Application of capsicum frutescens fruit shape gene CaFS1 in regulation of capsicum frutescens or tomato fruit shape

Abstract

The invention belongs to the technical field of pepper planting, and discloses a pepper fruit shape gene CaFS1, a KASP molecular marker linked with the gene and a corresponding primer, the KASP molecular marker is single nucleotide polymorphism at the 14853470th basic group on a pepper 10 # chromosome, and the basic group is replaced from C to T at the 14853470th basic group. The invention also discloses a method for obtaining a chromosome region closely linked with the fruit shape of the pepper fruit by using a whole genome association analysis and mixed pool separation analysis population localization method, developing a molecular marker in a candidate interval to determine a candidate gene CaFS1, and screening a KASP molecular marker according to the base mutation of the candidate gene. The marker is used for carrying out genotype identification on 90 randomly sampled single plants of the F2 group, and the coincidence rate reaches 100%. The result not only is beneficial to pepper fruit shape identification and auxiliary breeding, but also lays a foundation for map-based cloning of fruit shape genes and analysis of a molecular mechanism of pepper fruit shape change.

Description

[0001] (This application is an invention entitled "Pepper fruit shape gene CaFS1 The application for the divisional application of "and its linked KASP molecular markers, primers, acquisition methods and applications" was filed on September 22, 2023, with application number 202311236339.7.) Technical Field The invention belongs to the field of pepper breeding and molecular biology, and more specifically relates to a pepper fruit shape gene CaFS1 , and SNP molecular markers and primers (KASP) closely related to this gene, and also involve their applications in predicting pepper fruit shape changes and molecular assisted breeding. Background Art

[0002] chili( Capsicum annuum L. ) belongs to the genus Capsicum in the Solanaceae family and is one of the most important vegetable crops in China. Fruit is the most important economic output of pepper. Fruit shape is one of the most important selective traits in the process of crop cultivation and domestication selection. The fruits of wild peppers are extremely small, but in the process of domestication and improvement, the fruits of modern cultivated peppers have gradually become larger and evolved into a rich variety of shapes. For vegetable crops such as peppers whose fresh fruits are edible organs, fruit shape is an even more important commodity trait, because the shape and size of the fruit not only affect the yield and quality of the crop, but also affect consumers' consumption preferences, packaging needs and market value. At present, fruit shape is still an important trait that Chinese breeders pay great attention to in pepper breeding programs.

[0003] The fruit shape traits of pepper are regulated by quantitative trait loci (QTL) and are the main targets of molecular marker-assisted breeding (MAS). Although pepper has problems such as large genome, low molecular marker saturation of genetic linkage map, and time-consuming and labor-intensive QTL gene mining, the improvement of pepper genome information and the development of molecular marker technology have greatly promoted QTL cloning and functional analysis. Researchers have identified many pepper fruit-related QTLs sites through natural populations or hybrid populations. For example, 16 SNP sites were identified to be associated with fruit weight, of which 7 SNPs were located on known fruit weight genes, such as STYLOSA , FASCIATED , WUSCHEL and CLAVATA1 In terms of flesh thickness, Qpt.iivr-2.1, Qpt.iivr-3.1, ftd2.1 and other QTLs were identified, and QTL NloLG25.1 was found to be related to the number of ovaries. A gene related to the control of the ventricle of pepper was identified at lcn1.1. CaBRX ,silence CaBRXIt can significantly reduce the number of ventricles and affect the expression of flower and ventricle related genes. fs3.1 and fs10.12 were found to be the strongest major QTLs for fruit length, explaining 67% and 44% of the genetic effects, respectively. Although some related gene QTLs have been found in pepper fruit trait research, the mode of action of these regulatory factors is still poorly understood, and their application is still limited and inefficient.

[0004] Therefore, exploring the key genes or QTL functions of important agronomic traits of pepper, such as fruit shape, and developing molecular markers related to fruit shape are of great significance for the establishment of a molecular breeding technology system for pepper. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a method for producing a fruit shape gene of pepper. CaFS1 Linked SNP molecular markers (KASP markers) provide new ways for the screening, identification and auxiliary screening of pepper fruit shape, as well as the breeding of pepper fruit shape.

