Method for capturing low-abundance virus RNA (Ribonucleic Acid) structure at high throughput and application thereof

Abstract

The invention provides a method for capturing a low-abundance virus RNA (Ribonucleic Acid) structure at high flux and application thereof, and belongs to the fields of molecular biology and virology. The method comprises the following steps: mixing RNA virus with a cross-linking agent, carrying out cross-linking under ultraviolet light, extracting the cross-linked RNA virus, and carrying out fragmentation treatment by using RNase III to obtain an RNA fragment; purifying RNA fragments, carrying out proximity ligation and decrosslinking, and establishing a library from the decrosslinked RNA fragments; the target RNA is hybridized and captured by adopting an RNA probe group, and the captured target RNA is subjected to high-throughput sequencing and structural analysis. According to the method, the target RNA is captured by using the RNA oligo probe after the database is established, so that the data depth of the target RNA is improved, and the method can be used for determining key structural elements in a low-abundance virus RNA genome, revealing long-distance interaction in the low-abundance virus RNA genome and identifying a stable genome domain in virus particles.

Description

Technical Field

[0001] The invention belongs to the fields of molecular biology and virology, and in particular relates to a method for high-throughput capture of low-abundance viral RNA structures and an application thereof. Background Art

[0002] Viruses are a class of pathogens that pose a serious threat to health and life safety. Except for prions, viruses are composed of nucleic acids and proteins. According to the type of nucleic acid of the virus, it is divided into RNA virus and DNA virus. The complete viral nucleic acid is also called the viral genome. The viral genome is the complete set of genetic codes of the virus, which guides the translation of all viral proteins and regulates the viral life cycle. Its RNA structure / interaction plays a key role in the replication, transcription, translation and infection of host cells of the virus. Therefore, studying the structure and interaction of the viral genome is very important for understanding the pathogenicity, infection and replication process of the virus.

[0003] Traditional methods may have limitations when studying viral RNA. It is difficult to effectively detect low-abundance viral RNA (such as HIV virus), difficult to obtain high-quality data, unable to fully capture complex RNA structures / interactions, and difficult to study long-range interactions and dimers of low-abundance viral RNA. Therefore, it is necessary to develop high-throughput methods to more deeply study low-abundance viral RNA to help understand the pathogenic mechanism of the virus and develop antiviral drugs and vaccines. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a method for high-throughput capture of low-abundance viral RNA structures, which can improve the capture rate and comprehensiveness of analysis of low-abundance viral RNA structures, and then be used to analyze stem structures, dimer sites and long-range RNA interactions.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a method for high-throughput capture of low-abundance viral RNA structures, comprising the following steps: mixing RNA viruses with a cross-linking agent, cross-linking under ultraviolet light, extracting the cross-linked RNA viruses, and fragmenting them with RNase III to obtain RNA fragments; purifying the RNA fragments, performing adjacent ligation and cross-linking removal, and establishing a library of cross-linked RNA fragments; hybridizing and capturing target RNA using an RNA probe set, and performing high-throughput sequencing and structural analysis on the captured target RNA.

[0007] Preferably, the structure comprises any one or more of 5'-UTR, RRE stem, dimerization site and long-range RNA interaction.

[0008] Preferably, the low-abundance virus comprises HIV.

[0009] Preferably, the sequence of the RNA probe set is SEQ ID NO:1 to SEQ ID NO:572.

[0010] Preferably, the cross-linking agent is a PBS solution containing 1-4 μmol / L Posoralen TEGAzide.

[0011] Preferably, the cross-linking agent further comprises digitalisin, and the mass concentration of the digitalisin is 0.01-1%.

[0012] Preferably, the wavelength of the ultraviolet light is 360-370 nm.

[0013] Preferably, the fragmentation treatment system is: 200 ng RNA, 1 μL 10×RNase III buffer, 1 μL RNaseIII, and 20 μL of RNase-free water.

[0014] Preferably, after the RNA virus is mixed with the cross-linking agent, the final concentration of the RNA virus is 10 5 ~10 9 Copy number / mL.

