Penicillium photosporum LZ-3, fungicide and application of penicillium photosporum LZ-3 in biological control and growth promotion of panax notoginseng root rot

Abstract

The invention belongs to the technical field of biological bacterium agents, and particularly relates to a penicillium photosporum LZ-3, a bacterium agent and application of the penicillium photosporum LZ-3 in biological prevention and control and growth promotion of panax notoginseng root rot. The preservation number of the penicillium glabrata LZ-3 disclosed by the invention is CCTCC (China Center for Type Culture Collection) NO: M2024280. On the basis, the invention further provides a microbial inoculum containing the penicillium photosporum LZ-3, and the penicillium photosporum LZ-3 and the microbial inoculum containing the penicillium photosporum LZ-3 can effectively relieve continuous cropping obstacles of the panax notoginseng and antagonize fusarium fungi and sphaerotheca fungi so as to achieve the effect of preventing and controlling the root rot of the panax notoginseng. Meanwhile, the growth of the pseudo-ginseng can be promoted and the saponin content in the pseudo-ginseng can be increased.

Description

Technical Field

[0001] The invention belongs to the technical field of biological microbial agents, and specifically relates to Penicillium luminosporum LZ-3, a microbial agent and application thereof in biological control and growth promotion of Panax notoginseng root rot. Background Art

[0002] Panax notoginseng is a plant of the genus Panax in the Araliaceae family. It is a traditional precious Chinese medicinal material in my country with the effects of promoting blood circulation and relieving pain. In recent years, the existence of continuous cropping problems in Panax notoginseng has restricted the sustainable development of Panax notoginseng planting. Continuous cropping problems refer to the phenomenon that after the same or closely related crops are planted in succession, the quality deteriorates and soil-borne diseases spread. Panax notoginseng has serious continuous cropping problems. Root rot caused by pathogens is considered to be an important cause of continuous cropping problems in Panax notoginseng. The annual loss due to root rot damage is usually 5% to 20%. There are many pathogens that cause Panax notoginseng root rot, but Fusarium is still the most reported. Qiao Xinguo's research found that the relative abundance of Fusarium in the root tissue of Panax notoginseng root rot can reach up to 73.37%. In addition, there are also fungi of the genus Sphaerotheca and Fusarium pubescens. Dong Xian's research found that Fusarium oxysporum infection in Panax notoginseng can cause root rot, with an incidence rate of up to 77.5%. Wang Jing also reported that the main pathogenic fungi of Panax notoginseng root rot are Fusarium oxysporum and Fusarium solani.

[0003] Fusarium pathogens can cause root rot in most crops, causing serious losses to crop production. The pathogenic fungi of Chinese herbal medicine root rot are complex and diverse, and Fusarium spp. is the most harmful pathogen. Among the 17 Chinese herbal medicine root rot diseases, including Panax notoginseng and Astragalus, Fusarium fungi are the main pathogens, among which Fusarium oxysporum and Fusarium solani are the most common, with an occurrence frequency of up to 83.3%. In addition to Panax notoginseng root rot, Fusarium can also cause root rot in ginseng, which is also in the Araliaceae family.

[0004] There are many methods for the prevention and control of Panax notoginseng root rot, including physical control, chemical control and biological control. Although chemical pesticides are effective, the use of a large number of chemical pesticides has caused serious soil pollution. Therefore, the biological control method of "using bacteria to treat bacteria" has developed into a new idea. For example, the Vietnamese Sophora endophytic fungus SDTE-P is used to prevent and control Panax notoginseng black spot disease, and the biological fertilizer improved by Trichoderma is applied to improve the soil of banana wilt disease. Penicillium sp. has a broad antibacterial spectrum and strong stress resistance. It can effectively prevent and control plant diseases and is an excellent biocontrol microorganism. However, there are few reports on Penicillium luminosporum in the agricultural field. It is mainly reported as a pathogen and is one of the pathogens of penicillium disease during onion storage and soft rot during pomegranate storage. Although there are reports in the field of agricultural biocontrol that Penicillium luminosporum can help soybeans and sunflowers resist heat stress, there are no reports on whether it can prevent and control crop root rot. There are no patents or reports on whether it can be used for biological control of Panax notoginseng root rot and promote Panax notoginseng growth. Summary of the invention

[0005] The object of the present invention is to provide a Penicillium luminosporum LZ-3, a bacterial agent and an application thereof in biological control of Panax notoginseng root rot and promoting the growth of Panax notoginseng. The Penicillium luminosporum LZ-3 can effectively alleviate the continuous cropping obstacles of Panax notoginseng, antagonize Fusarium and Sphaerotheca fungi to achieve the effect of preventing and controlling Panax notoginseng root rot, and at the same time can promote the growth of Panax notoginseng and increase the saponin content in Panax notoginseng.

[0006] The invention provides a Peicillium glabrum LZ-3. The preservation number of the Peicillium glabrum LZ-3 is CCTCC NO: M2024280.

[0007] The present invention also provides a bacterial agent containing the Penicillium luminosporum LZ-3 described in the above technical solution.