[0006] In order to solve the above technical problems, the technical solution proposed by the present invention is: In the first aspect, the present invention provides a method for CaFS1 The linked KASP molecular marker uses the pepper zunla-1 gene as the reference gene and is a single nucleotide polymorphism at the 14853470th base on pepper chromosome 10, where a substitution from base C to T occurs.

[0007] Pepper fruit shape gene CaFS1 The linked KASP molecular marker, preferably, has a nucleotide sequence as shown in SEQ ID NO:2.

[0008] In a second aspect, the present invention provides a primer for identifying the KASP molecular marker, comprising: Forward primer 1: GAAGGTGACCAAGTTCATGCTTGTTTTAACAGAAACTGGTGTTTTC; Forward primer 2: GAAGGTCGGAGTCAACGGATTTGTTTTAACAGAAACTGGTGTTTTT; Reverse primer: AAAAAGTGCTAACAGGACATCACG.

[0009] The two forward primers are connected to different fluorescent linker sequences respectively. The linker sequence matching the FAM fluorescence in forward primer 1 is GAAGGTGACCAAGTTCATGCT, and the linker sequence matching the HEX fluorescence in forward primer 2 is GAAGGTCGGAGTCAACGGATT.

[0010] In a third aspect, the present invention provides a method for screening the KASP molecular marker, comprising the following steps: (1) Resequencing of pepper materials, and genome-wide association analysis of pepper fruit shape traits based on the resequencing results. On this basis, a high-generation inbred line of pepper with long fruits was used as the male parent, and a high-generation inbred line of pepper with round fruits was used as the female parent, and the F2 population was constructed by hybridization; (2) The fruit shape phenotype of the F2 population was identified, and a long-fruited mixed pool and a round-fruited mixed pool were obtained by using a mixed pool segregation analysis population positioning method, and RNA-seq sequencing was performed. After bioinformatics analysis of the sequencing results, candidate chromosome regions linked to the fruit shape of pepper fruit were obtained; (3) Develop molecular marker technology to replace / insert / delete single bases in the candidate region of the chromosome to narrow down the candidate interval and finally obtain the fruit shape gene CaFS1 Tightly linked KASP molecular markers.

[0011] In a fourth aspect, the present invention provides an application of the KASP molecular marker or the primer in identifying the types of long and round fruits of pepper or in molecular assisted breeding. This is beneficial to the rapid identification and breeding of pepper fruit shape genes, and to cloning the main effect genes controlling fruit shape, laying a foundation for studying the regulatory mechanism of fruit shape changes.

[0012] The above application, preferably, the application method is as follows: S1: Extract the DNA of pepper sample to be tested as template; S2: adding the primers to perform PCR amplification; S3: Use KASP reagent for typing and read the typing results. Blue represents round fruit dominant FAM, green represents long fruit recessive HEX, and red represents intermediate fruit heterozygous Heterozygote.

[0013] Preferably, a quantitative PCR device is used for PARMS PCR amplification; when the fluorescent group and the corresponding fluorescent quenching group are close to each other, the fluorescence emitted by the fluorescent group will be absorbed by the quenching group, emitting fluorescence with a longer wavelength or releasing heat. At this time, the fluorescent signal of the group cannot be detected within the wavelength corresponding to this fluorescence. Once the two are separated, the fluorescent signal can be detected. PARMS uses the FRET principle to detect the amplification signals of FAM and HEX fluorescent primers. When the corresponding allele is amplified, the corresponding fluorescent signal will appear.

[0014] Preferably, the PCR amplification program is: Preincubation 94°C 900S; 94°C 20S, 78°C 10S, TD62°C, 0 Cyc->57 (-0°C), 10 cycles; 94°C 20S, 57°C 60S, 35 cycles; Cooling 37°C 30S.

[0015] In a fifth aspect, the present invention provides a pepper fruit shape gene CaFS1 The CDS nucleotide sequence of its coding region is shown in SEQ ID NO: 1.

