Recombinant of viral vector and human tumor suppressor gene and application thereof

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses a recombinant of a viral vector and a human tumor suppressor gene and application thereof, and application of the recombinant constructed by utilizing an adenovirus vector and the human tumor suppressor gene in preparation of drugs for treating tumor-related diseases. According to the invention, the human tumor suppressor gene is cloned to the adenovirus by utilizing the characteristic that the human tumor suppressor gene can inhibit the growth of various tumor cells, so that the human tumor suppressor gene is effectively introduced into the tumor tissue, the corresponding protein is expressed to inhibit the growth of the tumor tissue, and the growth retardation or apoptosis of the tumor cells occurs, thereby achieving the purpose of inhibiting the tumor; according to the recombinant, adenovirus is used for carrying the human tumor suppressor gene to be directly expressed in tumor cells, so that the problem that a recombinant gene engineering product cannot be prepared in vitro by a gene engineering method due to unstable protein expression of the human tumor suppressor gene is solved; according to the method, the exogenous human tumor suppressor gene is transferred and efficiently expressed in the tumor tissue of a patient, so that the treatment purpose is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of gene engineering technology, and specifically relates to a recombinant of a virus vector and a human tumor suppressor gene and application thereof. Background Art

[0002] With the advancement of molecular biology technology, especially the development of genetic engineering technology, gene therapy for malignant tumors has become a hot topic of research. At present, there are more than 600 gene therapy programs approved for clinical trials worldwide, and some treatment programs have achieved certain therapeutic effects, preliminarily showing the prospects of gene therapy. Only by combining genes with potential therapeutic effects with transferable gene vectors, and through the latter's mediation, the target gene is introduced into the target cell and expressed, can a real clinical therapeutic effect be achieved. Therefore, constructing the fusion sequence of the therapeutic gene and the gene vector is the key to achieving gene therapy.

[0003] The lack of specific, targeted and efficient gene transfer vectors has always been a difficult problem in tumor gene therapy. At present, the vectors used in gene therapy research are mainly divided into two categories: viral vectors and non-viral vectors. Commonly used viral vectors include adenovirus vectors, adeno-associated virus vectors and retrovirus vectors. Adenovirus vectors are commonly used gene vectors. Their advantages are high transfection efficiency, good operability, ability to carry large target gene fragments, ability to prepare high-titer virus particles, ease of industrial production, ability to infect both dividing cells and non-dividing cells, and safety and low pathogenicity. However, there are also shortcomings. One is the lack of specificity of infection, and the other is immunogenicity.

[0004] Studies have shown that when adenovirus vectors carry exogenous genes in the E1 or E3 deletion region, they can achieve long-term expression of target genes and reduce their immunogenicity; retrovirus vectors can carry exogenous genes and integrate them into the target cell genome to achieve stable and lasting expression of target genes, but retroviruses have low in vitro reproduction titers and low transfection efficiency, and can only infect dividing cells. Random integration into chromosomes poses a risk of carcinogenesis; other viral vectors and non-viral vectors that can be used for gene transfer have different advantages and disadvantages.

[0005] Therefore, it is necessary to propose a recombinant of a viral vector and a human tumor suppressor gene and its application, so as to at least partially solve the problems existing in the prior art.

[0006] The above information disclosed in this background technology is only used to increase the understanding of the background technology of the present invention and therefore, it may include information that does not constitute the prior art known to ordinary technicians in this field. Summary of the invention

[0007] The purpose of the present invention is to provide a recombinant of a viral vector and a human tumor suppressor gene and its application to solve the problems raised in the above background technology.

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] The invention relates to a recombinant of a virus vector and a human tumor suppressor gene and its application, and uses the recombinant constructed by using an adenovirus vector and a human tumor suppressor gene in the preparation of drugs for treating tumor-related diseases.

[0010] Preferably, the fusion sequence is:

[0011] Adenovirus genome sequence right side -ATGTTTACCGCCACACTCGCAGGGTCTGCA CCTGGTGCGGGTCTCATCGTACCTCAGCACCTTCCAGATC,TCTGACATG CGATGTCGACTCGACTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTCA AGGAGAGAAAAAGACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTTGGTACCGAGCTCGGATCCCG s23 CTAGAGCCACCCTCCAGGGAGCAGGTAGCTGCTGGGCTCCGGGGACA CTTTGCGTTCGGGCTGGGAGCGTCTTTCCACGACGGTGACACGCTTCCC TGGATTGGCAGCCAGACTGCTTTCCGGGTCACTGCC 6sgCATTCTCCACTTCTTGTTCCCCACTGACAGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGTTCTTGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCACTTCACCGTACTAACCAGGGAAGCTCTCCCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGATTTGCCCTACCTCGGAATGCTGGCATTTGCACCTACCTCACAGAGTGCATTGTGAGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGCGGGATCCACTAGTAACGCCGCCAGTGTGCTGGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCCGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGAGGGGGATCCCCACGCTAGAGCTa3GACTATAATAATAAAACGCCAACTTTGACCCGGAACGCGGAAAACACCTGAGAAAAACACCTGGGCGAGTCTCCACCTAAACGGTCAAAGTCCCCGCGGCCCTAGACAAATATTA 2848 - Adenovirus genome sequence on the left