[0008] Preferably, the bacterial agent includes a bacterial suspension of the Penicillium luminosporum LZ-3 and / or a metabolite of the Penicillium luminosporum LZ-3.

[0009] Preferably, the concentration of Penicillium luminosporum LZ-3 in the bacterial agent is 10 5 ~10 7 CFU / mL.

[0010] The present invention also provides the use of Penicillium luminescens LZ-3 described in the above technical scheme or the bacterial agent described in the above technical scheme in one or more of preventing and controlling Panax notoginseng root rot, resisting Fusarium fungi, resisting Sphaerotheca fungi, promoting Panax notoginseng growth and increasing the saponin content in Panax notoginseng.

[0011] Preferably, the promoting the growth of Panax notoginseng includes: one or more of increasing the plant height of Panax notoginseng, increasing the aboveground fresh weight of Panax notoginseng and promoting the root growth of Panax notoginseng.

[0012] Preferably, the promoting the growth of Panax notoginseng roots includes one or more of increasing the fresh weight of Panax notoginseng roots, increasing the dry weight of Panax notoginseng roots and increasing the root length of Panax notoginseng.

[0013] Preferably, the saponin comprises one or more of R1, Rg1, Rb1 and Rd.

[0014] The present invention also provides a method for preventing and controlling Panax notoginseng root rot, resisting Fusarium fungi and / or Sphaerotheca fungi, promoting Panax notoginseng growth and increasing the saponin content in Panax notoginseng, comprising: root irrigation treatment of Panax notoginseng seedlings with the bacterial agent described in the above technical scheme.

[0015] Preferably, the concentration of Penicillium luminescens LZ-3 in the soil after the root irrigation treatment is 10 5 ~10 7 CFU / g.

[0016] Beneficial effects:

[0017] The present invention provides a kind of Penicillium glabrum LZ-3, and biological preservation of the Penicillium glabrum LZ-3 is carried out. On this basis, the present invention also provides a bacterial agent containing the Penicillium glabrum LZ-3, the Penicillium glabrum LZ-3 and the bacterial agent containing the Penicillium glabrum LZ-3 can effectively alleviate the continuous cropping obstacle of Panax notoginseng, antagonize the fungus of the genus Fusarium and / or the fungus of the genus Sphaerocephala to achieve the effect of preventing and controlling the root rot of Panax notoginseng, and at the same time can promote the growth of Panax notoginseng and increase the saponin content in Panax notoginseng.

[0018] Biological Deposit Description

[0019] Penicillium glabrum LZ-3, biologically classified as Peicillum glabrum, was deposited in the China Center for Type Culture Collection (CCTCC) on January 29, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: M2024280. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0021] Figure 1 Evaluation and identification of the biocontrol bacteria in Example 1;

[0022] Figure 2 The qualitative identification of the functions and the evaluation of the antagonistic ability of Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 in Example 2;

[0023] Figure 3The biological control effect of different concentrations of Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 on Panax notoginseng root rot in Example 2 was evaluated;

[0024] Figure 4 The effects of Penicillium luminescens LZ-3 and Penicillium polishum LZ-6 on saponin content and enzyme activity in Example 3;

[0025] Figure 5 The effects of Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 on the cell membrane permeability and hydrogen peroxide content of pathogens in Example 4;

[0026] exist Figures 2 to 4 In the table, different letters between a, b and c indicate significant differences (P < 0.05); Figure 5 Note: * indicates significant difference, * indicates P<0.05, ** indicates P<0.01. DETAILED DESCRIPTION

[0027] The present invention provides a kind of Penicillium glabrum LZ-3, and the deposit number of the Penicillium glabrum LZ-3 is CCTCC NO: M2024280. The Penicillium glabrum LZ-3 of the present invention is isolated from a Panax notoginseng base with serious Panax notoginseng root rot and continuous cropping obstacles under the Laotan Mountain forest of Zhutang Township, Lancang County, Pu'er City, Yunnan Province. After identification, it is found that the colony morphology of the Penicillium glabrum LZ-3 of the present invention is irregular, the spores are only round, and the hyphae are less.

[0028] The present invention also provides a bacterial agent containing the light spore Penicillium LZ-3 described in the above technical solution. The bacterial agent of the present invention preferably includes a bacterial suspension of the light spore Penicillium LZ-3 and / or a metabolite of the light spore Penicillium LZ-3, and more preferably a bacterial suspension of the light spore Penicillium LZ-3 or a metabolite of the light spore Penicillium LZ-3. The concentration of the light spore Penicillium LZ-3 in the bacterial agent of the present invention is preferably 10 5 ~10 7 CFU / mL.