[0016] In a sixth aspect, the present invention provides a pepper fruit shape gene CaFS1 Application in regulating pepper or tomato fruit shape.

[0017] The above application, preferably, is silent in pepper CaFS1 Gene, cultivate pepper varieties with short fruit shape.

[0018] Preferably, overexpression in tomato CaFS1 Genes, breeding long-fruit tomato varieties.

[0019] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention screens a KASP molecular marker that can be directly used for the identification of pepper fruit shape, and then relies on the molecular marker for assisted breeding, which can effectively solve the problems of long conventional breeding cycle and susceptibility to environmental influences, and is of great significance in the pepper fruit shape breeding practice and the study of fruit shape change and regulatory mechanism; the marker is used to perform genotype identification on 90 randomly sampled individual plants of the F2 population, and the coincidence rate reaches 100%. This result is not only helpful for the identification of pepper fruit shape and assisted breeding, but also lays a foundation for the map-based cloning of fruit shape genes and the analysis of the molecular mechanism of pepper fruit shape change.

[0020] 2. By using this molecular marker at an early stage, satisfactory plants can be quickly screened, which effectively reduces the planting scale, reduces the workload of later identification, improves the efficiency and accuracy of selection, and is of great significance for studying the mechanism of fruit color formation. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 This is a preliminary genome-wide association study (GWAS); Figure 2 The phenotypes of 90 individual plants of the parents, F1 and run markers; Figure 3 Some results of genotyping of KASP148 marker in F2 population; Figure 4 Identification of TRV-mediated CaFS1 gene silencing in D40 fruit, including: (A) pTRV2-CK: phenotype of pepper plants infected with TRV empty vector, pTRV2-CaPDS: phenotype of pepper plants infected with TRV-PDS, pTRV-CaFS1: phenotype of D40 plants infected with TRV-CaFS1; (B) Real-time fluorescence quantitative PCR detection of TRV-induced CaFS1 gene silencing in D40; (C) Fruit phenotype of TRV-mediated CaFS1 gene silencing strains; Figure 5 for CaFS1 Identification and phenotypic observation of OE lines. (A) PCR positive detection of transformed plants, M represents DL2000 marker, B represents blank control, N represents negative control, and P represents positive control; (B) CaFS1 Tomato fruit shape phenotype of OE lines. DETAILED DESCRIPTION

[0023] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0024] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0025] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0026] Example: The present invention uses two highly homozygous materials to construct an F2 population. The chromosome region that is closely linked to the fruit shape (long round fruit) of pepper is obtained by using the whole genome association analysis (GWAS) and pooled segregation analysis (BSA) population positioning methods, and molecular markers are developed within the candidate interval to determine the candidate gene CaFS1 The nucleotide sequence is shown in SEQ ID NO: 1. A KASP molecular marker screened based on the base mutation of the candidate gene can be directly used for the identification of pepper fruit shape, and then the molecular marker is used for auxiliary breeding, which can effectively solve the problem of long conventional breeding cycle and susceptibility to environmental influences. By using the molecular marker at an early stage, satisfactory plants can be quickly screened, effectively reducing the planting scale, reducing the workload of later identification, and improving the efficiency and accuracy of selection.

[0027] Pepper long round fruit shape gene CaFS1 The method for obtaining the linked molecular marker KASP molecular marker is as follows: 1. Construction of genetic population In the early stage of this invention, 10X resequencing was performed on 383 pepper materials. Based on the resequencing results, a genome-wide association study (GWAS) was performed on the pepper fruit shape traits, and a very strong GWAS signal was found on chromosome 10. Figure 1 Subsequently, two high-generation homozygous inbred pepper materials, long-fruit "D40" and round-fruit "D39", were selected as parents to construct F1 and F2 populations. By investigating the target traits of the populations, genetic analysis of pepper fruit shape traits was conducted.

[0028] 2. Phenotypic identification of fruit shape The phenotype of each individual plant in F1 and F2 was identified. Three fruits on the "four-door bucket" of each plant at the green and ripe stage were harvested, photographed with a digital camera, and the length and width of the fruit were measured using a digital vernier caliper to complete the phenotypic identification of the fruit shape traits.

