acid in preparation of medicine for relieving toxic and side effects of osimertinib

Abstract

The invention discloses application of glycyrrhizic acid in preparation of a medicine for relieving toxic and side effects of osimertinib. In an in-vitro HaCaT cell strain, glycyrrhizic acid can significantly improve the survival rate of keratinocytes under the action of osimertinib, reduce the apoptosis rate, reduce the expression level of Cleved PARP and a DNA damage marker gamma-H2A. X protein of the cells, and reduce the transcriptional level of inflammation-related factors CCL2, CCL27, IL18, TNF alpha and IL6. In an osimertinib-induced mouse skin toxicity model, glycyrrhizic acid can significantly improve skin unhairing and rash symptoms, recover the expression level of Ki67 and improve proliferation disorder caused by osimertinib; the osimertinib can obviously reduce the number of green fluorescent cells in epidermal tissues, recover the thickness of mouse epidermis, improve the phenomenon of epidermis damage, effectively relieve the toxic and side effects of osimertinib, obviously improve rash, unhairing and inflammatory response caused by osimertinib and improve the safety of osimertinib.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and specifically relates to the application of glycyrrhizic acid in the preparation of a drug for reducing the toxic and side effects of osimertinib, and is the application of glycyrrhizic acid in the treatment of skin toxicity induced by osimertinib, an epidermal growth factor receptor inhibitor drug. Background Art

[0002] Osimertinib (trade name Tagrisso) is an oral third-generation EGFR-TKI that has significant efficacy against non-small cell lung cancer with EGFR mutations, especially the T790M resistance mutation. It can irreversibly inhibit EGFR with EGFRm (Exon 19deletion [Ex19del] / L858R) and EGFR T790M resistance mutations, thus showing good clinical efficacy. Osimertinib has shown longer progression-free survival (PFS) than first-generation EGFR-TKIs (such as erlotinib or gefitinib) in patients with advanced NSCLC who are positive for EGFR T790M mutations.

[0003] In the FLAURA study, osimertinib as first-line treatment significantly prolonged the median PFS to 18.9 months compared with standard EGFR-TKI (erlotinib or gefitinib), compared with 10.2 months in the control group. Based on this study result, osimertinib was approved for first-line treatment, and more and more clinical guidelines recommend it as a first-line preferred option for EGFR-sensitive mutation NSCLC.

[0004] Compared with first- and second-generation EGFR-TKIs, osimertinib has a lower severity of skin toxicity, but the incidence is still above 30%. Common skin adverse reactions include acne-like rash, itching, dry skin, and paronychia.

[0005] Currently, there is no effective means to prevent and treat osimertinib-induced skin toxicity. The only clinical approach is to reduce the dose or stop the drug, which not only seriously affects the quality of life of patients, but also leads to dose adjustment or treatment interruption, ultimately leading to tumor progression. Therefore, in-depth research on the molecular mechanism of osimertinib-induced skin toxicity and finding effective therapeutic drugs based on this are of great practical significance for the safe, effective and widespread clinical application of osimertinib.

[0006] Glycyrrhizic acid is the main active ingredient of licorice. Studies have shown that glycyrrhizic acid has multiple effects such as anti-inflammatory, antiviral, anti-tumor and organ protection, and has good therapeutic effects and high safety. However, no studies have shown that it can be used to treat the toxic side effects caused by osimertinib. Summary of the invention

[0007] The purpose of the present invention is to provide an application of glycyrrhizic acid in the preparation of a drug for alleviating the toxic side effects of osimertinib. The drug is a drug that can be used to alleviate the toxic reactions induced by osimertinib and can alleviate the skin toxic side effects caused by the use of osimertinib alone.

[0008] To achieve the above object, the present invention adopts the following technical solution:

[0009] The present invention provides the use of glycyrrhizic acid in the preparation of a drug for reducing the skin toxicity and side effects of osimertinib. The CAS number of the glycyrrhizic acid is 53956-04-0, and the molecular formula is C 42 H 62 O 16 , molecular weight is 822.96.