[0029] The method for preparing the bacterial suspension of Penicillium luminosporum LZ-3 of the present invention preferably comprises: inoculating Penicillium luminosporum LZ-3 onto a PDA solid culture medium, inverting the culture medium to obtain Penicillium luminosporum LZ-3 spores; scraping the Penicillium luminosporum LZ-3 spores and resuspending them with distilled water, filtering the hyphae with two layers of gauze to obtain the bacterial suspension of Penicillium luminosporum LZ-3. The temperature of the inverted culture of the present invention is preferably 25 to 30°C, more preferably 28°C; the time is preferably 7 to 20 days, more preferably 15 days. The method for preparing the metabolite of Penicillium luminosporum LZ-3 of the present invention preferably comprises inoculating the bacterial cake onto a PDA culture medium containing cellophane for culture, the culture temperature is preferably 25 to 30°C, the cellophane and hyphae are taken out together after 7 days of culture, and the non-volatile metabolites are retained in the culture medium, and the pathogens are inoculated on the culture medium, which can be used to evaluate the antibacterial ability.

[0030] The present invention also provides the use of Penicillium luminosporum LZ-3 described in the above technical solution or the bacterial agent described in the above technical solution in preventing and controlling Panax notoginseng root rot, resisting Fusarium fungi, resisting Sphaerocystis fungi, promoting Panax notoginseng growth and increasing the saponin content in Panax notoginseng. The anti-Fusarium fungi described in the present invention preferably include resistance to Fusarium oxysporum and / or resistance to Fusarium solani, that is, the Penicillium luminosporum LZ-3 described in the present invention is preferably resistant to root rot, and more preferably resistant to Panax notoginseng root rot. The promotion of Panax notoginseng growth described in the present invention preferably includes: increasing Panax notoginseng plant height, increasing the fresh weight of the aboveground part of Panax notoginseng and promoting the growth of Panax notoginseng roots; the promotion of Panax notoginseng root growth preferably includes increasing the fresh weight of Panax notoginseng roots, increasing the dry weight of Panax notoginseng roots and increasing the root length of Panax notoginseng. The saponin of the present invention preferably includes one or more of R1, Rg1, Rb1 and Rd, more preferably R1, Rg1, Rb1 and Rd.

[0031] The Penicillium luminescens LZ-3 of the present invention can increase the content of peroxidase POD and phenylalanine ammonia lyase PAL in the root of Panax notoginseng, induce systemic resistance of Panax notoginseng, and at the same time stimulate hydrogen peroxide of pathogenic bacteria Fusarium, causing oxidative stress damage to cells, leading to destruction of cell membranes of pathogenic bacteria, thereby inhibiting the growth of pathogenic bacteria, achieving the effect of resisting Fusarium oxysporum and / or Fusarium solani, so as to achieve the effect of resisting root rot.

[0032] The present invention also provides a method for alleviating the continuous cropping obstacle of Panax notoginseng, resisting the fungus of the genus Fusarium and / or the genus Sphaerotheca, promoting the growth of Panax notoginseng and increasing the saponin content in Panax notoginseng, comprising: performing root irrigation treatment on Panax notoginseng seedlings with the bacterial agent described in the above technical scheme. The concentration of Penicillium luminosporum LZ-3 in the soil after the root irrigation treatment of the present invention is preferably 10 5 ~10 7 CFU / g.

[0033] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0034] Experimental materials, instruments and data processing methods used in the following examples

[0035] Test soil: The soil for mycobacterial separation was collected from the Panax notoginseng base under the forest of Laotan Mountain, Zhutang Township, Lancang County, Pu'er City, Yunnan Province (latitude and longitude are 99°47′59″E, 22°43′19″N). The land had been planted with Panax notoginseng for 2 years and had a relatively serious root rot of Panax notoginseng. In addition, natural soil and soil from continuous planting of Panax notoginseng for 2 years were selected for subsequent treatment.

[0036] Test plants: One-year-old Panax notoginseng seedlings were obtained from the Panax notoginseng planting base of Xundian Daheqiao Agricultural University (25°31'8.0"N, 103°16'41.6"E, H1980m).

[0037] The test pathogens: Fusarium oxysporum LP1, Fusarium solani LP2 and Plectosphaerella cucumerina, were provided by the Key Laboratory of Agricultural Biodiversity and Pest Control, Ministry of Education, Yunnan Agricultural University.

[0038] Test instruments: refrigerated high-speed centrifuge (HITACHI CR22 GⅢ); high-pressure steam sterilizer (Sanyo, Japan, mLS-3780); clean bench (Suzhou Antai, SW-CJ-2F); Roche LC96 fluorescence quantitative PCR instrument (LightCycler96); microplate reader; analytical balance (Sartorius, BSA124S-CW); centrifuge (Thermo Fisher Scientific, HeraeusFresco17); pipette (Eppendof, Germany), 55kHz ultrasonic cleaning machine (Shanghai Sound Source Ultrasonic Instrument Co., Ltd., SY3100DH).

[0039] The experimental data were analyzed and processed using Microsoft Excel 2016, and SPASS18.0 software was used for statistical analysis. GraphPad Prism 8.0 software was used for drawing.

[0040] Example 1

[0041] Isolation and Identification of Penicillium luminosporum LZ-3

[0042] The dilution plate method was used to isolate microorganisms in the soil. Take 10g of the sterilized soil sample and add 90mL of sterilized water. Shake at 120r / min for 90min to make a soil bacterial suspension, and then dilute it to 10 -4 and 10 -5 Take 50 μL of a concentration of 10 -5 g / mL bacterial suspension was evenly spread on PDA medium and cultured in a constant temperature and light incubator at 28°C. After the colonies grew out, single colonies of different morphologies were picked for pure culture.