[0015] The present invention also provides the application of the method in the study of the pathogenic mechanism of low-abundance RNA viruses and the preparation of antiviral drugs and vaccines.

[0016] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0017] The present invention provides a method for high-throughput capture of low-abundance viral RNA structures. After establishing an RNA ligation library, the target RNA is captured with an RNA oligo probe, which improves the data depth of the target RNA and proves the reliability of the method from the perspectives of data volume, comparison of ligation groups and non-ligation groups, and sample correlation (repeatability). The method of the present invention can be used to determine key structural elements in low-abundance viral RNA genomes, such as 5'-UTR and RRE stems, reveal long-range interactions in low-abundance viral RNA genomes, and identify stable genomic domains in viral particles, which helps to deeply understand the organization, functional significance, and role of low-abundance viral RNA genomes in splicing, packaging, and assembly processes, and is expected to promote the development of new therapeutic strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 :HiCapR technical principle;

[0019] Figure 2 :HiCapR technology to identify RNA interactions and dimers;

[0020] Figure 3 : Comprehensive contact matrix between infected cells and virions of NL4-3 and GX2005002 strains;

[0021] Figure 4 : Pearson correlation analysis and clustering of contact readings of various samples;

[0022] Figure 5 :HiCapR sequencing data coverage in HIV genome;

[0023] Figure 6 :HiCaPR reveals long-range interactions of HIV genome;

[0024] Figure 7 : HiCapR identifies dimerization sites in the HIV genome. DETAILED DESCRIPTION

[0025] The invention provides a method for high-throughput capture of RNA interactions (HiCapR) of low-abundance viral RNA structures, comprising the following steps: mixing RNA virus with a cross-linking agent, cross-linking under ultraviolet light, extracting the cross-linked RNA virus, and fragmenting the RNA virus with RNase III to obtain RNA fragments; purifying the RNA fragments, performing adjacent ligation and cross-linking removal, and establishing a library of the cross-linked RNA fragments; hybridizing and capturing target RNA with an RNA probe set, and performing high-throughput sequencing and structural analysis on the captured target RNA.

[0026] The method provided by the present invention is applicable to all kinds of low-abundance RNA viruses. The structure includes but is not limited to 5'-UTR, RRE stem, dimer site and long-range RNA interaction.

[0027] In the present invention, as an optional embodiment, the preparation method of the RNA virus comprises: infecting cells with RNA virus, culturing, isolating RNA virus, and obtaining RNA virus particles. The infection time of the present invention is preferably 40 to 50 hours, more preferably 48 hours. The MOI of the RNA virus is preferably 0.1 to 0.2, more preferably 0.15. The concentration of the cells is preferably 1.0×10 7 ~9.0×10 9 / mL, more preferably 1.0×10 8 ~9.0×10 8 Pieces / mL.

[0028] The present invention mixes the prepared RNA virus with a cross-linking agent, and then uses a cross-linking instrument to cross-link. The cross-linking condition is ultraviolet light irradiation, the wavelength of the ultraviolet light is 360-370nm, preferably 365nm, the irradiation time is 10-25min, preferably 15-20min, and the cross-linking is preferably carried out in two steps, and the cross-linking is preferably carried out under ice bath conditions. The present invention is conducive to forming covalent bonds between the RNA molecules that interact with each other in the virus through ultraviolet cross-linking, which facilitates subsequent close-range connection reactions.

[0029] The crosslinking agent of the present invention is preferably a PBS solution containing 1 to 4 μmol / L Psoralen TEGAzide, and the concentration of the Psoralen TEGAzide is more preferably 2 to 3 μmol / L. The crosslinking agent of the present invention also includes digitonin, and the mass concentration of digitonin in the PBS solution is preferably 0.01 to 1%, and more preferably 0.01 to 0.5%. The digitonin of the present invention is used as a permeation agent to increase the crosslinking agent to penetrate the virus capsid protein to reach RNA, thereby improving the crosslinking efficiency. In the mixed system of RNA virus and crosslinking agent of the present invention, the final concentration of RNA virus is 10 5 ~10 9 The number of copies / mL is preferably 10 5 ~10 6 Copy number / mL.

