Cell line for knocking down ARHGAP44 gene expression and application thereof

Abstract

The invention discloses a cell line for knocking down ARHGAP44 gene expression and application thereof, and belongs to the technical field of biological medicine. The invention discloses a shRNA (short hairpin Ribonucleic Acid) molecule. The nucleotide sequence of the shRNA molecule is shown as SEQ ID NO. 3 or 4. The invention also provides a construction method of the ARHGAP44 gene knock-down cell line, and the construction method comprises the following steps: carrying out exogenous expression on the shRNA molecule in a target cell, and obtaining the ARHGAP44 gene expression knock-down cell line through the method. According to the invention, the constructed ARHGAP44 gene shRNA plasmid vector can be stably loaded in osteosarcoma cells, so that the continuous and stable knock-down of the ARHGAP44 gene in the cells is realized, and the constructed MG63-ARHGAP-cell line can be effectively applied to the medical research of osteosarcoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to a cell line for knocking down ARHGAP44 gene expression and an application thereof. Background Art

[0002] Osteosarcoma is a highly malignant tumor. If the tumor is accompanied by metastasis, the patient's survival prognosis risk increases significantly. From the biological behavior of cells, osteosarcoma is highly heterogeneous. Not only are the clinical manifestations of different patients different, but also different areas of the tumor tissue of the same patient have obvious differences. The cells in different areas of osteosarcoma tissue have different functions and obvious heterogeneity. After osteosarcoma is diagnosed by pathology, early chemotherapy or radiotherapy begins. Resection of tumor tissue is an important step in the treatment of osteosarcoma. With the improvement of tumor surgical technology and the development of implant research, limb preservation therapy has shown good treatment prospects. Consolidation chemotherapy or radiotherapy after tumor tissue resection is very important for controlling tumor metastasis and improving survival rate. Immunotherapy is intravenous infusion of lymphocytes or interferon and transfer factor, but the efficacy is not yet certain. The main reason for the difference in efficacy is also the heterogeneity of osteosarcoma cells. There are obvious individual differences in the response of different patients to immunotherapy.

[0003] The applicant has found that the ARHGAP44 gene plays a role in the process of osteosarcoma metastasis to the lung, and its most obvious feature is that no matter what type of osteosarcoma cell, once the tumor metastasizes, the metastatic cells have obvious invasiveness and the motility of the cells is significantly enhanced. The ARHGAP44 gene is a small G protein family member gene, and its main function is to regulate cytoskeleton movement, that is, to regulate the invasion and metastasis ability of the tumor. The applicant found that the ARHGAP44 gene, as a cell movement-related gene, has significantly enhanced expression in osteosarcoma metastases, so it is suggested that if the gene is artificially interfered with and its expression is reduced from the gene level, it may have a control effect on tumor metastasis. To achieve this purpose, the invention is directed to the specific shRNA interfered with by ARHGAP44, and its actual regulatory effect on gene expression is verified in vitro, which has medical research value.

[0004] The present invention constructs a stable knockdown cell line of ARHGAP44 in osteosarcoma by combining shRNA interference with G418 drug screening technology, and the cell can achieve stable knockdown of the gene expression in osteosarcoma. In this way, in medical research, the function of the ARHGAP44 gene in osteosarcoma can be further analyzed by comparing the biological behavior differences between the cell line and other cell lines with normal expression of ARHGAP44, and the mechanism of action can be clarified to provide cell tools. The cell line can be better applied to osteosarcoma medical research practice. Summary of the invention

[0005] In view of the problems existing in the above-mentioned prior art, the purpose of the present invention is to design and provide a cell line for knocking down the expression of the ARHGAP44 gene and its application. The ARHGAP44 gene stably knocked down osteosarcoma cell line obtained by the present invention is of great significance to the medical research of osteosarcoma.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] In one aspect, the present invention provides a shRNA molecule, the nucleotide sequence of the shRNA molecule is shown as SEQ ID NO. 3 or 4.

