Application of rice gene SLL4 in regulation and control of rice leaf shape

Abstract

The invention discloses application of a rice gene SLL4 in regulation and control of a rice leaf shape, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the SLL4 gene is as shown in SEQ ID NO. 1; the rice gene SLL4 regulates and controls the development of blister cells and thick-walled cells so as to influence the growth form of leaves, and overexpresses the SLL4 gene in rice, so that the curling degree of the leaves can be increased. The method disclosed by the invention is applied to production practice, is beneficial to shaping ideal plant types of rice and increasing the yield of crops, and has an important application value.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of rice gene SLL4 in regulating rice leaf shape. Background Art

[0002] Rice is one of the three major staple foods in the world and the most important food crop in my country. Rice belongs to the genus Oryza in the subfamily Oryza of the Poaceae family, and has 20 species, including two cultivated rice species, namely African cultivated rice and Asian cultivated rice (grain and japonica subspecies). Among the global rice cultivation area, the cultivated area of ​​Asian cultivated rice exceeds 95%. my country is one of the origins of cultivated rice, with more than 80 known ancient rice sites, ranking first in the world.

[0003] Rice yield is affected by many factors, among which the influence of plant type is very significant. Rice plant type is one of the important traits of rice, which is composed of leaf type, stem type, panicle type, root type and other parts. The leaves are the main place for rice to carry out photosynthesis and respiration. The photosynthetic energy storage and normal life function of rice are affected by the leaves. Therefore, leaf morphology is an important part of rice plant tissue occurrence and morphological construction. Leaf morphology affects the structure of rice plant type and plays a role in photosynthesis and stress resistance by changing the leaf area index of the plant. It is mainly evaluated by leaf length, leaf width, leaf color, leaf thickness, curl, leaf inclination, droop and other indicators. Appropriate leaf morphology is conducive to the increase of rice yield. Leaf size affects the photosynthetic leaf area and is also related to curl, uprightness and so on. Generally speaking, narrow and short leaves are upright leaves, wide and long leaves are mostly drooping leaves, and curled or thick leaves also have a certain effect on leaf uprightness. The leaf inclination angle distribution in rice leaf morphology is most closely related to the canopy light distribution, and the leaf inclination angle is also the main factor determining the leaf area index (LAI) distribution. The appropriate leaf inclination angle can allow the leaves to receive light on both sides, improving light efficiency. The curling of rice leaves can make the leaves of long-leaf rice varieties straight, reduce the overlapping of leaves, improve the light conditions in the middle and late stages of group growth, and improve photosynthetic efficiency.

[0004] With the development of molecular markers and the improvement of gene cloning technology, multiple leaf shape-related genes have been located in rice, some genes have been cloned, and some progress has been made in the study of rice leaf shape development and molecular regulation mechanism. At present, 28 genes related to rice leaf width, 16 genes related to rice leaf length, more than 60 genes regulating leaf inclination, and more than 30 genes controlling rice leaf curling have been successfully cloned. At present, most of the rice leaf curling genes that have been successfully located and cloned are related to rice bullose cells, and only a few are related to the development of rice leaves with adaxial or abaxial polarity.

[0005] So far, a series of genes encoding transcription factors that regulate leaf shape have been reported in rice. For example, the OsMYB103L gene encodes an R2R3-type MYB transcription factor with transcriptional activation activity, which is homologous to AtMYB103 in Arabidopsis. Overexpression of OsMYB103L causes curling of rice leaves. SLL1 encodes a SHAQKYF-type MYB transcription factor belonging to the KANADI family. In the sll1 mutant, the leaves are extremely curled inward because thick-walled cells cannot be formed on the abaxial surface of the leaves. Expression of the SLL1 gene can restore this mutant phenotype. OsCOW1, a member of the rice YUCCA gene family, functions in the tryptophan-dependent IAA biosynthesis. The oscow1 mutants caused by homozygous insertion of Tos17 or T-DNA all have the following characteristics: leaves curl upward. When oscow1 mutant seedlings are planted under conditions of low light intensity and high relative humidity, the curled leaf phenotype is restored, while the transpiration rate of the wild type is reduced by 5 to 10 times, indicating that the curled leaf phenotype of the mutant is caused by water loss and wilting rather than morphological defects. OsLBD3-7 is a typical LBD family member. OsLBD3-7 may act as an upstream regulatory gene of bulliform cell development to regulate leaf curling. HD-Zip IV family members ROC8 and ROC5 both affect the formation and development of leaf bulliform cells, that is, the number and size of bulliform cells, and thus regulate the direction of leaf curling. They regulate the curling of rice leaves in the form of heterodimers. OsHox32 is a member of the HD-Zip III family. The number of bulliform cells in the OsHox32-OV line is reduced, resulting in narrow leaves that curl toward the adaxial surface. LF1 encodes a HD-ZIPIII transcription factor. Due to defects in polarity development, the lf1 mutant has curled leaves on the front and sunken lemmas. Overexpression of the zinc finger homeodomain-containing transcription factor OsZHD1 induces curling of rice leaves due to an increase in the number of bulliform cells.