[0010] The present invention has demonstrated through in vitro cell experiments and in vivo mouse experiments that glycyrrhizic acid has a significant inhibitory effect on osimertinib-induced skin toxicity, and can be used to treat osimertinib-induced skin toxicity, thereby expanding the clinical application of osimertinib.

[0011] The glycyrrhizic acid used in the in vivo experiments in this study was in the form of its ammonium salt with a purity of >95%.

[0012] Furthermore, the skin toxicity and side effects of osimertinib include: hair loss and rash in mice.

[0013] Furthermore, the skin toxicity and side effects of osimertinib include: reduced epidermal thickness in mice and decreased proliferation markers.

[0014] Furthermore, the skin toxicity and side effects of osimertinib include: upregulation of the expression levels of keratinocyte apoptosis-related proteins c-PARP and c-Caspase-3.

[0015] Preferably, the dosage of glycyrrhizic acid is 30 mg / kg. Studies have shown that this dosage is a safe and effective dosage.

[0016] The present invention provides an effective therapeutic drug for skin toxicity induced by EGFR inhibitors such as osimertinib. Studies have shown that compared with the osimertinib monotherapy group, the combined use of glycyrrhizic acid can significantly inhibit the apoptosis of keratinocytes in the epidermal tissue of mice and reduce the damage to the epidermal tissue of mice. In addition, the dosage of glycyrrhizic acid is low and has no effect on animal survival, normal skin function, etc., indicating that glycyrrhizic acid is reasonable and safe as a protective agent and has high feasibility.

[0017] The pharmaceutically acceptable carrier is a filler, a wetting agent, a binder, a disintegrant or a lubricant.

[0018] The drug dosage form is a liquid preparation or a solid preparation, including oral solid preparations, oral liquid preparations, injections, lyophilized powder injections, large infusion dosage forms, patches, ointments, gels, soft capsules or suppositories.

[0019] The present invention has the following beneficial effects:

[0020] (1) The present invention provides a new use of glycyrrhizic acid in the preparation of a preparation for treating osimertinib drug toxicity. Glycyrrhizic acid can significantly improve and alleviate the rash, desquamation and inflammatory response caused by osimertinib, and reduce keratinocyte apoptosis and inflammation caused by osimertinib. Glycyrrhizic acid can effectively reduce the toxic and side effects of osimertinib, improve the safety of osimertinib, and expand its clinical application.

[0021] (2) Glycyrrhizic acid has low dosage, high safety and moderate price. It can be made into appropriate dosage forms according to needs and has high clinical feasibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Glycyrrhizic acid reversed the keratinocyte survival rate decreased by osimertinib.

[0023] Figure 2 Glycyrrhizic acid inhibits osimertinib-induced keratinocyte apoptosis, where (A) is a representative graph of the expression of apoptosis-related protein Cleaved PARP in keratinocytes after glycyrrhizic acid combined with osimertinib, and (B) is a statistical graph of the expression level of apoptosis protein.

[0024] Figure 3 Representative diagram showing that glycyrrhizic acid upregulates the DNA damage marker γ-H2A.X.

[0025] Figure 4 Glycyrrhizic acid restores the level of inflammatory factors in keratinocytes. (A) is a statistical chart of the transcriptional level changes of inflammatory factors CCL2, CCL27, and IL18, and (B) is a statistical chart of TNFα and IL6 levels.

[0026] Figure 5 Glycyrrhizic acid improves osimertinib-induced skin toxicity, where (A) is the appearance of mouse abdominal skin, and (B) is the immunohistochemistry of mouse proliferation marker Ki67.

[0027] Figure 6 Glycyrrhizic acid inhibits osimertinib-induced apoptosis of mouse skin keratinocytes, where (A) is hematoxylin-eosin (H&E) staining of mouse skin tissue, and (B) is TUNEL staining of mouse abdominal skin tissue.