[0008] In a second aspect, the present invention provides a recombinant expression vector comprising a nucleotide sequence encoding the shRNA molecule as described in claim 1 and a vector.

[0009] The recombinant expression vector is a eukaryotic expression vector.

[0010] In a third aspect, the present invention provides the use of the shRNA molecule, or the recombinant expression vector as claimed in claim 2 or 3, in knocking down the ARHGAP44 gene in human osteosarcoma cells.

[0011] In a fourth aspect, the present invention provides a method for constructing an ARHGAP44 gene knockdown cell line, comprising the following steps:

[0012] Exogenously express the shRNA molecule according to claim 1 in target cells.

[0013] In the construction method, the target cells are human osteosarcoma cells.

[0014] In the construction method, the target cells are human osteosarcoma MG63 cells.

[0015] In a fifth aspect, the present invention provides a cell line for knocking down the expression of the ARHGAP44 gene, which is obtained by any one of the construction methods described.

[0016] The use of the shRNA molecule or the recombinant expression vector in preparing a product for inhibiting osteosarcoma cell metastasis.

[0017] The preparation method of osteosarcoma cells with stable knockdown of ARHGAP44 gene mainly includes the following steps: 1) designing ARHGAP44 gene siRNA interference fragment according to the sequence structure of ARHGAP44 gene, and constructing shRNA plasmid vector that can stably knockdown gene expression; 2) transfecting human osteosarcoma cells with the constructed ARHGAP44 gene shRNA vector; 3) stabilizing the obtained recombinant cell line with G418 drug, achieving stable knockdown of ARHGAP44 gene expression in osteosarcoma cells, and continuously culturing.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention can stably load the constructed ARHGAP44 gene shRNA plasmid vector in osteosarcoma cells, thereby achieving sustained and stable knockdown of the ARHGAP44 gene in the cells. The constructed "MG63-ARHGAP-" cell line can be effectively used in osteosarcoma medical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the comparison diagram of ARHGAP44 gene siRNA fragments after NCBI sequence blast;

[0021] Figure 2 This is a partial sequencing map of the ARHGAP44 gene shRNA plasmid vector;

[0022] Figure 3 To verify gene expression in cell lines by QPCR experiments. DETAILED DESCRIPTION

[0023] The present invention will be further described below by means of drawings and embodiments.

[0024] Embodiment 1:

[0025] According to the ARHGAP44 gene structure, the siRNA interference sequence was designed, the shRNA stem-loop structure interference plasmid vector was constructed, and the ARHGAP44 continuous knockdown osteosarcoma cell line was constructed through cell transfection combined with G418 drug screening and named "MG63-ARHGAP-" cell line. The details are as follows:

[0026] 1. Design of ARHGAP44 gene interference siRNA sequence

[0027] The CDS region of the ARHGAP44 gene is 2307 bp in length. The siRNA target sites were screened by moving base by base between the base sites in the CDS region to ensure that the selected siRNA sequence was 19 to 22 bp in length and had a GC content of about 40% to 50%. The blast comparison was performed with the ARHGAP44 gene sequence published by the NCBI Human Genome Project to ensure the specificity of the sequence and to exclude the possibility that the screened sequence was a homologous sequence of other human genes.

[0028] At the same time, when designing the target gene siRNA sequence, the scramble sequence recognized in RNAi design was selected as a control, the control sequence: TTCTCCGAACGTGTCACGT, and blast alignment was performed again before use to exclude the homology between the control sequence and the ARHGAP44 gene. Figure 1 As shown, the screened ARHGAP44 gene siRNA sequence can match the ARHGAP gene after blast comparison with the NCBI genome sequence, and the siRNA fragment has gene specificity.

