Cryptococcus neoformans fluorescent PCR (polymerase chain reaction) detection method

Abstract

The invention relates to the technical field of medical examination molecular diagnosis, and particularly discloses a fluorescence PCR (Polymerase Chain Reaction) detection method for cryptococcus neoformans. A group of brand new specific primers (CN-F and CN-R) and a TaqMan probe (CN-P) are designed aiming at a cryptococcus neoformans ITS1 + 5.8 S + ITS2 + LSUrRNA gene region, and an internal standard system taking barley Dhn10 gene as a template is introduced to carry out whole-process monitoring. The detection method of the integrated UDG anti-pollution system is established by optimizing and determining the optimal concentration ratio of the primer probe and the reaction procedure. The method has the advantages of high sensitivity, high specificity, excellent precision and excellent clinical inclusiveness, can be used for 100% detection of new cryptococcus neoformans variants, Glubii variants and heterozygotes thereof, and provides a reliable tool for rapid and accurate clinical diagnosis of cryptococcus neoformans infection.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostic technology in medical testing, and specifically discloses a novel method for detecting Cryptococcus neoformans using fluorescent PCR. Background Technology

[0002] Cryptococcus is an important opportunistic pathogenic fungus, and Cryptococcus neoformans is one of the main pathogens causing serious infections (such as meningitis and pneumonia) in immunocompromised patients (such as AIDS patients and organ transplant recipients). Traditional methods for detecting Cryptococcus, such as ink staining microscopy and fungal culture, have drawbacks such as being cumbersome, time-consuming, and having insufficient sensitivity or specificity, making it difficult to meet the needs of rapid and accurate clinical diagnosis.

[0003] With the development of molecular biology techniques, detection methods based on real-time fluorescence PCR have become a research hotspot due to their advantages such as speed, sensitivity, and specificity. For example, Chinese patent document CN113862393A discloses a method for rapid detection of Cryptococcus gattii, which designs primers and probes targeting the CAP59 gene. However, this method is mainly targeted at this specific species and does not involve an internal standard system for quality control of the detection process (such as nucleic acid extraction). Another example is Chinese patent document CN103740832A, which discloses a novel Cryptococcus detection kit containing specific primer and probe sequences and a nucleic acid release agent. It employs an internal standard (artificially synthesized plasmid) and an UNG anti-contamination system to improve reliability. However, this technical solution does not provide sufficient validation data on the detection inclusiveness and precision (reproducibility) of the detection results for major clinical variants of Cryptococcus neoformans (such as *C. gattii* and *C. grubi*), and may lead to the risk of missed detection due to genetic variations in the strain.

[0004] Therefore, there is still room for improvement in existing technologies. There is an urgent need to develop a new Cryptococcus fluorescent PCR detection method that not only has high sensitivity and specificity, but also can widely cover common new Cryptococcus variants in clinical practice, has highly stable and reliable detection results, and has complete process monitoring and anti-contamination capabilities, so as to improve the accuracy and reliability of clinical diagnosis. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a novel method for detecting Cryptococcus neoformans by fluorescent PCR. This method has higher sensitivity, specificity, excellent inclusion of clinical strains, superior detection precision, and an integrated quality control and anti-contamination system.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a specific primer-probe composition for detecting novel Cryptococcus neoformans, characterized in that it comprises: The upstream primer CN-F has the nucleotide sequence shown in SEQ ID NO: 1: CCTGTTTGAGAGTCATGAAAAT; The downstream primer CN-R has the following nucleotide sequence as shown in SEQ ID NO: 2: ATTTAAGGCGAGCCGACG; The TaqMan probe CN-P has the following nucleotide sequence as shown in SEQ ID NO: 3: CAAACACCCAAATCCAAGTCCAACAG; the 5' end of the probe is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a quencher group BHQ1.

[0007] Preferably, it further includes an internal standard primer-probe composition for monitoring the nucleic acid extraction and amplification process, characterized in that it comprises: The internal standard forward primer Dhn10-F has the nucleotide sequence shown in SEQ ID NO: 4: TCGCATCACTAGCTACGAAC; The internal standard downstream primer Dhn10-R has the nucleotide sequence shown in SEQ ID NO: 5: CCTGGTATTCCATCTTGC; The internal standard TaqMan probe Dhn10-P has the nucleotide sequence shown in SEQ ID NO: 6: TTCGCATTTATAGAGCGCGCGCAC; the 5' end of the probe is labeled with the fluorescent reporter group VIC, and the 3' end is labeled with the quencher group BHQ1.