[0043] Strain morphological identification: The activated strains were inoculated on different culture media for morphological observation, including potato dextrose agar (PDA), synthetic nutrient medium (SNA), corn flour medium (Maize) (Wang Haiyan, 2023), Czapek medium (Czapek), and oatmeal agar (OA) (Nian Wenkai, 2022).

[0044] The purified strains were sequenced (Beijing Qingke Biotechnology Co., Ltd.) using the following primers. The sequences obtained were compared with the NCBI database by BLAST, and the phylogenetic tree was constructed using MEGA-X software and the Neighbor-Joining (NJ) method.

[0045] ITS sequence of LZ-3: 5'-GGAAGGATCATTACTGAGTGAGGGCCCTCTGGGT CCAACCTCCCACCCGTGTTTATTGTACCTTGTTGCTTCGGTGCGCCCGCCTCACGGCCGCCGGGGGGCTTCTGCCCCCGGGTCCGCGCGCACCGGAGACACTATTGAACTCTGTCTGAAGATTGCAGTCTGAGCATAAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCCCCCGGGGACGGGTCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACAACCAATCATCCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA-3' (SEQ ID NO.1);

[0046] TUB2 sequence of LZ-3: 5'-ACGTGCTGACACGATCCCAATTGATAGCCTGTT GGACCGAATCACTGACTGGTTTCTAGGCAAACCATTGCTGGCGAGCACGGACTTGATGGTGATGGACAGTGAGTTTCAACATCGATGAGATTGCGAGGTGGAAATGGCGGTCTGATAATTTTTAGCGTCAACGAGGCTTCCGACCTCCAGTTGGAGCGCATGAACGTCTACTTCAACGAGGTATGTGTGGAATTGAAGCTAT AGGTATAAAGGCTTCTCTAATGTTGATTGTGATAGGCCAGCAGCAACCGTTACGTTCCCCGTGCCGTCCTTGTCGACTTGGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCCTTCGGTGGTCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCAAAACC-3'(SEQ ID NO.2).

[0047] Table 1 Primers used in this example

[0048]

[0049] The biocontrol effect of the isolated strains was evaluated by bottle culture test. First, the soil of Panax notoginseng was divided into 200mL sterilized tissue culture bottles, 50g per bottle. 7 CFU / mL was inoculated in tissue culture bottles, 20mL per bottle, 6 bottles were inoculated for each treatment, and the same volume of sterilized water was added as a control. Sterilized Panax notoginseng seeds were planted in tissue culture bottles filled with continuous cropping soil, 10 plants per bottle. They were cultured in a greenhouse, and the survival rate of the plants was measured and recorded after three months of cultivation (Luo L, 2021).

[0050] The results are as follows Figure 1 As shown, A is the bottle culture test screening of biocontrol bacteria; B is the phylogenetic tree constructed based on ITS; C is the colony morphology and spore morphology; D is the phylogenetic tree constructed based on TUB2.

[0051] Depend on Figure 1 It can be concluded that 12 strains of antagonistic bacteria were isolated from the soil of Panax notoginseng in Lancang County ( Figure 1A), the 12 strains were tested in a bottle culture test to screen the biocontrol bacteria. The results showed that LZ-3 and LZ-6 could improve the continuous cropping barrier of Panax notoginseng. From the perspective of colony morphology, the two strains were irregular in shape, with only round spores and mainly spores, and fewer hyphae. The number of hyphae of LZ-3 was more than that of LZ-6 ( Figure 1 C). Phylogenetic trees were constructed based on the two pairs of primers ITS and TUB2. The results showed that LZ-3 was Penicillium luminosporum and LZ-6 was Penicillium polishum ( Figure 1 (middle D).

[0052] Example 2

[0053] 2.1 Qualitative analysis of strain function

[0054] Penicillium luminescens LZ-3 and Penicillium polishii LZ-6 were inoculated into Ashby nitrogen-free solid medium, silicate culture medium (SSM), phosphate solubilizing medium (PSM), potassium solubilizing medium, CAS medium, laccase culture medium (CCM), cellulase culture medium (LCM), and IAA identification reagent Salkowski reagent (Wang Haiyan, 2023) for qualitative functional evaluation. The results are as follows Figure 2 As shown in A, from left to right are Ashby nitrogen-free solid medium (N), phosphate-solubilizing medium (P), silicic acid medium (K), potassium-solubilizing medium, CAS medium, cellulase medium, and laccase medium; IAA detection is observed using a white ceramic plate, CK1: IAA standard solution + Salkowski reagent, CK2: Salkowski reagent, CK3: non-IAA-producing fungi + Salkowski reagent, T: bacterial fermentation broth + Salkowski reagent.