[0030] The present invention has no particular limitation on the recovery / extraction method of the RNA virus, and any method known in the art can be used. As an optional embodiment, the present invention uses RNeasy mini kit (Qiagen) to extract RNA according to the instructions of the kit. After the RNA is extracted in the present invention, it is preferred to use a Dotblot kit to detect the UV crosslinking effect.

[0031] The present invention performs fragmentation treatment on the RNA obtained by crosslinking. The fragmentation treatment is preferably performed using RNase III, and the reaction system of the RNase III fragmentation treatment is preferably RNA 200ng, RNase III buffer (10×) 1μL, RNase III 1μL, and RNase-free water to make up to 20μL. The temperature of the fragmentation treatment is 36-38°C, preferably 37°C, and the time of the fragmentation treatment is 4-6min, preferably 5min.

[0032] The present invention immediately transfers the RNA mixture obtained by fragmentation treatment to RNA purification. The present invention has no special restrictions on the method of RNA purification, and methods well known in the art can be used. As an optional embodiment, the present invention uses MagicPure RNABeads (TransGen) to purify RNA according to the instructions of the kit.

[0033] The present invention performs proximity ligation of RNA fragments, and the proximity ligation system is preferably: 200ng RNA, 1 unit / μL RNA ligase 1, 1× RNA ligase buffer, 1mMATP, 1 unit / μL Superase-in, and the final volume is 200μL. The connection temperature of the present invention is 15-17°C, preferably 16°C; the connection time of the present invention is 15-17h, preferably 16h. The present invention preferably uses a miRNeasy kit (Qiagen) to wash to stop obtaining RNA fragments.

[0034] The present invention connects the RNA fragments and then de-crosslinks them to obtain de-crosslinked RNA fragments, wherein the de-crosslinking is performed using a crosslinking instrument, and the de-crosslinking condition is ultraviolet C radiation irradiation, wherein the wavelength of the ultraviolet C is 250 to 260 nm, preferably 254 nm, and the irradiation time is 3 to 8 min, preferably 5 min. The de-crosslinking is preferably performed on ice. The purpose of the de-crosslinking is to destroy the covalent bonds so as to avoid the covalent bonds formed by crosslinking from affecting the reverse transcription reaction during the subsequent library construction.

[0035] After obtaining the de-crosslinked RNA fragments, the de-crosslinked RNA fragments are used to establish a library. The present invention has no particular restrictions on the method for establishing the library, and a method for establishing a sequencing library known in the art is used. As an optional embodiment, the present invention uses SMARTer Stranded Total RNA-Seq Kit v2 (Clonetech) to construct a library of adjacently connected RNA.

[0036] After obtaining the sequencing library, the present invention designs an RNA probe group according to the target RNA, and uses the designed RNA probe group to hybridize and capture the target RNA, and performs high-throughput sequencing and structural analysis on the captured target RNA. The present invention captures the target RNA through the probe group, improves the data quality of low-abundance viral RNA, and enriches the interactions involved in the low-abundance viral RNA in the final library, improves the efficiency of the data, and realizes the subsequent analysis of long-distance RNA interactions and dimers that are difficult to study.

[0037] The design principle of the RNA probe group of the present invention is: to fully cover the target virus genome as much as possible and overlap in a tiled manner, and to consider the possible application to related mutant strains, to fully cover all possible mutations as much as possible, thereby improving the capture efficiency of mutant strains, and the designed probe group can be conventionally synthesized by a biological company. When the low-abundance virus is HIV, the sequence of the probe group is preferably SEQ ID NO: 1 to SEQ ID NO: 572. In the embodiment of the present invention, the typical strains of HIV HIV-1NL4-3 (HIV-1B subtype strain) and HIV-1GX2005002 (HIV-1CRF01_AE primary strain, accession number: GU564222) are used as examples for illustration. The HiCapR of the present invention provides a high coverage analysis of the HIV RNA genome, which can capture and analyze the stem structure, dimer site and long-distance RNA: RNA interaction in the HIV RNA genome, and discovers multiple unknown homodimers in the HIV genome.