[0008] Secondly, the present invention provides a novel Cryptococcus fluorescent PCR detection kit, characterized in that it comprises the primer and probe composition described in the first aspect.

[0009] Preferably, the reaction system of the kit is 25 μL, comprising: 20 μL of CN reaction mixture, 1 μL of CN enzyme mixture, and 4 μL of nucleic acid from the sample to be tested; The CN reaction mixture contains dNTPs (including dUTP), buffer, MgCl2, BSA, 10 pmol upstream primer CN-F, 10 pmol downstream primer CN-R, 5 pmol probe CN-P, 8 pmol internal standard upstream primer Dhn10-F, 8 pmol internal standard downstream primer Dhn10-R, and 3 pmol internal standard probe Dhn10-P. The CN enzyme mixture contains hot-start Taq DNA polymerase and uridine enzyme (UDG), wherein the amount of hot-start Taq enzyme per person is 5 U and the amount of UDG enzyme is 0.5 U.

[0010] Thirdly, the present invention provides a novel method for detecting Cryptococcus neoformans using fluorescent PCR, characterized in that the reagent kit described in the second aspect is used to perform real-time fluorescent PCR amplification of the nucleic acid of the sample to be tested. The amplification program is as follows: incubation at 50°C for 2 minutes; pre-denaturation at 95°C for 5 minutes; then 40 cycles are performed, each cycle including denaturation at 94°C for 15 seconds, annealing and extension at 60°C for 35 seconds, and collecting fluorescence signals at the 60°C stage. The interpretation criteria are as follows: if the FAM detection channel of the tested sample has no amplification curve, but the VIC channel has an amplification curve and the Ct value is ≤35, then it is judged as negative for Cryptococcus neoformans; if the FAM detection channel of the tested sample has an amplification curve and the Ct value is ≤38, then it is judged as positive for Cryptococcus neoformans, and the result of the VIC channel does not need to be considered.

[0011] Fourthly, the present invention provides the use of the primer-probe composition described in the first aspect or the kit described in the second aspect in the preparation of products for diagnosing novel cryptococcal infections.

[0012] Fifthly, the present invention provides the use of the primer-probe composition described in the first aspect or the kit described in the second aspect in detecting novel Cryptococcus neoformans, Grubi variants or their hybrids.

[0013] The core innovation of this invention lies in the novel design and optimization of a set of primers (CN-F, CN-R) and TaqMan probes (CN-P) targeting the highly conserved and specific region of the Cryptococcus neoformans genome, specifically the ITS1+5.8S+ITS2+LSUrRNA. This design, through bioinformatics analysis, ensures highly specific binding to Cryptococcus neoformans while exhibiting no significant homology with the human genome or other common pathogens, thus laying the foundation for highly specific detection from the outset. The principle involves specifically amplifying this target region via PCR and then using the probe's hydrolysis to release a fluorescent signal for real-time detection.

[0014] This invention creatively introduces an internal control system (primers Dhn10-F / R, probe Dhn10-P) using the barley Dhn10 gene as a template. This internal control system is independent of the pathogen being detected, and its primer and probe sequences are specially designed to run in parallel with the target detection in the same reaction system, allowing for real-time monitoring of the efficiency and quality of the entire process from clinical sample nucleic acid extraction to PCR amplification. Its working principle is as follows: regardless of the presence of the target pathogen, the internal control should be effectively amplified and generate a fluorescent signal (VIC channel). The absence of the internal control signal indicates inhibition or failure in the detection process, thus effectively identifying and avoiding false negative results caused by operational errors or the presence of inhibitors in the sample, greatly improving the reliability of the detection results.

[0015] Through systematic experimental optimization, this invention establishes a highly refined reaction system, including a unique optimal concentration ratio between CN primers / probes and internal standard primers / probes (e.g., 10 pmol CN primers and 5 pmol probes, 8 pmol internal standard primers and 3 pmol probes), and a matching thermal cycling program. This optimization is not a simple combination of existing components, but rather the determination of the optimal synergistic effect point through repeated testing. Its direct technical effect is the achievement of exceptional detection precision, ensuring that the coefficient of variation (CV) of Ct values ​​in intra-batch and inter-batch repeated detections remains consistently below 5%, thus guaranteeing high consistency and reproducibility of detection results.