[0006] In summary, leaf shape, as an important agronomic trait of rice, is an important component of the ideal plant type and plays an important role in variety improvement and molecular design-assisted breeding. It is of great significance to analyze the transcription factors that regulate leaf shape in rice and explore their mechanism of action in regulating rice leaf shape. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a gene and protein for regulating rice leaf shape. The specific technical solution is as follows:

[0008] The present invention provides a rice gene SLL4, the nucleotide sequence of the SLL4 gene is shown in SEQ ID No.1; the nucleotide sequence also includes mutants, alleles or derivatives generated by adding, replacing, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1.

[0009] The present invention also provides a protein encoded by the above gene, the amino acid sequence of which is shown in SEQ ID No. 3; the amino acid sequence also includes an amino acid sequence or derivative generated by adding, replacing, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown in SEQ ID No. 3.

[0010] The present invention also provides a plasmid containing the gene and an overexpression vector HJEV6-SLL4 containing the gene.

[0011] The present invention also provides a host cell containing the above SEQ ID No. 1 sequence, and the host cell is one of an Escherichia coli cell, an Agrobacterium cell, and a plant cell.

[0012] The present invention also provides an application of a rice gene SLL4 in regulating leaf shape, wherein the functional protein encoded by the rice gene SLL4 regulates the development of bullous cells and thick-walled cells to affect the morphology of leaves; the application approach is to increase the curling degree of leaves by overexpressing the SLL4 gene in rice.

[0013] The present invention also provides a method for improving rice plant type by increasing the curling degree of leaves, wherein the SLL4 gene is transformed into rice cells, and then the transformed rice cells are cultivated into plants.

[0014] The present invention also provides a rice with curled leaves, in which the SLL4 gene is overexpressed.

[0015] The present invention also provides an application of a rice gene SLL4 in rice plant type improvement breeding.

[0016] The specific technical steps for implementing the present invention are as follows:

[0017] I. Isolation and genetic analysis of the rice allium leaf curl mutant sll4

[0018] The rice shallot-like 4 (shallot-like 4) leaf-curling mutant sll4 used in the present invention is obtained by treating seeds of the japonica rice variety Nipponbare (Japonica) with a 1% concentration of chemical mutagen (ethyl methane sulphonate, EMS) to obtain a mutant material sll4 with leaves half-curled inward. The mutant was then isolated into three phenotypes: flat leaves, half-curled leaves and shallot-like leaves, with a separation ratio of nearly 1:2:1. After continuous self-pollination for multiple generations, the shallot-like 4 leaf-curling mutant can be stably inherited, so a homozygous shallot-like 4 leaf-curling mutant is obtained, such as Figure 1The homozygous onion leaf curl mutant was reciprocally crossed with ZF802, TN1 and Guangsi, and it was found that the F1 generation showed the half-rolled leaf trait regardless of whether the mutant was the female parent or the male parent. The phenotypes of the F2 segregation generation of each combination were further analyzed, and the segregation ratios of wild-type plants, half-rolled leaf plants and onion leaf curl plants in each F2 population were analyzed by SAS statistical software. 2 The P values ​​of the test were all much greater than 0.05, indicating that the separation ratio of wild-type plants, semi-curled leaf plants and onion-curled leaf plants was close to 1:2:1. Therefore, it was speculated that the curling trait of rice leaves was a quality trait controlled by a dominant nuclear gene.