[0012] Preferably, the amplification of the recombinant adenovirus is carried out at 25 cm 2 Adenovirus cells were cultured in a culture flask. When the abundance reached 70% to 80%, the culture medium was discarded, 3 mL of D-Hanks solution was added to wash away the residual serum in the culture flask, 1 mL of adenovirus diluent diluted with serum-free DMEM was added at 5 PFU / cell, and the cells were cultured in a 37°C incubator. The culture flask was gently shaken every 10 minutes to keep the virus evenly adsorbed. After 1 hour, the virus diluent was discarded, 3 mL of D-Hanks solution was added to wash away the unadsorbed virus particles in the culture flask, 5 mL of serum-free DMEM was added, and the cells were cultured in a 34°C incubator until the cells were completely diseased and harvested.

[0013] Preferably, the adenovirus is purified by freezing and thawing the harvested cell suspension three times, centrifuging at 4000 g for 10 min at 4°C, collecting the supernatant, and using BDAdeno-X TM The adenovirus was purified using an adenovirus purification kit (Cat. Nos. 631532), aliquoted and stored at -70°C.

[0014] Preferably, the radiation-induced recombinant adenovirus vector transfection: at 25 cm 2 Inoculate 1x10 6 HT-29 cells were treated with 0.5, 1.0, or 2.0 Gy (0.2 Gy / min) at room temperature 24 h later. 60 Irradiate the cells with Coγ-rays, discard the culture medium, add 3mL D-Hanks solution to wash away the residual serum in the culture bottle, add 1mL recombinant adenovirus coefficient solution at 40MOI and 80MOI within 1h after irradiation, culture at 37℃, shake gently once every 10min, discard the virus dilution solution after 1h, add 3mL D-Hanks solution to wash away the unabsorbed virus particles in the culture bottle, add 10mL DMEM containing 10% serum, and culture and passage in a 37℃ incubator.

[0015] Preferably, the determination of cell apoptosis: collect the cell suspension by trypsin digestion, centrifuge and discard the supernatant, wash twice with PBS, discard the supernatant, suspend the precipitate, add 70% ethanol, shake and mix, and fix at room temperature for 30 minutes, centrifuge and discard the supernatant, suspend the precipitate, wash twice with PBS, centrifuge and discard the supernatant, suspend the precipitate, add 100 μL (5 μg / mL propidium iodide (PI), 10 kU / mL, 0.005% Triton-100) of fluorescent dye, shake and mix, stain at room temperature in the dark for 30 minutes, centrifuge and discard the supernatant, suspend the precipitate, wash twice with PBS, add 1 mL PBS to make a cell suspension, and analyze by BDFCM.

[0016] Preferably, the detection of human tumor suppressor gene protein expression: collect cells by trypsin digestion, wash twice with cold PBS, suspend the precipitate, add 4% formaldehyde to fix at room temperature for 30 minutes, centrifuge and discard the supernatant, oscillate and suspend the precipitate, add 0.5mL PBS containing 0.1% Tween-20 and 0.5% BSA by mass fraction, mix well and incubate at room temperature for 30 minutes, wash twice with cold PBS, centrifuge and discard the supernatant, suspend the precipitate, add 100μL 1:100 diluted mouse anti-human tumor suppressor gene mAb-1, incubate at room temperature for 30 minutes, wash twice with cold PBS, centrifuge and discard the supernatant, suspend the precipitate, add 100μL 1:200 diluted FITC-labeled goat anti-mouse IgG, incubate at room temperature in the dark for 30 minutes and then analyze on the machine.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention utilizes the characteristic that human tumor suppressor gene can inhibit the growth of various tumor cells, clones it into adenovirus, and then effectively introduces human tumor suppressor gene into tumor tissue, expresses corresponding protein to inhibit the growth of tumor tissue, causes growth arrest or apoptosis of tumor cells, and thus achieves the purpose of inhibiting tumor; the recombinant utilizes adenovirus to carry human tumor suppressor gene to be directly expressed in tumor cells, thus solving the problem that the expression of human tumor suppressor gene protein is unstable and cannot be prepared into recombinant genetic engineering products in vitro by genetic engineering methods. This method realizes the transfer of exogenous human tumor suppressor gene and its efficient expression in the patient's tumor tissue to achieve the treatment purpose, making gene therapy of proliferative diseases a reality.

[0019] The above summary is for illustrative purposes only and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments and features described above, further aspects, embodiments and features of the present invention will be readily apparent by reference to the following detailed description. DETAILED DESCRIPTION

[0020] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0021] Example:

[0022] The invention relates to a recombinant of a virus vector and a human tumor suppressor gene and its application, and uses the recombinant constructed by using an adenovirus vector and a human tumor suppressor gene in the preparation of drugs for treating tumor-related diseases.