[0029] 3. QTL analysis of fruit shape Plant the F2 segregation population, select the longest and roundest 20 plants, extract leaf DNA, and mix the sample DNA in equal amounts to construct the round fruit pool and the long fruit pool DNA after quality inspection. Use the Illumina sequencing platform to perform whole genome resequencing of the two mixed pools (sequencing depth of 30x) and the two parents (sequencing depth of 10x). The reads obtained by DNA-seq sequencing of the two mixed pools were aligned to the pepper zunla-1 reference gene (http: / / peppersequence.genomics.cn), and bwa was used for mapping, samtools for SNP calling, and SNP-Index was calculated. The SNP-Index of the two extreme mixed pools was subtracted to obtain Δ(SNP-Index), and the Δ(SNP-Index) of each region on the chromosome was calculated by the sliding window method.

[0030] 4. Fine positioning of major QTLs for fruit shape The chromosomal region of the QTL controlling fruit shape was obtained through step 3. In order to further narrow down the candidate region of the gene controlling fruit shape, the DNA sequence variation within the QTL segment was analyzed, the SNPs sites that met the requirements in the fine positioning interval were screened, and the KASP markers were developed to perform genotyping on the individual plants in the F2 population to determine the exchange plants. The screening criteria mainly included: (1) base changes from C to T or G to A; (2) SNP-index = 0.9-1 in the mutation pool. Analyze whether these SNPs will cause structural changes in the genes in which they are located, such as premature termination, amino acid changes, etc. After narrowing down the candidate interval through KASP genotyping technology, combined with the genetic linkage map, the candidate gene was successfully located within the 0.7Mb interval of chromosome 10.

[0031] 5. Development of molecular markers linked to oblong fruit shape The annotation information of genes in the fine-mapped interval was analyzed to find genes with related functions. Total RNA from different tissues of the round and long fruits of the parents was extracted and reverse transcribed into cDNA. Real-time fluorescence quantitative PCR (RT-qPCR) was used to measure the expression levels of all genes in the fine-mapped interval in the two parents, and genes related to gene expression characteristics were screened. Based on the above information, IQ-DOMAIN1, which connects the calcium signaling pathway and gene expression regulation, was selected as a candidate gene and named CaFS1 , CaFS1The CDS nucleotide sequence of the coding region is shown in SEQ ID NO: 1, and the sequence of the gene was further cloned. Through sequencing, it was found that the gene had 4 base variations, and the variations of two sites were also sequenced in the BSA sequencing annotation. KASP marker primers were designed for the two markers, and it was found that they could well distinguish the round fruit, long fruit and F1 of the parents. Finally, the marker KASP148 with the best typing effect was selected to perform genotyping on 90 random plants in the F2 population. Marker KASP148 is a single nucleotide polymorphism at the 14853470th base on chromosome 10 of pepper, where a base C to T substitution occurred. The nucleotide sequence of the marker KASP148 is shown in SEQ ID NO: 2, and a C to T substitution occurred at the 201st base in SEQ ID NO: 2.

[0032] SEQ ID NO: 1: 。

[0033] SEQ ID NO:2: GTAGAAACACATCTAAGGTTGAACATATTACCTTCTTTCAGTTGCTTTTAAGATACCGCTTCCTGTTTGTCAATGCTTGTCTCAACTTTGTTGATTCCTTTCTGTGCAGTTAGTTTATCTGCTGCTTCGTATGATAGCTTTCTAGGCTTCATAGCACGTTTCCAATTGGCTGAAGTTGTTTTAACAGAAACTGGTGTTTTC GTTGTTTGAGTTTTATTACTCGTAGGAGTTTTCCGTGATGTCCTGTTAGCACTTTTTGGACTTGATTGAACAGGAATTCGACTTTCCCATGGCCGTGCAGCGATCCAGCGATCTGTCCAGCTCCAGCCCCAATGAGCTTTGCCTAATTCATGGTTACTTGATCCGACTATTGGGTTGGAATTGGCTCTCCACTGTGACAA.