[0019] 2. Map-based cloning of the SLL4 gene that controls rice leaf shape

[0020] 1. Preliminary localization of the SLL4 gene

[0021] In order to isolate the SLL4 gene, the present invention uses the F2 population formed by hybridizing the mutant sll4 with the indica rice variety Taichung Local Number (TN1) as the positioning population. During the peak tillering period of the F2, the individual plants with the green onion curl phenotype are identified and selected for the preliminary positioning and fine positioning of the SLL4 gene. The SLL4 gene is preliminarily positioned on the long arm of chromosome 4 and between the P1 and P2 markers ( Figure 2 ).

[0022] 2. Fine positioning of the SLL4 gene

[0023] By comparing the sequence of indica rice variety 9311 and japonica rice variety Nipponbare and developing new molecular markers (Table 1), the SLL4 gene was precisely located between M4 and M5, with a physical distance of 51 kb, which contained a total of 4 open reading frames (ORFs). By sequencing and analyzing the open reading frames (ORFs) in this segment, the SLL4 gene was determined to be located at 28408664-28416032 on chromosome 4 ( Figure 3 ).

[0024] 3. Identification and functional analysis of the SLL4 gene

[0025] The SLL4 overexpression vector was constructed using the HJEV6 plasmid. Construction steps: Using the cDNA of the japonica rice variety "Nipponbare" as a template, PCR amplified a 1839 bp cDNA sequence, and the fragment was connected to the SacI restriction site of the HJEV6 vector to obtain the HJEV6-SLL4 overexpression vector ( Figure 4 ).

[0026] Through transgenic technology, transgenic research on functional overexpression was carried out, and the results showed that the present invention obtained overexpression transgenic rice with curled leaves, proving that the present invention correctly cloned the SLL4 gene, clarified the DNA sequence (SEQ ID No.1) and cDNA sequence (SEQ ID No.3) of the SLL4 gene, and amino acid sequence analysis showed that the SLL4 gene encodes a C2H2-type zinc finger transcription factor (SEQ ID No.2).

[0027] The present invention cloned and identified a gene affecting rice leaf morphology from a rice shallot leaf curling mutant sll4 (shallot-like 4), named it SLL4, and verified the gene function through overexpression experiments. It was found that the SLL4 gene played a positive regulatory role in the curling morphology of rice leaves, and the functional protein encoded by the gene affected the morphology of leaves by regulating the development of bulliform cells and thick-walled cells.

[0028] Beneficial effects of the present invention:

[0029] The present invention provides a new gene SLL4 cloned from a rice leaf curl mutant. Overexpression of the SLL4 gene can increase the curl of the leaves. The functional protein encoded by the gene affects the morphology of the leaves by regulating the development of bullous cells and thick-walled cells. The present invention provides new gene resources and theoretical guidance for rice plant type improvement and molecular design breeding, helps to shape the ideal rice plant type, and increases the yield of crops, and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is the phenotype diagram of wild-type Nipponbare (NPB) and the onion leaf curling mutant sll4;

[0031] Figure 2 This is the preliminary location map of the leaf roll gene SLL4 on rice chromosome 4;

[0032] Figure 3 This is the fine-scale localization map of the leaf roll gene SLL4 on rice chromosome 4;

[0033] Figure 4 is the plasmid map of the overexpression vector HJEV6-SLL4;

[0034] Figure 5 This is the phenotype of Nipponbare plants after overexpression of the SLL4 gene;

[0035] Figure 6 This is the phenotype of the Nipponbare plant after the SLL4 gene was knocked out. DETAILED DESCRIPTION

[0036] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0037] Example 1: Map-based cloning of the SLL4 gene

[0038] 1. Rice material

[0039] The rice (Oryza sativa L.) mutant sll4 (shallot-like 4), whose original wild type material is the japonica rice variety Nipponbare. The rice (Oryza sativa L.) mutant sll4 (shallot-like 4) is obtained by treating the japonica rice variety (japonica) Nipponbare with a 1% concentration of chemical mutagen (ethyl methane sulphonate, EMS), and the mutant material sll4 with half-curled leaves inward was obtained. The mutant was later isolated into three phenotypes: flat leaves, half-curled leaves, and onion-curled leaves, and the separation ratio was close to 1:2:1. After continuous self-pollination for multiple generations, the onion-curled leaf mutant can be stably inherited, and thus the homozygous mutant sll4 was obtained. The mutant begins to show the curled leaf phenotype from the seedling stage and accompanies the entire growth period, such as Figure 1 shown.