[0023] Recombinant tumor inhibition test:

[0024] The tumor inhibition effect was detected by clone formation method, and the cell survival curve was fitted with linear square model. Relative biological effect (RBE) = tumor inhibition rate of experimental group / tumor inhibition rate of control group. Cell growth and morphological changes were observed and recorded every day during cell culture.

[0025] The killing effect of recombinant glands on tumor cells:

[0026] The recombinant was transfected into cultured Hep-2 cells by conventional methods, and the number of cells in each group was the same. The experiment was divided into the following groups: 1. blank control; 2. MOI200; 3. MOI150; 4. MOI100; 5. MOI50; 6. MOI10; 7. GFPvirus MOI200; 8. GFPvirus MOI150. After transfection, the cells were cultured for 36 hours and observed under a light microscope. It can be seen that when MOI>50, the recombinant has a killing effect on Hep-2 cells, and the killing effect becomes more obvious with the increase of the dose.

[0027] The expression level of human tumor suppressor gene protein in HT-29 cells after radiation-induced AdCMV-human tumor suppressor gene recombinant transfection:

[0028] After 1 day of treatment, the ratio of cells overexpressing human tumor suppressor genes in the simple transfection group (71.9% in the 40MOI group and 78.3% in the 80MOI group) was slightly higher than that in the normal control group (67.8%). The ratio of cells overexpressing human tumor suppressor genes in the simple radiation group (68.0%, 69.4%, and 73.6% in the 0.5, 1.0, and 2.0Gy groups, respectively) was comparable to that in the control group. After 3 days of treatment, the number of cells overexpressing human tumor suppressor genes in each experimental group decreased significantly, and the number of cells overexpressing human tumor suppressor genes in the simple transfection group decreased by about 20%; the number of cells overexpressing human tumor suppressor genes in the 0.5, 1.0, and 2.0Gy simple irradiation groups decreased by 75%, 66%, and 60%, respectively; the ratio of cells overexpressing human tumor suppressor genes in the radiation-induced transfection group was higher than that in the simple radiation group at the same dose, but still significantly lower than that in the simple transfection group (about 50% reduction).

[0029] As can be seen from the above, the present invention utilizes the characteristic that human tumor suppressor genes can inhibit the growth of various tumor cells, clones them into adenovirus, and then effectively introduces human tumor suppressor genes into tumor tissues, expresses corresponding proteins to inhibit the growth of tumor tissues, causes growth arrest or apoptosis of tumor cells, and thus achieves the purpose of inhibiting tumors; the recombinant utilizes adenovirus to carry human tumor suppressor genes and directly expresses them in tumor cells, thereby solving the problem that the expression of human tumor suppressor gene proteins is unstable and cannot be prepared into recombinant genetic engineering products in vitro by genetic engineering methods. This method realizes the transfer of exogenous human tumor suppressor genes and their efficient expression in the patient's tumor tissue to achieve the purpose of treatment, making gene therapy for proliferative diseases a reality.

[0030] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "examples", "specific examples" or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine different embodiments or examples described in this specification and the features of different embodiments or examples, unless they are contradictory.

[0031] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Recombinant viral vector and human tumor suppressor gene and its application, It is characterized in that The application of adenovirus vectors and human tumor suppressor genes to construct recombinants in the preparation of drugs for treating tumor-related diseases.

2. The recombinant of the viral vector and human tumor suppressor gene according to claim 1 and its use, Features: The recombinant comprises the following nucleotide sequence: -ATGTTTACCGCCACACTCGCAGGGTCTGCACCTGGTGCGGGTCTCATCGTACCTCAGCACCTTCCAGATCTCTGACATGCGATGTCGACTCGACTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATCCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTTGGTACCGAGCTCGGATCCCGs 23 CTAGAGCCACCGTCCAGGGAGCAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTCTTTCCACGACGGTGACACGCTTCCCTGGATTGGCAGCCAGACTGCTTTCCGGGTCACTGCC 6 7 3GACTATAATAATAAAACGCCAACTTTGACCCGGAACCGGGAAACACCTGAGAAAAACACCTGGGCGAGTCTCCACGTAAACGGTCAAAGTCCCCGCGGCCCTAGACAAATATTA.

3. The recombinant of the viral vector and human tumor suppressor gene according to claim 1 and its use, Features: The gene of the human tumor suppressor cell adopts any eukaryotic cell promoter, prokaryotic cell promoter or virus promoter in the upstream, and adopts any eukaryotic gene polyadenylation nucleotide in the downstream.

4. The recombinant of the viral vector and human tumor suppressor gene according to claim 1 and its use, Features: The recombinant is obtained in any prokaryotic cell by homologous recombination.

5. The recombinant of the viral vector and human tumor suppressor gene according to claim 1 and its use, Features: The recombinant is used for preparing medicines for treating various malignant tumors.

6. The recombinant of the viral vector and human tumor suppressor gene according to claim 1 and its use, Features: The recombinant is used for preparing medicine for preventing the occurrence of tumors and the regeneration of tumors after surgical resection.