[0034] 6. Application of molecular markers linked to oblong fruit shape (1) CTAB method was used to extract DNA from 90 individual plants in the F2 population a. Add dithiothreitol (DTT, 0.2%) to the CTAB extraction solution; b. Add 2 fresh leaves the size of the centrifuge tube cap into a 2.0ml centrifuge tube; grind them into powder with liquid nitrogen, add 800-900µL CTAAB buffer and mix well; c. 65℃ water bath for 30min-1h, gently shake 1-3 times during the period, and cool to 4℃ or room temperature to below 15℃ after water bath; d. Add 500 chloroform / isoamyl alcohol (24:1) and mix up and down for 2-5 minutes to ensure that the sample and chloroform are fully mixed; e. Centrifuge at 12,000 rpm for 10 min. Take 500 µL of the supernatant and add it to a 1.5 ml centrifuge tube pre-added with 500 µL of isopropanol. Gently invert upside down to mix; place in a 4°C or -20°C refrigerator for more than 30 min; f. Centrifuge at 12,000 rpm for 10-20 min, discard the supernatant; wash the precipitate with 500 ul of 75% alcohol, centrifuge at 12,000 rpm for 5 min, and discard the supernatant; g. Air-dry the DNA to allow the alcohol to evaporate completely; add 100µL of pure water (containing a final concentration of 1% RNase) to dissolve the DNA; h. Remove RNA in a 37℃ water bath or at room temperature for 1 hour; take DNA for electrophoresis. After the band is confirmed to be intact, use a micro-spectrophotometer to measure the DNA concentration. The ratios of 260 / 280 and 260 / 230 must be greater than 1.8. Dilute the DNA to 100 ng and place at -20℃ for later use.

[0035] (2) KASP148 marker typing of individual plants in the F2 population a. KASP primer reagent is generally composed of 3 primers, 2 of which are allele-specific forward primers; 1 is a universal reverse primer; the 2 allele-specific forward primers only differ in the 3' end base, corresponding to different alleles. Allele-specific forward primers will produce different fluorescent signals through competitive PCR reaction. The adapter sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGATT; KASP148 primers were designed by SNPWay ( http: / / www.snpway.com / ): 148-5F: 5'-GAAGGTGACCAAGTTCATGCTTGTTTTAACAGAAACTGGTGTTTTC-3' (as shown in SEQ IDNO: 3); 148-5R: 5'-GAAGGTCGGAGTCAACGGATTTGTTTTAACAGAAACTGGTGTTTT-3' (as shown in SEQ IDNO: 4); 148-5C: 5'-AAAAAGTGCTAACAGGACATCACG-3' (as shown in SEQ ID NO: 5); b. KASP148 primer synthesis was from Qingke Biotechnology (PAGE purification); c. The typing system is shown in Table 1 below: Table 1: Classification system

[0036] Amplification Procedure: Preincubation 94℃ 900s; 94℃ 20s, 78℃ 10s, TD 62℃, 0 Cyc->57 (-0℃), 10 cycles; 94℃ 20s, 57℃ 60s, 35 cycles; Cooling 37℃ 30s.

[0037] (3) Typing results The fruit shape of individual plants in the F2 population was phenotypically identified using the KASP148 marker. The fruit shapes and genotypes of 90 individual plants in the F2 population constructed by KASP148 marker D40 and D39 are shown in Table 2. The phenotypes of the 90 individual plants of the parents, F1 and run markers are shown in Figure 2 , the identification results of some F2 plants are as follows Figure 3 As shown, the genotyping results were 100% consistent with the phenotyping results.

[0038] Table 2: Fruit shape and genotype of 90 individual plants in the F2 population constructed by D40 and D39 using KASP148 marker

[0039] 7. VIGS Verification CaFS1 Regulating the shape of the fruit "D40" In order to gain a preliminary understanding CaFS1 Whether there is any effect on pepper fruit shape is further evaluated by VIGS CaFS1 function.