[0029] According to the above standards, the ARHGAP44 gene siRNA interference sequence (nucleotide sequence as shown in SEQ ID NO.1) and the scramble control sequence (nucleotide sequence as shown in SEQ ID NO.2) were obtained:

[0030] (1) ARHGAP44 gene siRNA sequence: 5'-CAACATCCGATACTTGATA-3'

[0031] (2) Scramble control sequence: 5'-TTCTCCGAACGTGTCACGT-3'

[0032] 2. Design stem-loop shRNA sequence based on ARHGAP44 gene siRNA sequence

[0033] The ARHGAP44 gene siRNA sequence obtained by the above screening was used as the main chain, and the "complementary fragment" corresponding to the siRNA sequence was designed according to the principle of base complementary pairing. The specific ARHGAP44 gene siRNA target sequence and its "complementary fragment" were used as the "branches" at both ends of the stem-shaped circular RNA, and the 6-base "stem-loop" structure required for the construction of circular RNA was inserted in the middle of the fragment. The "stem-loop" structure base sequence selected the structurally stable "CTCGAG" sequence.

[0034] After designing the shRNA stem-loop and branch main structure, two restriction endonucleases suitable for ARHGAP44 were selected according to the CDS region sequence of the ARHGAP44 gene: EcoRI and KpnI; then, the EcoRI / AgeI restriction endonuclease cleavage site sequence was inserted at both ends of the stem-loop structure branch, and the designed double-stranded Oligo sequence was synthesized base by base by chemical synthesis.

[0035] According to the above steps, the designed stem-loop shRNA vector sequence is as follows:

[0036]

[0037] The nucleotide sequence of the shRNA vector is shown in SEQ ID NO.3 or 4; wherein the sequence of SEQ ID NO.3 is: CcggtagCAACATCCGATACTTGATACTCGAGTATCAAGTATCGGATGTTGCTTTTTg;

[0038] The sequence of SEQ ID NO.4 is:

[0039] AttcaaaaaagCAACATCCGATACTTGATACTCGAGTATCAAGTATCGGATGTTGCT.

[0040] 3. Insert the shRNA sequence into the eukaryotic expression vector backbone to construct the shRNA plasmid vector

[0041] The shRNA Oligo sequence designed and biosynthesized above was double-digested with a specific fast-cutting enzyme to quickly double-digest the base sequence (digestion conditions: 37 degrees Celsius, 0.5-1h) to expose the EcoRI / AgeI sticky ends, and then connected with the eukaryotic expression vector that was double-digested and purified using ligase buffer (connection conditions: 22 degrees Celsius, 45min-1h). The connection product was transformed into DH5α competent bacteria, and positive clones were selected. After shaking the bacteria, the bacterial solution was sequenced and identified. The sequence that was successfully identified by sequencing was the successfully constructed ARHGAP44 gene shRNA plasmid vector. Figure 2 As shown, the shRNA plasmid vector designed based on the siRNA fragment was identified by sequencing and was consistent with the expected sequence.

[0042] 4. Transfection of shRNA plasmid vector into human osteosarcoma MG63 cell line

[0043] The positive clones that were successfully constructed as shown by the sequencing results in the above steps were shaken in large quantities for plasmid extraction. The extracted shRNA plasmid vector was dissolved in sterile DEPC water, the plasmid concentration was determined, and human osteosarcoma MG63 cells were transfected using lipofectimane 2000 cationic liposome method.

[0044] Because the eukaryotic expression vector carries the NEO gene, it has resistance to the drug G418, while cells that are not transfected with the eukaryotic vector do not have G418 resistance. Based on this feature, osteosarcoma cell lines transfected with shRNA were stably screened.

[0045] 5. G418 drug screening to obtain ARHGAP44 stable knockdown expression cell line

[0046] Untransfected osteosarcoma MG63 cells were used as a control to screen the optimal concentration of G418. The screening steps were as follows: MG63 cells were seeded in a 24-well plate. When the cell density reached 50% to 70% the next day, the culture medium was replaced and G418 was added at concentrations of 500 ng / mL, 800 ng / mL, 1000 ng / mL, 2000 ng / mL, and 3000 ng / mL to start screening. The lowest concentration at which all cells died within 10 to 14 days was determined as the optimal screening concentration.

[0047] According to the above steps, the experimental results determined that the optimal concentration of G418 for human osteosarcoma MG63 was 800 ng / mL.