[0055] Depend on Figure 2 From A, we can conclude that both Penicillium luminescens LZ-3 and Penicillium polishum LZ-6 have the ability to fix nitrogen, solubilize phosphorus and potassium, but cannot produce iron carriers. Both can produce cellulase, laccase, and IAA, indicating that they may inhibit the growth of pathogens by producing cellulase and laccase, improve soil physicochemistry by fixing nitrogen, solubilizing phosphorus and potassium, and promote crop growth by producing IAA.

[0056] 2.2 Indoor evaluation of antagonistic bacteria

[0057] The pathogenic bacteria LP1 and LP2 with strong pathogenicity and Sphaerotheca parviflora were selected for plate co-culture test and cellophane culture test to clarify the inhibitory ability of Penicillium on pathogens. The test method is as follows:

[0058] Plate confrontation method: Antagonistic bacteria were screened by plate confrontation culture method. Penicillium cake was inoculated on one side of the culture dish, and pathogen cake was inoculated on the other side. After culturing in a constant temperature incubator at 25°C for 4 days, the inhibition rate and relative inhibition effect were calculated. Each treatment was repeated 3 times. Inhibition rate (%) = [(control colony radius - confrontation culture colony radius) / control colony radius] × 100% (Luo Lifen, 2018).

[0059] Cellophane culture test: Penicillium cake was inoculated on PDA medium covered with sterile cellophane, and the treatment of inoculating PDA blank agar block was used as a control. After 7 days, the cellophane was removed, and the cakes of pathogen LP1, pathogen LP2 and Sphaerotheca microplus were inoculated respectively, and the inhibition rate was calculated (Wang Haiyan, 2023). Figure 2 As shown in B~D, B is the plate co-culture diagram, CK are three pathogens, the Penicillium under treatment is on the left side of the culture dish, C is the plate co-culture inhibition rate, and D is the inhibition rate of Penicillium non-volatile metabolites. The cellophane co-culture test was used. After Penicillium grows in the PDA culture medium containing cellophane, its volatile metabolites will be secreted into the culture medium through the cellophane. Then the cellophane is taken out and the pathogens are inoculated to determine whether the non-volatile metabolites of Penicillium can inhibit bacteria.

[0060] Depend on Figure 2 From B to D, it can be concluded that both Penicillium luminosilicate LZ-3 and Penicillium polishii LZ-6 can inhibit the growth of Fusarium LP1 and LP2, as well as Sphaerotheca microtyphina. The inhibitory ability of Penicillium luminosilicate LZ-3 on LP1 and LP2 is stronger than that of Penicillium polishii LZ-6. Penicillium luminosilicate LZ-3 has the strongest inhibitory ability on the co-culture of Fusarium LP2, with an average inhibition rate of 86%, followed by an average inhibition rate of 66% on Sphaerotheca microtyphina, and finally an average inhibition rate of 64% on LP1. However, there is no significant difference in the inhibitory ability of their metabolites.

[0061] 2.3 Evaluation of antagonistic bacteria in potted plants

[0062] According to the indoor results in step 2.2, the most pathogenic LP2 was selected for potted plant experiments to verify the biological control effects of Penicillium luminescens LZ-3 and Penicillium polishii LZ-6 on the pathogen LP2. The specific steps are as follows:

[0063] Preparation of Penicillium spore suspension: Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 were inoculated on PDA solid culture plates, inverted and cultured at 28°C for 15 days, spores on the culture plates were scraped off, and the activated strains were prepared into spore suspensions with distilled water. The suspensions were filtered with double-layer gauze and counted with an optical microscope. The concentration of the spore suspension of the potential biocontrol bacteria was 10 6 ~10 8 CFU / mL, after root irrigation, in the soil, it reaches 10 5 ~10 7 The final concentration of the soil after root irrigation of the pathogen Fusarium LP2 suspension was 10 5 CFU / g.

[0064] 2.3.1 One-year-old Panax notoginseng seedlings were selected for root irrigation experiments. Two types of soil were selected for the experiment: sterilized soil and natural soil under the pine forest were sterilized at 121°C for 30 minutes to obtain sterile soil (Luo L, 2021). Flower pots with a diameter of 15 cm and a height of 13 cm were selected, and each flower pot contained 1 kg of soil. The sterilized soil was first irrigated with a suspension of the pathogen Fusarium LP2 to a final concentration of 10 5 CFU / g and then instilled with antagonistic bacteria.

[0065] After 3 months, the incidence of Panax notoginseng root rot, fresh weight of Panax notoginseng roots and length of Panax notoginseng roots were counted. The results are as follows Figure 2 As shown in E~G, E is the fresh weight of Panax notoginseng roots; F is the incidence of Panax notoginseng root rot; G is the root length of Panax notoginseng.

[0066] It can be seen from Figures E to G that both Penicillium luminescens LZ-3 and Penicillium polishum LZ-6 can reduce the incidence of Panax notoginseng root rot caused by LP2, and the average incidence of root rot decreased by 36% and 50%. At the same time, they can increase the root length and fresh weight of Panax notoginseng, with the root fresh weight increased by 55% and 56%, and the root length increased by 32% and 40%. However, there was no statistical difference between the treatments. From the results, it can be seen that both strains of Penicillium have good disease prevention and control and growth promotion effects.