[0040] use CaFS1 The full length of CDS was searched on the Solanaceae VIGS webpage (https: / / vigs.solgenomics.net / ) to obtain the most effective silencing region. According to the principle of primer specificity design, Geneious Prime software was used to design CaFS1 The silencing fragment primers are used to amplify the silencing target fragment and recover the product.

[0041] The pTRV2 vector was treated with EcoRI and BamHI double enzyme digestion and recovered, the purified product of the target fragment was recombined with the TRV2 vector, and the recombinant product was transformed into Escherichia coli DH5α, a Kan-resistant plate was coated, and a single clone was selected for PCR identification and TRV2 universal primer sequencing verification.

[0042] The correct viral recombinant plasmid DNA was extracted and identified, and transformed into Agrobacterium strain GV3101 to obtain Agrobacterium containing the recombinant vector. The single clone of Agrobacterium was identified by PCR using target gene-specific primers. The infection solution (10mMMgCl2, 10mM MES, 200uM AS) was prepared and the plants were infected by leaf injection method, with empty vector and reporter gene (phytoene desaturase, PDS) as controls.

[0043] The pepper plants were inoculated with the bacterial solution and placed in the dark for 24 h. The inoculated plants were then transferred to a room with 16 h of light (200 umol / m 2 / s, 22 ± 2℃) / 8 h dark (20±2℃) photoperiod and 70% relative humidity in an artificial climate incubator for about three weeks. About three weeks after virus inoculation, we used the photobleaching phenomenon of the leaves of the positive control plants as a signal of effective inoculation. TRV virus detection primers were used to detect PTRV2- CaFS1 New leaves were tested by PCR to obtain positive lines, and the silencing efficiency of positive plants was evaluated by real-time fluorescence quantitative PCR.

[0044] Finally, the phenotypic observations of relevant traits were carried out on the positive lines.

[0045] The results showed that compared with the control, the silenced CaFS1 The fruit shape of the plant strains changed significantly, with the long fruits becoming shorter and smaller (4).

[0046] 8. Overexpression CaFS1 Causes tomato fruit to lengthen For further research CaFS1 To investigate the effects of morphological changes on tomato fruit shape, we constructed CaFS1 High expression strains.

[0047] according to CaFS1 The full-length sequence primers were designed based on the CDS and restriction endonucleases were added. The target fragment was amplified from the parent and the product was purified. The overexpression vector Gate8 was treated with XhoI and XbaI and recovered. After homologous recombination, the recombinant product was transformed into Escherichia coli and coated with spec resistance plates. The recombinant clones were selected for shaking. The colonies were PCR verified for positive clones using universal primers 35SF and Gate8R, and then sequenced to verify the transformation into Agrobacterium.

[0048] Transformed regenerated plants were obtained through seed germination, cotyledon pre-culture, Agrobacterium-mediated genetic transformation, screening culture and differentiation, and resistance bud rooting. Subsequently, the leaves of the regenerated plants after genetic transformation were cut from the CaFS1 overexpression line, and DNA was extracted using the CTAB method. PCR detection was performed using screening marker gene-specific primers to determine the positive plants, and then the overexpression efficiency of the positive plants was evaluated and the phenotype was observed by real-time fluorescence quantification. CaFS1 The lines with significant expression levels and obvious changes in fruit shape were propagated to the T3 generation for phenotypic observation.

[0049] The results showed that pepper was overexpressed in tomato CaFS1 It will make the fruit longer, indicating CaFS1 It regulates the shape of the fruit. Figure 5 ).

Claims

1. A pepper fruit shape gene CaFS1 Application in regulating pepper or tomato fruit shape, It is characterized in that The gene CaFS1 The CDS nucleotide sequence of the coding region is shown in SEQ ID NO:

1.

2. The use according to claim 1, It is characterized in that Silence in the peppers CaFS1 Gene, cultivate pepper varieties with short fruit shape.

3. The use according to claim 1, It is characterized in that Overexpression in tomato CaFS1 Genes, breeding long-fruit tomato varieties.

Images