[0038] The present invention performs high-throughput sequencing on the RNA captured by probe set hybridization to generate a large amount of sequencing data, and uses bioinformatics tools to analyze the sequencing data, including identification of RNA-RNA interactions, homodimers, and RNA structure prediction, etc. The present invention has no particular restrictions on the methods of high-throughput sequencing and analysis of sequencing data, and methods well known in the art can be used.

[0039] The present invention also provides the application of the above method in the study of the pathogenic mechanism of low-abundance viral RNA and the preparation of antiviral drugs and vaccines. The HiCapR method of the present invention improves the capture efficiency and comprehensiveness of the analysis of low-abundance viral RNA, can capture and analyze the stem structure, dimer site and long-distance RNA: RNA interaction in the low-abundance viral RNA genome, and has high resolution and high coverage analysis of the low-abundance viral RNA genome, including key regions such as 5'-UTR and RRE stem. And can further discover unknown homodimers, provide a new perspective for the viral RNA splicing and packaging process, can help understand the pathogenic mechanism of the virus, and develop antiviral drugs and vaccines.

[0040] The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. In the following embodiments, unless otherwise specified, all are conventional methods. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0041] Example 1

[0042] HiCapR is used to study the complex structure of HIV RNA:

[0043] 1. Cell culture and virus infection: MT4 cell line (RRID: CVCL_2632) was cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA), 100 U / mL penicillin and 100 μg / mL streptomycin. The cells were maintained at 37°C and 5% CO2 saturated humidity. The cells (cell concentration was 1.0×10 8 / mL) were exposed to HIV-1NL4-3 (HIV-1B subtype strain) and HIV-1GX2005002 (HIV-1CRF01_AE primary strain, accession number: GU564222), respectively, with a multiplicity of infection (MOI) of 0.15, and two replicates per group. Infection for 48h. The virus culture supernatant was mixed with an equal volume of saturated sodium sulfate solution at 4°C for 1h. The cells were washed three times with PBS, and the virus precipitates (NL4-3 virus infection group was marked as NV1, NV2; GX2005002 virus infection group was marked as GV1, GV2) and washed cells (NL4-3 virus infection group was marked as NC1, NC2; GX2005002 virus infection group was marked as GC1, GC2) were collected.

[0044] 2. Cross-linking: Dilute Psoralen TEG Azide (ThermoFisher Scientific) to 2 μM in PBS containing 0.01% digitonin (Sigma), and resuspend the virus particles or cells. Incubate at 37°C for 10 min and spread evenly into one well of a 6-well plate (the virus in the system is 10 5 Copy number / mL). Remove the cover of the 6-well plate and place it in a cross-linking instrument (CL-1000 cross-linking instrument, UVP), and cross-link twice at 365nm for 10 minutes (the cross-linking instrument must be placed in a safety cabinet). Place the well plate on ice each time for cross-linking. After cross-linking for 10 minutes, take out the well plate and replace it with new ice, and cross-link it again.

[0045] 3. RNA extraction: Use RNeasy mini kit (Qiagen) according to the instructions of the kit.

[0046] 4. RNA fragmentation: Prepare RNA fragmentation reaction system: 200 ng RNA, 1 μL RNase III buffer (10×), 1 μL RNase III, and 1 μL RNase-free water to make up to 20 μL. Incubate the reaction system at 37°C for 5 min, fragment it into 20 μL mixture, and immediately transfer it to RNA purification.

[0047] 5. RNA purification: Use MagicPure RNABeads (TransGen) according to the instructions of the kit.

[0048] Each RNA sample was then divided into two halves, one half was used for proximity ligation and decrosslinking (respectively labeled NV1+L, NV2+L, GV1+L, GV2+L, NC1+L, NC2+L, GC1+L, GC2+L); the other half was directly decrosslinked (respectively labeled NV1-L, NV2-L, GV1-L, GV2-L, NC1-L, NC2-L, GC1-L, GC2-L).