[0067] 2.3.2 One-year-old Panax notoginseng seedlings were selected for root irrigation experiment, and continuous cropping soil with Panax notoginseng planted for two years was selected for the experiment. The treatment group was inoculated with 100mL of strain spore suspension, and the control group was inoculated with sterile water (CK); 6 pots were inoculated for each treatment, and each pot contained 10 seedlings.

[0068] After 3 months, observe the phenotypic traits of Panax notoginseng, such as Figure 3 As shown in A, in the first and second rows of potted Panax notoginseng, from left to right are CK, 10 7 , 10 6 and 10 5The incidence of Panax notoginseng root rot, fresh weight of Panax notoginseng roots, fresh weight of Panax notoginseng aboveground parts, dry weight of roots, plant height and root length were calculated. The results were as follows: Figure 3 As shown in B~G in the figure, B is the incidence of Panax notoginseng root rot; C is the fresh weight of Panax notoginseng roots; D is the fresh weight of the aboveground part; E is the dry weight of the roots; F is the plant height; and G is the root length.

[0069] Depend on Figure 3 It can be concluded that both Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 can reduce the incidence of Panax notoginseng root rot, increase the dry fresh weight of roots, the fresh weight of aboveground parts, and plant height. 6 CFU / g and 10 5 At the concentration of 10 CFU / g, Penicillium luminosporum LZ-3 can more significantly reduce the incidence of Panax notoginseng root rot than Penicillium polishum LZ-6. 5 CFU / g and 10 6 At the two concentrations of CFU / g, Penicillium luminescens LZ-3 had a stronger ability to reduce root rot, and the incidence of root rot was reduced by 66% and 64%, which was 50% and 12% higher than the average inhibition rate of Polish Penicillium LZ-6. In short, Penicillium luminescens LZ-3 had a more significant effect in preventing and controlling root rot, so Penicillium luminescens LZ-3 was selected for patent application.

[0070] Penicillium luminescens LZ-3 and Penicillium polishii LZ-6 can increase the fresh weight and dry weight of Panax notoginseng roots by more than 1 times at three concentrations, increase the average plant height by more than 17%, and increase the average root length by more than 30%. Compared with the blank control, Penicillium luminescens LZ-3 increased the fresh weight of Panax notoginseng roots by an average of 128%, the fresh weight of the aboveground part by more than 22%, the dry weight of the roots by 206%, the plant height by more than 17%, and the root length by more than 30%. Therefore, Penicillium luminescens LZ-3 has good root rot prevention and growth promotion effects.

[0071] Example 3

[0072] Effects of Penicillium luminescens LZ-3 and Penicillium polishii LZ-6 on notoginseng saponins and enzyme activities

[0073] 3.1 Determination of notoginseng saponin content

[0074] The Panax notoginseng plants were treated according to the method in step 2.3.2 of Example 3, so that after the roots were irrigated with Penicillium luminescens LZ-3 and Penicillium polishium LZ-6 respectively, the saponin content of Panax notoginseng was determined with reference to the method of Luo Cheng et al. (Luo Cheng, 2022): There were 6 pots for each treatment as replicates, 10 Panax notoginseng plants in each pot, and 3 Panax notoginseng plants were randomly selected from each pot for saponin determination. After the Panax notoginseng was irrigated for 3 months, the main root of Panax notoginseng was dried and ground, passed through a 100-mesh sieve, 0.2 g was accurately weighed, 15 mL of 75% methanol was added, ultrasonic extraction was performed for 30 minutes, centrifuged for 10 minutes (12000 r / min), 1 mL of the supernatant was taken and placed in a brown injection bottle, and the content of the four saponins R1, Rg1, Rb1 and Rd in Panax notoginseng was measured using an ultra-high performance liquid chromatograph. The results are as follows Figure 4 As shown in A~D, A~D represent the content results of saponins Rg1, Rb1, Rd, and R1 respectively.

[0075] Depend on Figure 4 From A to D, it can be concluded that Penicillium luminosporum LZ-3 can also significantly increase the content of saponin, a medicinal ingredient of Panax notoginseng, and significantly increase the content of saponin, increasing the content of Rg1, Rb1, Rd and R1 by 11%, 39%, 37% and 40% respectively, but Penicillium polishum LZ-6 cannot increase the content of saponin. Only Penicillium luminosporum LZ-3 can increase the content of saponin, the core medicinal quality of Panax notoginseng, so LZ-3 was selected for patent application, which will provide new ideas for improving the medicinal quality of Panax notoginseng.