[0048] The osteosarcoma MG63 cells transfected with shRNA were seeded in six-well plates at a density of 50% to 70%. After 24 hours of plating, G418 at a concentration of 800 ng / mL was added proportionally. When the cell growth reached 90%, the cells were subcultured with a medium containing G418. The drug concentration was maintained for 10 to 14 days, and the screening was terminated when all the cells in the control group died.

[0049] According to the above steps, the osteosarcoma NG63 cell line with stable knockdown of ARHGAP44 gene was finally obtained and named: “MG63-ARHGAP-” cell line.

[0050] 6. QPCR experiment to identify the expression of ARHGAP44 gene in recombinant “MG63-ARHGAP-” cells

[0051] The cultured recombinant "MG63-ARHGAP-" cell line and the untransfected common osteosarcoma MG63 cell line were washed with PBS, and then Trizol was added to gradually extract the cell mRNA, which was reverse transcribed to obtain cDNA. QPCR analysis was used to verify the relative expression level of ARHGAP44 in the recombinant "MG63-ARHGAP-" cell line and the control cells.

[0052] Primer sequences used in the QPCR experiment:

[0053] ARHGAP44 forward primer F (SEQ ID NO.5): ACAACAACATCCGATACTTGA

[0054] ARHGAP44 reverse primer R (SEQ ID NO.6): TTGGCATTATGGTTCACG

[0055] GAPDH forward primer (SEQ ID NO.7): TGAAGGTCGGAGTCAACGGA

[0056] GAPDH reverse primer (SEQ ID NO.8): CCATTGATGACAAGCTTCCCG

[0057] Among them, the GAPDH gene is the internal reference control gene.

[0058] Set the QPCR experiment procedure: pre-denaturation at 94°C for about 10 min, 94°C for 15 sec, 58°C for 30 sec, 72°C for 34 sec, for a total of 40 cycles. Detect the Ct values of each template duplicate well, and use Folds = 2 -ΔΔCt to represent the expression difference of the target ARHGAP44 gene in the constructed recombinant cell line and osteosarcoma control cells. The calculation formula is as follows: ΔΔCt = [Ct(ARHGAP44) - Ct(GAPDH)] 实验组 - [Ct(ARHGAP44) - Ct(GAPDH)] 对照组 .

[0059] As Figure 3 shown, the QPCR experiment verified that compared with the untransfected osteosarcoma MG63 cells, the expression of the ARHGAP44 gene in the constructed "MG63-ARHGAP-" cell line. The results suggest that the expression level of the gene in the recombinant cells is significantly lower than that of the ordinary MG63 control cells, indicating that the recombinant cell line was successfully constructed and can achieve stable knockdown of the ARHGAP44 gene.

Claims

1. A shRNA molecule, characterized in that The nucleotide sequence of the shRNA molecule is shown in SEQ ID NO. 3 or 4.

2. A recombinant expression vector, characterized in that: The recombinant expression vector comprises a nucleotide sequence encoding the shRNA molecule according to claim 1 and a vector.

3. A recombinant expression vector according to claim 2, characterized in that: The vector is a eukaryotic expression vector.

4. Use of the shRNA molecule according to claim 1, or the recombinant expression vector according to claim 2 or 3 in knocking down the ARHGAP44 gene in human osteosarcoma cells.

5. A method for constructing an ARHGAP44 gene knockdown cell line, characterized in that: The following steps are involved: Exogenously express the shRNA molecule according to claim 1 in target cells.

6. The construction method according to claim 5, characterized in that: The target cells are human osteosarcoma cells.

7. The construction method according to claim 5, characterized in that: The target cells are human osteosarcoma MG63 cells.

8. A cell line with knockdown of ARHGAP44 gene expression, characterized in that: Obtained by the construction method according to any one of claims 5 to 7.

9. Use of the shRNA molecule according to claim 1, or the recombinant expression vector according to claim 2 or 3 in the preparation of a product for inhibiting the metastasis of osteosarcoma cells.

Images