[0049] 6. Proximity ligation: Proximity ligation was performed under the following conditions: 200 ng RNA, 1 unit / μL RNA ligase 1 (New England Biolabs), 1× RNA ligase buffer, 1 mM ATP, 1 unit / μL Superase-in (Invitrogen), final volume 200 μL. Incubate at 16°C for 16 h and wash to stop using the miRNeasy kit (Qiagen).

[0050] 7. Decrosslinking: Use a CL-1000 crosslinker (UVP) to irradiate the RNA with 254 nm ultraviolet C radiation on ice for 5 min.

[0051] 8. Establish sequencing library: SMARTer Stranded Total RNA-SeqKit v2 (Clonetech) was used to construct cDNA library of adjacently connected RNA.

[0052] 9. Design T548XV1 probe set, hybrid capture and enrichment of target RNA: The designed T548XV1 probe set was synthesized by an RNA synthesis company. The cDNA library was enriched for HIV fragments using the TargetSeq One ​​Hyb&Wash kit (igenetech) and the T548XV1 probe set. The probe sequences are shown in Table 1.

[0053] Table 1 T548XV1 probe set sequence

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066] 10. Sequencing and structural analysis:

[0067] Send the sample for Novasek 6000 sequencing and provide sequencing library according to the requirements of the sequencing service provider.

[0068] Merge overlapping reads using pear (PEAR: a fast and accurate Illumina Paired-End read mergeR, doi:10.1093 / bioinformatics / btt593):

[0069] pear-ej 32-f sample_R2.fastq.gz-r sample_R1.fastq.gz-o sample.PEAR

[0070] Then use fastp (fastp: an ultra-fast all-in-one FASTQ preprocessor, doi:10.1093 / bioinform atics / bty560) to filter low-quality reads and cut the adapter:

[0071] fastp-i sample.PEAR.fastq-o sample.PEAR.fastp.fastq-h fastp.html-w 4-a AGATCGGAAG AGCGTCG (SEQ ID NO:573)

[0072] Chimeric reads were then detected using the hyb pipeline (Travis, AJ, Moody, J., Helwak, A., Tollervey, D., & Kudla, G. (2014). Hyb: a bioinformatics pipeline for the analysis of CLASH (crosslinking, ligation and sequ encing of hybrids) data. Methods, 65(3), 263-273. doi: 10.1016 / j.ymeth.2013.10.015) with default settings:

[0073] hybdetect=sample.PEAR.fastp db=$DB qc=none

[0074] Dimer Verification:

[0075] Synthesize primers for amplifying target RNA fragments:

[0076] T7-RRE-F: GCGTAATACGACTCACTATAGGGCAGCAGGAAGCACTATGGGCGC (SEQ ID NO: 574); RRE-R-GX002: GCGACAGCAAGGACTCTTGCCTGGAGC (SEQ ID NO: 575); RRE-R-NL43: GCGACAGCCAGGATTCTTGCCTGGAGC (SEQ ID NO: 576). T7-5UTR: GG GTAATACGACTCACTATAGGGTCTCTCTGGTTAGACCAG (SEQ ID NO: 577); NL43-1018: GATCTAAGTTCTTCTGATCCTGTCTG (SEQ ID NO: 578); GX002-1036: GATTTAACTTCTT CTGATCCTGCCTTG (SEQ ID NO: 579).

[0077] Using T7-RRE-F and RRE-R-GX002 as primers, the cDNA of GX2005002 lysate was amplified to obtain the GX2005002RRE in vitro transcription template. Using T7-RRE-F and RRE-R-NL43 as primers, the cDNA of NL43 lysate was amplified to obtain the NL43 RRE in vitro transcription template. Using T7-5UTR and NL43-1018 as primers, the cDNA of NL43 lysate was amplified to obtain the NL435'-UTR in vitro transcription template. Using T7-5UTR and GX002-1036 as primers, the cDNA of GX2005002 lysate was amplified to obtain the GX20050025'-UTR in vitro transcription template.

[0078] RNA was synthesized using the above in vitro transcription templates with the Novozyme in vitro transcription kit. RNA was in vitro transcribed using T7 RNA polymerase (Vazyme) with the purified NL4-3 and GX2005002 5'-UTR and extended RRE PCR products (200 ng) as templates, incubated at 37°C for 16 h, and then treated with DNase I at 37°C for 30 min, and then purified by gel purification using MagicPure RNABeads (TransGen).