[0016] The detection system of this invention exhibits excellent clinical inclusiveness, capable of 100% detection of newly emerging variants of Cryptococcus neoformans, Grubi variants, and hybrids of both, and even showing complete detection capability for Cryptococcus grate, a member of the same genus. This characteristic stems from the precise targeting of the highly conserved ITS1+5.8S+ITS2+LSUrRNA gene region within Cryptococcus neoformans. Its primer and probe design effectively avoids the decrease in binding efficiency or failure that may be caused by local gene sequence variations (SNPs) between strains, thus fundamentally solving the risk of missed detection that may be caused by the genetic diversity of pathogens in clinical practice.

[0017] Beneficial technical effects of the present invention: 1. High sensitivity and wide linear range: The detection method established in this invention has high sensitivity, with a detection limit of 5.00E+02 copies / mL for artificially constructed pseudovirus particles. It can effectively detect low-load Cryptococcus neoformans infection in clinical samples, providing a possibility for early diagnosis.

[0018] 2. Excellent specificity and anti-interference ability: Experimental verification shows that this detection system has no cross-reactivity with 17 common pathogens, including Candida albicans, Candida tropicalis, Aspergillus, Mucor, Mycobacterium tuberculosis, and Streptococcus pneumoniae. Simultaneously, the integrated barley Dhn10 internal standard system and UDG anti-contamination system work together to effectively eliminate interference from inhibitors in the sample and contamination from previous amplification products, ensuring high specificity and accuracy of the detection results.

[0019] 3. Excellent precision and variant coverage: In repeatability experiments, the coefficient of variation (CV) of Ct values ​​for 10 repeated tests of high and low concentration samples (1.00E+05 and 1.00E+03 copies / mL) was less than 5%, indicating excellent method stability. More importantly, it achieved a 100% detection rate for neofibrillated Cryptococcus neoformans, Grubi variants, hybrids, and Cryptococcus grate, demonstrating unparalleled clinical strain inclusiveness and effectively avoiding the risk of missed detection.

[0020] 4. Accurate and reliable clinical validation: In a blinded test of 40 suspected clinical samples (20 sputum samples and 20 bronchoalveolar lavage fluid samples), 19 positive cases and 21 negative cases were detected. All results were subsequently validated by sequencing, and the accuracy rate reached 100%, which fully demonstrates the high reliability and diagnostic value of the detection system of this invention in actual clinical applications. Attached Figure Description

[0021] Figure 1 This is an amplification curve of different primer-probe concentrations A in Example 2 of the present invention.

[0022] Figure 2 This is an amplification curve of different primer-probe concentrations of B in Example 2 of the present invention.

[0023] Figure 3 This is an amplification curve for sensitivity detection in Example 3 of the present invention.

[0024] Figure 4 This is an amplification curve for specific detection in Example 4 of the present invention.

[0025] Figure 5 This is a distribution diagram of Ct values ​​for repeatability testing in Embodiment 5 of the present invention.

[0026] Figure 6-9 This is an amplification curve of the inclusion detection of a novel Cryptococcus standard in Example 6 of the present invention.

[0027] Figure 10 This is a schematic diagram of typical results of clinical sample validation in Embodiment 7 of the present invention.

[0028] Figure 11 The above is a flowchart illustrating the overall operation of the novel Cryptococcus fluorescent PCR detection method provided by this invention.

[0029] The A condition is when the concentrations of CN-F and CN-R primers are 10 pmol, the concentration of the CN-P probe is 5 pmol, the concentrations of Dhn10-F and Dhn10-R primers are 8 pmol, and the concentration of the Dhn10-P probe is 3 pmol.

[0030] The term B refers to the concentration of CN-F and CN-R primers being 10 pmol, the concentration of CN-P probe being 5 pmol, the concentration of Dhn10-F and Dhn10-R primers being 10 pmol, and the concentration of Dhn10-P probe being 5 pmol. Detailed Implementation

[0031] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention. Test methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the respective manufacturers.

[0032] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in this invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by those skilled in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of those skilled in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or identical to those described in the embodiments of this invention may be used to implement this invention.

[0033] Unless otherwise stated, the test methods, detection methods and preparation methods disclosed in this invention all adopt conventional techniques in this technical field.