[0028] Figure 7 Glycyrrhizic acid reverses the reduction in epidermal thickness caused by osimertinib. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments. The following examples are only used to illustrate the present invention and are not intended to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements made to the inventive method, steps or conditions all belong to the scope of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0031] Glycyrrhizic acid (CAS No. 53956-04-0), the ammonium salt molecular formula is C 42 H 62 O 16 ·NH 3 , molecular weight 839.96, purchased from Sigma-Aldrich. Human keratinocytes HaCaT, purchased from the Cell Resource Center of the Basic Medical College of Peking Union Medical College, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. Osimertinib (CAS No. 1421373-65-0), purchased from Taoshu Biotechnology Co., Ltd.

[0032] Example 1

[0033] Human keratinocytes HaCaT were used as the research object, and four groups were set up, namely the control group, osimertinib group, glycyrrhizic acid group, and glycyrrhizic acid and osimertinib combination group. The dose of osimertinib was 0.5μM, the dose of glycyrrhizic acid was 50μM, and the control group was solvent dimethyl sulfoxide (DMSO). After 24 hours of co-administration, CCK8 staining was used to detect the survival rate of HaCaT cells. The calculation formula is: cell survival rate of the drug administration group = (average absorbance value of the drug administration group cells) / (average absorbance value of the control group cells) × 100%.

[0034] The experimental results are described in detail as follows: Figure 1 As shown, the average survival rates of HaCaT cells in the control group, osimertinib group, glycyrrhizic acid group and combination group were 100.00%, 76.86%, 101.90% and 87.26%, respectively. Compared with the osimertinib alone group, the cell survival rate of the combination group was significantly improved (p=0.0342), indicating that the combined use of glycyrrhizic acid can significantly improve the survival rate of keratinocytes under the action of osimertinib.

[0035] Example 2 Human keratinocytes HaCaT were used as the research object, and four groups were set up, namely control group, osimertinib group, glycyrrhizic acid group, and glycyrrhizic acid and osimertinib combination group. The dose of osimertinib was 0.5μM, the dose of glycyrrhizic acid was 50μM, and the control group was solvent dimethyl sulfoxide (DMSO). After 24 hours of co-administration, Western Blot technology was used to detect the expression of apoptosis-related proteins.

[0036] The experimental results are described in detail as follows: Figure 2 The results showed that when osimertinib acted alone on keratinocytes, it significantly upregulated the expression of the apoptosis-related protein Cleaved PARP. After combined use with glycyrrhizic acid, the expression level of Cleaved PARP protein in cells was significantly reduced, indicating that combined use of glycyrrhizic acid can significantly reverse osimertinib-induced keratinocyte apoptosis.

[0037] Human keratinocytes HaCaT were used as the research object, and four groups were set up, namely the control group, osimertinib group, glycyrrhizic acid group, and glycyrrhizic acid and osimertinib combination group. The dose of osimertinib was 0.5μM, the dose of glycyrrhizic acid was 50μM, and the control group was solvent dimethyl sulfoxide (DMSO). After 24 hours of co-administration, the expression of cellular DNA damage marker γ-H2A.X protein was detected by Western Blot technology.

[0038] like Figure 3 The results showed that osimertinib significantly upregulated the expression of γ-H2A.X protein, a DNA damage marker, in keratinocytes when used alone. When used in combination with glycyrrhizic acid, the expression level of γ-H2A.X protein, a DNA damage marker, was significantly reduced.

[0039] Example 3 Human keratinocytes HaCaT were used as the research objects. Four groups were set up, namely control group, osimertinib group, glycyrrhizic acid group and glycyrrhizic acid and osimertinib combined group. The dose of osimertinib was 0.5μM, the dose of glycyrrhizic acid was 50μM, and the control group was solvent dimethyl sulfoxide (DMSO). After 48 hours of co-administration, the expression levels of cellular inflammatory factors were detected by RT-qPCR and ELISA techniques. The upstream primer sequence of CCL2 was ccaataggaagatctcagtgcag, and the downstream primer sequence was aatcctgaacccacttctgc; the upstream primer sequence of CCL27 was cctgctgctgtcattgctcctg, and the downstream primer sequence was acctggatgaccttcctcagtagc; the upstream primer sequence of IL18 was cattgaccaaggaaatcggc, and the downstream primer sequence was cacagatagttacagccatacc.