[0079] Biomolecule binding kinetics assays were performed using the Octet R8 platform (sartorius) following standardized protocols. Quality control measures were implemented to ensure the reliability and reproducibility of the binding kinetics measurements.

[0080] HiCapR technology principle Figure 1 As shown; the method of identifying RNA interactions and dimers using HiCapR technology is as follows Figure 2 shown.

[0081] 11. Experimental Results

[0082] The evaluation results of sample data for each group are shown in Table 2.

[0083]

[0084]

[0085] From the above data, we can see that approximately 16 million raw reads were obtained for each sequencing library. The alignment rate reached over 90%, and over 95% of the reads contained HIV sequences, indicating that the capture efficiency of HIV RNA transcripts was high. A coverage depth of approximately 11,500 times was obtained on the genome. The uniform distribution of reads on the HIV genome after capture indicates that HiCapR has minimal bias in capturing the entire HIV RNA genome.

[0086] The overall duplication rate remained below 50%, and the duplication rate of the ligated group was lower than that of the non-ligated group, probably due to the increased library complexity caused by RNA proximity ligation. In the proximity ligation assay, the chimerism rate is a key indicator of ligation efficiency. Approximately 1% chimerism was observed in the non-ligated control group and approximately 9% chimeric reads were observed in the ligated group, which is consistent with the range widely reported in the literature. In long-range (>1kb) interactions, the proportions of 5'-3' and 3'-5' chimeras were almost equal, while proximal (<100-nt) interactions were enriched for 3'-5' chimeras, and proximal 5'-3' chimeras were similar to non-chimera sequencing reads.

[0087] The comprehensive contact matrix between infected cells and virions of NL4-3 and GX2005002 viruses in the HiCapR experimental group is shown in Figure 2. Figure 3 Shown. Heatmap showing the average number of chimeras per 1 million mapped reads, combining data from two biological replicates for each sample. Significant similarity was observed between viral particles in supernatants and infected cells of the same viral strain. A contact matrix was generated for the HIV-1 genome, revealing distinct local and long-range interactions.

[0088] Pearson correlation analysis and clustering of contact reads of various samples including ligation (+L) and non-ligation control samples (-L) were performed. Figure 4 As shown. The results showed that the correlation between biological replicates was high (r>0.99), indicating high reproducibility. HiCapR demonstrated high reproducibility, low bias, reliability, and efficiency in capturing HIV transcripts.

[0089] The coverage of HiCapR sequencing data in HIV genome is as follows Figure 5 The results show that the data covers the HIV genome evenly.

[0090] HiCaPR technology reveals long-range interactions of HIV genome Figure 6 Shown: (A) Heatmap of enriched interactions obtained from NL4-3 and GX2005002 infected cells and virions, the upper diagonal shows interactions from infected cells, while the lower diagonal area shows interactions from virions; (B) Viewpoint lines depict the binding positions of the 5'-UTR along the HIV-1 genome, the gray rectangles represent the viewpoint areas, and the different lines represent specific samples, where samples from virions are shown as dashed lines; (C) Contact matrix and base pairing details between 5'-UTR and 3'-UTR, the top panel shows a heatmap representing contact probability, the color bars represent the chimeric reads per 1M reads in each specific sample, and the bottom panel shows base pairings colored by base pairing score.

[0091] The results showed that both viruses exhibited a large number of long-range interactions in infected cells, while these interactions were significantly reduced in virions, with long-range interactions of more than 2500nt significantly reduced in virions compared to cells. Viepoint analysis was used to examine interactions involving 5'-UTR (Zhang, Y., et al. (2021). "In vivo structure and dynamics of the SARS-CoV-2 RNA genome." Nat Commun 12(1): 5695.). Results ( Figure 6 Middle B) reveals multiple peaks of 5'-UTR interactions in the HIV-1 genome. For most of these peaks, the signal in the virion is lower than in the cell. The interaction of the circularized ends (5'-UTR-3'-UTR) is still maintained in the virion ( Figure 6 Middle C). Multiple interaction peaks located near key elements were identified, indicating that the 5'-UTR plays a complex role in the HIV life cycle. Among these interactions, some are strain-specific, such as the interaction between the 5'-UTR and FSE is specific to the NL4-3 strain, while the interaction between the 5'-UTR and the 8.5K region (near the NES) is highly enriched in the GX2005002 strain.