[0034] Example 1: Primer and probe design and synthesis Based on the genome sequence of Cryptococcus neoformans, bioinformatics software analysis was used to select the highly conserved ITS1+5.8S+ITS2+LSUrRNA gene region within the Cryptococcus neoformans complex (including *Cryptococcus neoformans*, *Grubi*, and *Cryptococcus grusonii*). Following primer and probe design principles, specific primers and TaqMan probe sequences were designed for this region using software such as Primer Premier 5. Simultaneously, to monitor nucleic acid extraction and PCR processes, internal standard primers and probes were designed from a conserved region of the *Hordeum vulgare* Dhn10 gene. Hairpin structures, dimers, and mismatches were avoided during the design process. NCBI BLAST alignment ensured no significant homology with the human genome or other common pathogens. After multiple rounds of screening and optimization, the sequence was determined as follows: CN-F (SEQ ID NO:1): CCTGTTTGAGAGTCATGAAAAT; CN-R (SEQ ID NO:2):ATTTAAGGCGAGCCGACG; CN-P (SEQ ID NO:3): CAAACACCCAAATCCAAGTCCAACAG; Dhn10-F (SEQ ID NO:4): TCGCATCACTAGCTACGAAC; Dhn10-R (SEQ ID NO:5): CCTGGTATTCCATCTTGC; Dhn10-P (SEQ ID NO:6): TTCGCATTTATAGAGCGCGCGCAC; CN-P is labeled with FAM at its 5' end and BHQ1 at its 3' end; Dhn10-P is labeled with VIC at its 5' end and BHQ1 at its 3' end. All oligonucleotides were synthesized by a specialized company.

[0035] Example 2: Optimization of the reaction system and determination of the optimal concentration This embodiment aims to optimize the primer-probe concentration ratio. A 25 μL reaction system was used: 20 μL CN reaction mixture, 1 μL CN enzyme mixture, and 4 μL nucleic acid from the sample to be tested.

[0036] The CN reaction mixture contains: dNTPs (including dUTP), 10×PCR Buffer, MgCl2, BSA, and target primers / probes of different concentrations (CN-F / R / P) and internal standard primers / probes (Dhn10-F / R / P).

[0037] CN enzyme mixture contains: hot-start Taq DNA polymerase and UDG enzyme.

[0038] Fixed reaction procedure: 50℃ for 2 min; 95℃ for 5 min; 40 cycles (94℃ for 15 s, 60℃ for 35 s, fluorescence collected at 60℃).

[0039] Multiple concentration ratios were tested. The results are as follows: Figure 1 and Figure 2 As shown, when the concentration of CN-F / R primer is 0.40 μM (10 pmol / 25 μL), the concentration of CN-P probe is 0.20 μM (5 pmol / 25 μL), the concentration of internal standard primer Dhn10-F / R is 0.32 μM (8 pmol / 25 μL), and the concentration of internal standard probe Dhn10-P is 0.12 μM (3 pmol / 25 μL), the amplification curve has the clearest inflection point, the fluorescence signal is the strongest, and there is no primer dimer interference, which is determined to be the optimal concentration ratio. Figure 2 The comparison results at non-optimal concentrations are shown.

[0040] Example 3: Sensitivity and Detection Limit Determination The novel Cryptococcal pseudovirus standard (quantified by digital PCR) was serially diluted 10-fold (5.00E+06 to 5.00E+02 copies / mL). 4 μL of each concentration was used for detection in the optimal system determined in Example 2, with each concentration tested 20 times. The lowest concentration that produced a ≥95% positive detection rate was determined as the limit of detection (LoD). Results showed that at a concentration of 5.00 × 10^2 copies / mL, the positive detection rate was 100%, and a typical amplification curve was observed. Figure 3 As shown in the figure. Therefore, the LoD of this method is 5.00 × 10^2 copies / mL, exhibiting high sensitivity.

[0041] Example 4: Specificity Analysis Nucleic acids from 17 common pathogens were selected as interference samples, including Candida albicans, Candida tropicalis, Aspergillus fumigatus, Aspergillus flavus, Mycobacterium tuberculosis, and Streptococcus pneumoniae, with concentrations not lower than 1.00E+06 copies / mL or clinically relevant high levels. The optimal system of this invention was used for detection. Results are as follows: Figure 4 As shown, the FAM channel of all interfering samples showed no specific amplification curves (no Ct values), while the VIC internal standard channel amplified normally. This indicates that the primer-probe combination of the present invention has no cross-reactivity with non-target pathogens and exhibits high specificity.