[0040] The experimental results are described in detail as follows: Figure 4 As shown in A, after osimertinib acted on keratinocytes alone, the transcription levels of CCL2, CCL27, and IL18 increased significantly. After combined use with glycyrrhizic acid, the expression levels of CCL2, CCL27, and IL18 decreased significantly. Figure 4 As shown in B, after osimertinib acted on keratinocytes alone, the transcription levels of TNFα and IL6 increased significantly, and after combined use of glycyrrhizic acid, the expression levels of TNFα and IL6 decreased significantly.

[0041] Example 4 Thirty-two male C57BL / 6 mice aged 6-8 weeks and weighing 20-23g were randomly divided into 4 groups, namely the control group, osimertinib group, glycyrrhizic acid group, and glycyrrhizic acid and osimertinib combination group, with 8 mice in each group, and were continuously administered by gavage for 6 weeks. The dose of osimertinib was 50mg / kg / day, the dose of glycyrrhizic acid was 30mg / kg / day, and the control group was solvent saline. On the 42nd day of administration, the mice were anesthetized, weighed, and their abdominal hair was removed. The symptoms of skin toxicity were observed and photographed. The mice were then killed and their abdominal skin tissues were taken. Ki67 immunohistochemistry, H&E staining, and TUNEL staining were used to observe skin tissue damage and keratinocyte apoptosis.

[0042] like Figure 5 As shown in A, the abdominal skin tissue of mice in the osimertinib alone group showed obvious hair loss and rash, while the control group, glycyrrhizic acid group and combination group did not show the above phenomenon, indicating that glycyrrhizic acid can significantly improve the symptoms of skin hair loss and rash induced by osimertinib.

[0043] like Figure 5 As shown in B, the immunohistochemistry results of mice in the group treated with osimertinib alone showed that the proliferation marker Ki67 was significantly downregulated, and the expression level of Ki67 was restored in the group treated with glycyrrhizic acid, indicating that glycyrrhizic acid can significantly improve the proliferation disorder caused by osimertinib.

[0044] The above results demonstrate that glycyrrhizic acid can significantly improve osimertinib-induced skin toxicity reactions.

[0045] H&E staining results of abdominal skin tissue ( Figure 6 A) shows that the epidermis of mice in the osimertinib group showed obvious epidermal damage, and keratinocytes underwent nuclear condensation (blue arrows), indicating the occurrence of apoptosis, while the control group, glycyrrhizic acid group and combined group did not show the above phenomenon, indicating that the combined use of glycyrrhizic acid can significantly reduce osimertinib-induced skin damage and reduce the occurrence of keratinocyte apoptosis. TUNEL staining results ( Figure 6B) shows that compared with the group treated with osimertinib alone, the number of green fluorescence-positive cells in the epidermal tissue of mice in the group treated with glycyrrhizic acid and osimertinib was significantly reduced, indicating that the combined use of glycyrrhizic acid can inhibit osimertinib-induced keratinocyte apoptosis.

[0046] The above results indicate that glycyrrhizic acid can significantly inhibit osimertinib-induced keratinocyte apoptosis.

[0047] like Figure 7 As shown, the epidermal thickness of mice in the group treated with osimertinib alone was significantly reduced, while the glycyrrhizic acid combined group was able to restore the epidermal thickness of mice, indicating that glycyrrhizic acid can significantly improve osimertinib-induced epidermal damage.

Claims

1. A use of glycyrrhizic acid in the preparation of a drug for reducing the toxic and side effects of osimertinib, wherein the CAS number of the glycyrrhizic acid is 53956-04-0.

2. The use according to claim 1, characterized in that: Glycyrrhizic acid can reduce the rash, hair loss and inflammatory reactions caused by osimertinib.

3. The use according to claim 1, characterized in that: Glycyrrhizic acid can alleviate osimertinib-induced keratinocyte apoptosis and inflammation.

4. The use according to claim 1, characterized in that: The medicine is prepared from glycyrrhizic acid or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier as a filler, a wetting agent, a binder, a disintegrant or a lubricant.

5. The use according to claim 1, characterized in that: The drug dosage form is liquid preparation or solid preparation.

Images