[0040] 2. Analyze and position groups

[0041] The homozygous sll4 mutant was crossed with the indica rice variety TN1, and the F1 generation was selfed to obtain the F2 population. The F2 population had a total of 474 plants, of which 108 had normal leaves, 112 had semi-curled leaves, and 254 had onion-curled leaves. The 254 sll4 mutants were selected as the primary and fine positioning populations. About 1 gram of young leaves were taken from each plant at the tillering stage to extract total DNA.

[0042] 3. Localization of SLL4 gene by SSR and STS markers

[0043] The improved CTAB method was used to extract genomic DNA from rice leaves for gene localization. Take 3-5cm rice leaves, cut them into pieces and put them into a 2.0ml eppendorf centrifuge tube, add 2 steel beads, 700μl extraction solution, place them in the TissueLyser IIsystem tissue grinder, grind for 2-3min, place them in a 65℃ constant temperature oven for 40-60min, and shake them 1-2 times during the period. Then add 500μl chloroform to extract, shake them up and down vigorously, let them stand and then centrifuge, draw 500μl supernatant, add an equal amount of frozen isopropanol, centrifuge, wash them with 70% alcohol 1-2 times, dry them and add 200μl ultrapure water as DNA samples. Use 2-3μl DNA sample for each PCR reaction.

[0044] Preliminary positioning of the SLL4 gene: The BSA method was used to construct a mixed pool of onion curled leaves (20-30 plants with onion curled leaf phenotype were mixed in equal amounts and DNA was extracted) and a mixed pool of normal leaves. The 136 pairs of SSR primers synthesized in the laboratory and evenly distributed on 12 chromosomes were used to perform polymorphism analysis on the parents of the segregated population. Polymorphic molecular markers were selected to analyze the linkage group of the SLL4 gene, and similar linkage markers were found. The onion curled mutants in the F2 population were then used for verification to determine the linkage markers.

[0045] PCR amplification was performed using the PTC-200 gradient thermal cycler of MJ Research, where the total volume of the PCR amplification reaction was 20 μl, including 50 mmol / L KCl, 10 mmol / L Tris-HCl (pH 9.0), 1.5 mmol / L MgCl2, 200 μmol / L dNTP, 50-100 ng of genomic DNA, 1 unit of Taq polymerase and 0.1 μmol / L primers, and the rest was distilled water. The amplification program was 94°C pre-denaturation for 5 min, followed by cyclic amplification: 94°C denaturation for 45 s, annealing temperatures of each primer as shown in Table 1, annealing time 50 s, 72°C extension for 50 s, 35-39 cycles; 72°C extension for 10 min. The PCR products were electrophoresed in 4%-5% agarose gels and stained with ethidium bromide (EB) to detect the polymorphism of the PCR products. Finally, SLL4 was initially located between P1 and P2, with genetic distances of 1.5 cM and 5.8 cM from P1 and P2, respectively.

[0046] Fine positioning of the SLL4 gene: In order to further narrow the positioning interval of the SLL4 gene, we sampled the three traits of scallion curl, half curl and flat spread from the F2 segregating population of the sll4 / TN1 combination and conducted gene linkage analysis. Based on the results of the initial positioning, we developed multiple STS markers (Table 1) based on the differences between indica rice 9311 and japonica rice Nipponbare in the target segment on chromosome 4 published online.

[0047] PCR amplification was performed using the PTC-200 gradient thermal cycler of MJ Research, where the total volume of the PCR amplification reaction was 20 μl, including 50 mmol / L KCl, 10 mmol / L Tris-Cl (pH 9.0), 1.5 mmol / L MgCl2, 200 μmol / L dNTP, 50-100 ng of genomic DNA, 1 unit of Taq polymerase and 0.1 μmol / L primers, and the rest was distilled water. The amplification program was 94°C pre-denaturation for 5 min, followed by cyclic amplification: 94°C denaturation for 45 s, annealing temperatures of each primer as shown in Table 1, annealing time 50 s, 72°C extension for 50 s, 35-39 cycles; 72°C extension for 10 min. The polymorphism of the PCR products was detected by 4%-5% agarose gel electrophoresis separation and ethidium bromide (EB) staining.