[0042] Example 5: Precision (Repeatability) Assessment Two pseudovirus standards, at concentrations of 1.00E+05 copies / ml and 1.00E+03 copies / ml, were selected and tested 10 times within the same batch using the optimal system. The mean, standard deviation, and coefficient of variation (CV) of the Ct values ​​were calculated. The results are as follows: Figure 5 As shown, the average Ct value for high-concentration samples was 27.53, with a standard deviation of 0.07 and a CV of 0.26%; the average Ct value for low-concentration samples was 34.23, with a standard deviation of 0.18 and a CV of 0.51%. The CV values ​​were all significantly less than 5%, indicating that this method has excellent repeatability and precision. Example 6: Validation of Clinical Strains' Inclusivity To validate the method's ability to detect different genotypes of bacteria, clinical isolates or standard strains identified by molecular identification were collected, including: 5 strains of *Cryptococcus neoformans* var. *neophylline*, 5 strains of *Grubi* var. *neophylline*, 3 strains of *Cryptococcus neoformans* / Grubi var. *neophylline* heterozygote, and 2 strains of *Cryptococcus grate*. Nucleic acid samples of each strain were prepared at concentrations close to the LoD (approximately 5.00E+0.2 copies / mL), and each sample was tested 20 times using the optimal system. The results showed that the detection rate for all strains was 100%. Figure 6 , Figure 7 , Figure 8 , Figure 9 Typical amplification curves for neonatal variant, Grubi variant, heterozygote, and Cryptococcus grate are shown, demonstrating the excellent clinical inclusivity of this invention.

[0043] Example 7: Clinical Sample Testing Validation Forty clinically suspected cases of cryptococcal infection were treated with sputum and residual bronchoalveolar lavage fluid. Total nucleic acid was extracted from all samples and blinded testing was performed using the optimal system and standard procedure of this invention (same as in Example 2). Result interpretation criteria: FAM channel Ct ≤ 38 was considered positive; no FAM amplification and VIC channel Ct ≤ 35 was considered negative. Simultaneously, Sanger sequencing was performed on the target regions of all samples as the gold standard.

[0044] Nucleic acid extraction from test samples: (1) Nucleic acid extraction from clinical test samples Forty clinical samples were collected from suspected cases of Cryptococcus neoformans (20 sputum samples and 20 bronchoalveolar lavage fluid samples). Nucleic acid samples were extracted from the samples to be tested (positive and negative controls were extracted simultaneously). 4 μL of nucleic acid sample was used to prepare a PCR reaction system, and the amplification reaction was carried out in a real-time fluorescence PCR instrument. The fluorescence channels were selected sequentially as FAM and VIC. The PCR amplification program is as follows. 50℃, 2 min, 95℃, 5 min; 1 cycle 94℃, 15 sec, 60℃, 35 sec (collect fluorescence); 40 cycles.

[0045] After PCR, the negative or positive result of the corresponding pathogen nucleic acid is determined by the different fluorescence channel curves and Ct values. (If the FAM detection channel of the tested sample has no amplification curve, but the VIC channel has an amplification curve and a Ct value ≤ 35, the sample can be judged as CN negative; if the FAM detection channel of the tested sample has an amplification curve and a Ct value ≤ 38, and the VIC detection channel has or does not have an amplification curve, the sample can be judged as CN positive.) Of the 40 suspected clinical samples tested, 19 were positive and 21 were negative. Typical test results are as follows: Figure 10 As shown.

[0046] Sequencing validation results show that the detection system of this invention achieved a detection accuracy of 100%, further demonstrating the clinical detection accuracy of the system. Test results: The method of this invention detected 19 positive cases and 21 negative cases. All results were completely consistent with the sequencing results, with an overall concordance rate of 100%. Figure 10 Typical detection curves for positive and negative clinical samples are shown. This embodiment fully demonstrates the accuracy and reliability of the method of the present invention in the detection of real clinical samples.

[0047] Example 8: Overview of the Detection Process Figure 11 The complete operation flowchart of the novel Cryptococcus fluorescent PCR detection method provided by this invention is shown. The process mainly includes four steps: (1) nucleic acid extraction from clinical samples (such as sputum and bronchoalveolar lavage fluid); (2) preparation of the PCR reaction system, mixing the extracted nucleic acid with the reaction mixture and enzyme mixture in the kit of this invention in proportion; (3) real-time fluorescent PCR amplification, running the predetermined program on an instrument equipped with FAM and VIC channels; (4) result analysis and interpretation, outputting negative or positive results according to the amplification curve and Ct value of the dual channels and the predetermined standards. This process is clear, standardized, and easy to implement in clinical laboratories.