[0076] 3.2 Determination of Panax notoginseng enzyme activity

[0077] After root irrigation treatment with Penicillium luminescens LZ-3 and Penicillium polishum LZ-6, the roots of Panax notoginseng were collected and sampled at 24h and 120h, respectively, and the enzyme activity of the roots of Panax notoginseng was measured. Three Panax notoginseng strains were collected from each pot as one replicate, and each treatment was repeated 3 times. Irrigation with sterile water was used as a control. The kits purchased from Suzhou Keming Biotechnology Co., Ltd. were used to measure superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and phenylalanine ammonia lyase (PAL) (Yang K. et al. 2023). The results are as follows Figure 4 As shown in E to L, E to H are the contents of superoxide dismutase SOD, peroxidase POD, catalase CAT and phenylalanine ammonia lyase PAL in the roots of Panax notoginseng 24 hours after irrigation with fungi; I to L are the contents of superoxide dismutase SOD, peroxidase POD, catalase CAT and phenylalanine ammonia lyase PAL in the roots of Panax notoginseng 120 hours after irrigation with fungi.

[0078] Depend on Figure 4From E to L, it can be concluded that after treatment with Penicillium luminescens LZ-3 and Penicillium polishes LZ-6, the peroxidase POD of Panax notoginseng showed an increasing trend on the 1st and 5th days, and the increasing trend of the peroxidase POD of Penicillium luminescens LZ-3 was more significant, increasing by 480% on the 5th day, while Penicillium polishes LZ-6 only increased by 59%. Penicillium luminescens LZ-3 can more strongly increase the POD of Panax notoginseng resistance enzyme, while the control Penicillium polishes LZ-6 could not increase the POD on the fifth day, and the increase of Penicillium luminescens was more significant; phenylalanine ammonia lyase PAL was significantly increased on the 1st day, with an average increase of 125% and 407%, respectively. The PAL enzyme activity of Penicillium luminescens LZ-3 was 282% higher than that of Penicillium polishes LZ-6. On the 5th day, Penicillium luminescens LZ-3 was still the highest, increasing by 196%. In general, Penicillium luminescens LZ-3 can induce Panax notoginseng to produce more disease-resistant related enzyme activities than Penicillium polishii LZ-6, and may induce systemic resistance of Panax notoginseng, which may be one of the reasons why Penicillium luminescens can have better prevention effect.

[0079] Example 4

[0080] Effects of Penicillium luminescens LZ-3 and Penicillium polishium LZ-6 on cell membrane permeability and hydrogen peroxide content of pathogenic bacteria

[0081] Referring to the plate confrontation test in section 2.2 of the antagonistic indoor evaluation in Example 2, Penicillium luminescens LZ-3 and Penicillium polishii LZ-6 were confronted with the pathogens LP1 and LP2, respectively, to obtain the LP1 pathogen mycelium and LP2 pathogen mycelium that had been confronted with the Penicillium luminescens LZ-3 and Penicillium polishii LZ-6 plates, respectively.

[0082] The method of Guo Ning et al. (Guo Ning et al., 2023) was slightly modified: Propidium bromide (PI) staining solution detection method was used: the mycelium of the pathogen that had been confronted with the Penicillium plate was selected and 10 mL of 2.5 μg mL -1 The mycelium was stained with PI dye for 15 minutes in a dark environment, and then the dye on the surface of the mycelium was washed with physiological saline. The mycelium was immediately observed under a fluorescence microscope. The normal growth of pathogens was used as a control. The determination of hydrogen peroxide in pathogens was carried out using a kit from Suzhou Grace Biotechnology Co., Ltd. The results are shown in the figure. Figure 5 As shown, A is a fluorescence observation photograph of the effect of Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 on the cell membrane permeability of two pathogens LP1 and LP2, and B is the effect of Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 on the hydrogen peroxide content of two pathogens LP1 and LP2.

[0083] Depend on Figure 5It can be concluded that both pathogens LP1 and LP2 were stained red, while only a small amount of mycelium was stained red in the blank control. This indicates that Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6 can cause cell membrane damage to Fusarium mycelium, resulting in increased permeability and even destruction of its integrity, thereby making it easier for the PI dye to penetrate the damaged cell membrane and enter the mycelium. This example also measured the hydrogen peroxide content of the same sample, and the results showed that the hydrogen peroxide content was significantly increased after treatment with Penicillium luminosporum LZ-3 and Penicillium polishum LZ-6. Therefore, the present invention speculates that the two strains of Penicillium can induce an increase in the intracellular hydrogen peroxide content of the pathogen, thereby destroying the cell membrane and causing mycelial cell death, thereby inhibiting the growth of the pathogen.

[0084] The present invention reveals that Penicillium luminosporum LZ-3 can reduce the root rot of Panax notoginseng, increase the biomass of Panax notoginseng, and increase the content of saponin, the core medicinal quality of Panax notoginseng, which will provide a new idea for improving the medicinal quality of Panax notoginseng. At the same time, the present invention also found that Penicillium luminosporum LZ-3 can improve the enzyme activity related to Panax notoginseng resistance, especially significantly improve the content of PAL, which is an enzyme that catalyzes the first reaction of the phenylpropanoid metabolic pathway and is closely related to the synthesis of lignin. It is likely to resist the pathological infection of Fusarium by inducing the systemic resistance of Panax notoginseng.