[0048] Finally, the SLL4 gene was precisely located between M4 and M5, with a physical distance of 51 kb. The molecular marker sequences of the initial and fine positioning are shown in Table 1.

[0049] Table 1. Molecular marker sequences used for gene localization

[0050] Primer name Forward primer (5'-3') Back primer (5'-3') Fragment size (bp) Annealing temperature(℃) **P1 GTTCATTTCGTGATCTCTGAGC GCAGATTTACAGGTTTGCTAGG 264 55 **P2 ACCTCACCTTTCCCTCGATTGG GTTGGTTGCTTCCTCCCATACG 270 55 **P3 CGGAATCACCAATTTCTCTCTCAGC CGCAAGAAACGGAAACGAAACC 282 55 **P4 TTTGGGATAAATGGGAGAGG TCAGCTGGTTATTATGGAGAGG 361 55 *M1 TCATCACCCAATCCTATGTGTC AGGTCTGGAGCATGATTTGAG 747 55 *M2 ATTGCACGTCTCGTCTGACTT GCATCAGTTACAGCTTCACGAC 605 55 *M3 GAGCACAGAAACAGTATCATAGGG GCGGATGAAGTACGAGGATCTA 784 55 *M4 TTGATCGAGGCTTAAAATCTCA CTCACCAAGTTCGAAATCGTC 911 55 *M5 CCCACCATTGACCATTTTCTA ATCAGTATGCGCAGGAATTTG 898 55 *M6 TCTGGGTAGGCCTTATGCTTT CAGTGGACAAGTCCAACAACA 911 55 *M7 CGCACACACACAGTGACTAGC GGGATTTTGATCATCATGTGC 960 55 *M8 TTCAGATTGGTTCCGCTTATG TTCCGGACTGTGTAGTCCATC 901 55

[0051] Note: ** is used for initial positioning marks; * is used for fine positioning marks.

[0052] 4. SLL4 gene prediction, acquisition of full-length cDNA gene and prediction of function:

[0053] According to the results of fine mapping, according to the prediction of Rice Automated Annotation System (http: / / RiceGAAS.dna.affrc.go.jp), within the 51kb range, it was found that there were 4 open reading frames (ORFs) in this interval. After sequencing and analysis of these ORFs, it was found that one of the ORFs (LOC_Os04g47860) had a single base substitution (from C to T) in the second exon, resulting in proline becoming leucine. Therefore, we speculated that LOC_Os04g47860 is the candidate gene of SLL4. The RAP-DB database shows that the gene encodes a C2H2 zinc finger protein, containing 3 exons and 3 introns. The full-length CDS sequence of the SLL4 gene was obtained by PCR amplification (SEQ ID No: 3).

[0054] The protein encoded by the rice leaf rolling gene SLL4 has an amino acid sequence shown in SEQ ID No: 2. The "*" in SEQ ID No: 2 indicates a termination codon (TAG).

[0055] Example 2: Verification of SLL4 gene overexpression (method for improving rice leaf shape)

[0056] Using the cDNA of japonica rice variety "Nipponbare" as a template, primers 5'-TGTTACTTCTGCAGGAGCTCATGGCATCGAATTCATCGGC-3' and 5'-CTCACCATGGATCCGGTACCT GGCATCCTTCTCCCGTTGA-3' were used to amplify the 1839bp full-length cDNA sequence of the SLL4 gene, and the fragment was connected to the SacI restriction site of the HJEV6 vector. Then it was transformed into Escherichia coli DH5α, positive plasmids were identified by colony PCR, and the genetic transformation vector HJEV6-SLL4 containing the 1839bp full-length cDNA fragment of the SLL4 gene was obtained by sequencing the positive plasmids.

[0057] This plasmid was then transferred into the Agrobacterium tumefaciens strain EHA105 by electroporation to transform rice. Callus tissue induced from mature embryos of the japonica rice variety "Nipponbare" was cultured in the induction medium for 2 weeks, and then the vigorously growing calli were selected for transformation. Rice calli were infected with the EHA105 strain containing the plasmid HJEV6-SLL4, and after co-cultivation in the dark and 25°C for 3 days, they were cultured in the light for about 14 days on a screening medium containing 50 mg / L Hygromycin. The pre-differentiated calli were transferred to the differentiation medium and cultured under light conditions. Resistant transgenic plants were obtained in about a month, and the expression level was significantly increased. The plants were identified and continuously observed, and it was found that the overexpressing plants produced a leaf curling phenotype similar to that of the mutant (see Figure 5 ).