[0092] HiCapR identifies dimerization sites in the HIV genome Figure 7 Shown: (A) The connected fragments (arms) of homodimeric RNA molecules produce chimeras, in which each arm is aligned with overlapping coordinates on the HIV-1 genome; (B) The distribution of homodimers throughout the HIV-1 genome, the blue line graph shows the homodimer coverage along the HIV-1 genome in the connected sample of NL4-3 infected cells, the arc graph shows discontinuous reads in the unconnected sample of NL4-3 infected cells, the dark red part indicates the peak of the homodimer, the lower figure depicts the base pairing of the homodimer in the SL1 region of the 5'-UTR and the RRE region downstream, and the color map represents the log2-transformed dimer score; (C) The self-association of dimers was assessed using biolayer interferometry (BLI), and the data are the analysis results of three independent experiments.

[0093] The results show that using HiCapR technology, chimeras formed only by dimerization were selected through a stringent data filtering process to reduce background interference caused by RNA interactions or self-ligation. The number of reads of dimer chimeras, 3'-5' chimeras, and 5'-3' chimeras in each sample was quantified, and a contact matrix consisting of non-overlapping chimeras and dimer chimeras was plotted ( Figure 7The strongest homodimerization signal was found in the 5'-UTR region, which plays an important role in HIV dimerization. Homodimers were observed to be widely distributed throughout the entire length of the HIV genome, with approximately 20 conserved dimerization peaks ( Figure 7 Extended RRE RNA fragments with two dimerization sites were synthesized by in vitro transcription, and the ability of these fragments to form dimerization conformations was verified using Bio-Layer Interferometry (BLI) technology ( Figure 7 Middle C).

[0094] In summary, HiCapR technology has significant effects on HIV genome structure, long-range interactions and dimer discovery.

[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for high-throughput capture of low-abundance viral RNA structures, characterized in that: The following steps are involved: RNA virus is mixed with a cross-linking agent, cross-linked under ultraviolet light, the cross-linked RNA virus is extracted, and fragmented with RNase III to obtain RNA fragments; the RNA fragments are purified, adjacently ligated, and cross-linking is reversed, and a library is established for the reversed cross-linked RNA fragments; RNA probe groups are used to hybridize and capture the target RNA, and the captured target RNA is subjected to high-throughput sequencing and structural analysis.

2. The method according to claim 1, characterized in that: The structure includes any one or more of 5'-UTR, RRE stem, dimerization site and long-range RNA interaction.

3. The method according to claim 1, characterized in that The low-abundance viruses include HIV.

4. The method according to claim 3, characterized in that The sequences of the RNA probe set are SEQ ID NO: 1 to SEQ ID NO:

572.

5. The method according to claim 1, characterized in that The cross-linking agent is a PBS solution containing 1-4 μmol / L Posoralen TEGAzide.

6. The method according to claim 1, characterized in that The cross-linking agent also includes digitalis glycoside, and the mass concentration of the digitalis glycoside is 0.01-1%.

7. The method according to claim 1, characterized in that The wavelength of the ultraviolet light is 360-370 nm.

8. The method according to claim 1, characterized in that The fragmentation treatment system is: 200 ng RNA, 1 μL 10×RNase III buffer, 1 μL RNase III, and 20 μL is made up with RNase-free water.

9. The method according to any one of claims 1 to 8, characterized in that: After the RNA virus is mixed with the cross-linking agent, the final concentration of the RNA virus is 10 5 ~10 9 Copy number / mL.

10. Use of the method according to any one of claims 1 to 9 in the study of the pathogenic mechanism of low-abundance RNA viruses and in the preparation of antiviral drugs and vaccines.

Images