[0085] Reactive oxygen species mainly include superoxide radicals (O 2- ), hydrogen peroxide (H2O2), hydroxyl radical (-OH), nitric oxide radical (NO - ) and singlet oxygen ( 1 O2)(Wang Haode, 2018). At present, many studies have also clarified that some low concentrations of reactive oxygen species (ROS) play an important role in the pathogenic process of pathogens. The increase of H2O2 will inhibit the growth of biotrophic pathogens, whether it is generated by the pathogen itself or induced to be produced and accumulated by plants. When the reactive oxygen accumulates to a certain concentration, it can cause oxidative stress damage to the cells (Zhang Yandong, 2019). The test results of the present invention show that Penicillium luminosporum LZ-3 can increase the H2O2 content of the two strains of Fusarium. At the same time, combined with the PI staining results, it can be seen that the cell membrane of the pathogen is destroyed and the contents are leaked. Therefore, the present invention speculates that Penicillium may induce an increase in the hydrogen peroxide content of the pathogen, resulting in cell membrane damage, thereby inhibiting the growth of the pathogen.

[0086] References:

[0087] [1] Wang Haiyan. Isolation and identification of endophytic Trichoderma strain 6S-2 and its mechanism for preventing and controlling apple continuous cropping problems[D]. Shandong Agricultural University, 2023. DOI: 10.27277 / d.cnki.gsdnu.2023.000004.

[0088] [2] Nian Wenkai. Pathogenicity study of five new pathogenic fungi of Rehmannia glutinosa including Sphaerotheca scoparia and screening of control agents (Master's degree thesis) [D]. Henan Agricultural University, 2022.

[0089] [3]Luo L, Guo C, Wang L, et al. Negative Plant-Soil Feedback Driven by Re-assemblage of the Rhizosphere Microbiome With the Growth of Panaxnotoginseng[J]. Frontiers in microbiology, 2019,10:1597.

[0090] [4]Luo L,Wang L,Deng L,Mei 22;9(3):e0140021.doi:10.1128 / Spectrum.01400-21.Epub 2021Nov 10.PMID:34756064;PMCID:PMC8579924.

[0091] [5]Yang K, Wang H, Luo L, Zhu S, Huang H, Wei Z, Zhu Y, Guo L, He X. Effects of different soil moisture on the growth, quality, and root rot di sease of organic Panax notoginseng cultivated under pine forests. J EnvironManage. 2023Mar 1;329:117069.doi:10.1016 / j.jenvman.2022.117069.Epub 2022Dec28.PMID:36584512.

[0092] [6] Wang Haode. The role of H2O2 in the formation of Rhizoctonia solani and the functional analysis of CAT[D]. Shenyang Agricultural University, 2018.

[0093] [7] Zhang Yandong. Response and mechanism of Alternaria alternata to oxidative stress[D]. Gansu Agricultural University, 2019. DOI: 10.27025 / d.cnki.ggsnu.2019.000268.

[0094] [8] Zhang Qian, Li Ping, He Zikang, et al. Active substances against Ralstonia solanacearum from endophytic fungi Penicillium citrinum and Penicillium polishii of Portulaca oleracea[J]. Journal of Tropical and Subtropical Botany, 2019, 27(06): 731-738.

[0095] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A kind of Penicillium glabrum LZ-3, the deposit number of the Penicillium glabrum LZ-3 is CCTCCNO: M2024280.

2. A bacterial agent containing the Penicillium luminosporum LZ-3 according to claim 1.

3. The bacterial agent according to claim 2, characterized in that The bacterial agent includes a bacterial suspension of the Penicillium luminosporum LZ-3 and / or a metabolite of the Penicillium luminosporum LZ-3.

4. The bacterial agent according to claim 2 or 3, characterized in that: The concentration of Penicillium luminosporum LZ-3 in the bacterial agent is 10 5 ~10 7 CFU / mL.

5. Use of the Penicillium luminescens LZ-3 described in claim 1 or the bacterial agent described in any one of claims 2 to 4 in one or more of preventing and controlling Panax notoginseng root rot, resisting Fusarium spp. fungi, resisting Plectosphaerella fungi, promoting Panax notoginseng growth and increasing the saponin content in Panax notoginseng.

6. The use according to claim 5, characterized in that: The promoting the growth of Panax notoginseng comprises: one or more of increasing the plant height of Panax notoginseng, increasing the aboveground fresh weight of Panax notoginseng and promoting the root growth of Panax notoginseng.

7. The use according to claim 6, characterized in that: The promoting of Panax notoginseng root growth includes one or more of increasing the fresh weight of Panax notoginseng roots, increasing the dry weight of Panax notoginseng roots and increasing the length of Panax notoginseng roots.

8. The use according to claim 5, characterized in that: The saponin includes one or more of R1, Rg1, Rb1 and Rd.

9. A method for preventing and controlling root rot of Panax notoginseng, resisting Fusarium and / or Sphaerotheca fungi, promoting growth of Panax notoginseng and increasing the content of saponins in Panax notoginseng, characterized in that: include: The root of Panax notoginseng seedlings is irrigated with the bacterial agent described in any one of claims 2 to 4.

10. The method according to claim 9, characterized in that The concentration of Penicillium luminosporum LZ-3 in the soil after the root irrigation treatment was 10 5 ~10 7 CFU / g.

Images