[0058] Example 3: Gene knockout to verify SLL4 gene function

[0059] The gene knockout vector was constructed using the A pYLCRISPR / Cas9-MH / B vector system of Liu Yaoguang's team at South China Agricultural University. The specific steps are as follows: first, the target linker was prepared using primers SLL4-U3-F: GGCAGC CTCACCAGCCACCTGTA and SLL4-U3-R: AAACTACAGGTGGCTGGTGAGGC. Next, the gRNA expression cassette was prepared by ligating the pYLgRNA-U3 vector with the corresponding linker, and then the gDNA expression cassette was amplified by two rounds of nested PCR. The gRNA expression cassette prepared in the above step was used as the template for the first round of amplification, and the amplification primers were UF: 5'-CTCCGTTTTACCTG TGGAATCG-3' and gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'. The first round amplification product was diluted 100 times as the template for the second round of amplification, and the amplification primers were Uctcg-B1': 5'-TTCAGAG GTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3' and gRcggt-BL: 5'-AGCGTG GGTCTCGACCGGGTCCATCCACTCCAAGCTC-3'. The two sets of amplified PCR products were purified and mixed in equal amounts, and then digested and ligated with the pYLCRISPR / Cas9-MH vector, and then transformed into DH5α. The positive plasmid was identified by colony PCR, sequencing, etc., so as to obtain the gene knockout vector pYLCRISPR / Cas9-MH-SLL4 of the gene. The plasmid pYLCRISPR / Cas9-MH-SLL4 was transferred into the Agrobacterium tumefaciens strain EHA105 by electroporation to transform rice. Then, callus tissue induced by mature embryos of the japonica rice variety "Nipponbare" was used. After culturing in the induction medium for 2 weeks, the vigorously growing callus was selected as the recipient for transformation. The rice callus was infected with the EHA105 strain containing the plasmid pYLCRISPR / Cas9-MH-SLL4. After co-cultivation in the dark and 25°C for 3 days, it was cultured in the light on a screening medium containing 50 mg / L Hygromycin for about 14 days. The pre-differentiated callus was transferred to the differentiation medium and cultured under light conditions. Resistant transgenic plants were obtained in about a month. The plants were identified and continuously observed, and it was found that the leaf curling of the transgenic rice was unchanged compared with the mutant at the same growth stage ( Figure 6 ).

[0060] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A rice gene SLL4, characterized in that: The nucleotide sequence of the SLL4 gene is shown in SEQ ID No. 1; the nucleotide sequence also includes mutants, alleles or derivatives generated by adding, replacing, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID No.

1.

2. A protein encoded by the rice gene SLL4 according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID No.3; the amino acid sequence also includes an amino acid sequence or derivative generated by adding, replacing, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown in SEQ ID No.

3.

3. A plasmid containing the nucleotide sequence of the SLL4 gene according to claim 1.

4. An overexpression vector containing the nucleotide sequence of the SLL4 gene according to claim 1, characterized in that: The overexpression vector is HJEV6-SLL4.

5. A host cell containing the nucleotide sequence of the SLL4 gene according to claim 1, characterized in that: The host cell includes one of an Escherichia coli cell, an Agrobacterium cell, and a plant cell.

6. Application of a rice gene SLL4 in regulating leaf shape, characterized in that: The functional protein encoded by the rice gene SLL4 regulates the development of bulliform cells and thick-walled cells to affect the morphology of leaves; the application approach is to increase the curling degree of leaves by overexpressing the SLL4 gene in rice.

7. A method for improving rice plant shape by increasing the curl of leaves, characterized in that: The SLL4 gene of claim 1 is transformed into rice cells, and the transformed rice cells are then cultured into plants.

8. A rice plant with curled leaves, characterized in that: The SLL4 gene is overexpressed in the rice.

9. Application of a rice gene SLL4 in rice plant type improvement breeding.

Images