[0048] Finally, it should be noted that the above embodiments are used to illustrate the technical solutions of the present invention and not to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A novel fluorescent PCR detection method for Cryptococcus, characterized in that, Includes the following specific primer-probe compositions: The upstream primer CN-F has the nucleotide sequence shown in SEQ ID NO: 1; The downstream primer CN-R has the nucleotide sequence shown in SEQ ID NO: 2; The TaqMan probe CN-P has the nucleotide sequence shown in SEQ ID NO:

3. The probe is labeled with a fluorescent reporter group at its 5' end and a quencher group at its 3' end.

2. The novel Cryptococcus fluorescent PCR detection method according to claim 1, characterized in that, It also includes an internal standard primer-probe composition for process monitoring, the internal standard primer-probe composition comprising: The internal standard forward primer Dhn10-F has the nucleotide sequence shown in SEQ ID NO: 4; The internal standard downstream primer Dhn10-R has the nucleotide sequence shown in SEQ ID NO: 5; The internal standard TaqMan probe Dhn10-P has the nucleotide sequence shown in SEQ ID NO:

6. The 5' end of the probe is labeled with a fluorescent reporter group that is different from the probe in claim 1, and the 3' end is labeled with a quenching group.

3. The novel Cryptococcus fluorescent PCR detection method according to claim 2, characterized in that: In a 25 μL reaction system, the concentrations of the CN-F and CN-R primers are each independently 8-15 pmol, and the concentration of the CN-P probe is 3-8 pmol; the concentrations of the Dhn10-F and Dhn10-R primers are each independently 6-12 pmol, and the concentration of the Dhn10-P probe is 2-5 pmol.

4. A novel Cryptococcus fluorescent PCR detection kit, characterized in that: A primer-probe composition comprising any one of claims 1-3.

5. The reagent kit according to claim 4, characterized in that: The kit also includes reaction buffer, magnesium ions, dNTPs, hot-start Taq DNA polymerase, uridine enzyme, and bovine serum albumin.

6. The reagent kit according to claim 5, characterized in that: The 25 μL reaction system of the kit contains: 20 μL of CN reaction mixture, 1 μL of CN enzyme mixture, and 4 μL of nucleic acid from the sample to be tested; The CN reaction mixture comprises 8-15 pmol of CN-F and CN-R primers, 3-8 pmol of CN-P probe, 6-12 pmol of Dhn10-F and Dhn10-R primers, 2-5 pmol of Dhn10-P probe, 0.1-0.3 μg / μL of BSA, and 1.0-3.0 mM of Mg. 2+ ; The CN enzyme mixture contains 5 U of hot-start Taq DNA polymerase and 0.5 U of UDG enzyme.

7. A fluorescent PCR detection method for detecting Cryptococcus neoformans using the kit described in any one of claims 4-6, characterized in that, Includes the following steps: (1) Extract nucleic acid from the clinical sample to be tested; (2) Mix the nucleic acid with the components in the kit to prepare a PCR reaction system; (3) Perform real-time fluorescence PCR amplification. The amplification program includes: incubation at 50℃ for 2-5 minutes; pre-denaturation at 95℃ for 3-10 minutes; and then 35-45 cycles, each cycle including denaturation at 94℃ for 10-30 seconds, annealing and extension at 60℃ for 30-60 seconds, and collecting fluorescence signals during the annealing and extension phases.

8. The fluorescent PCR detection method according to claim 7, characterized in that: The real-time fluorescence PCR amplification program is as follows: 50℃ for 2 minutes; 95℃ for 5 minutes; then perform 40 cycles: 94℃ for 15 seconds, 60℃ for 35 seconds, and collect fluorescence.

9. The fluorescent PCR method according to claim 7 or 8, characterized in that, The interpretation criteria are as follows: if the fluorescence detection channel for CN-P shows no specific amplification curve, but the fluorescence detection channel for Dhn10-P shows an amplification curve with a Ct value ≤ 35, then the result is judged as negative for Cryptococcus neoformans; if the fluorescence detection channel for CN-P shows a specific amplification curve with a Ct value ≤ 38, then the result is judged as positive for Cryptococcus neoformans.

10. The use of the fluorescent PCR detection method for Cryptococcus neoformans according to any one of claims 1-3 or the kit according to any one of claims 4-6 in the preparation of products for diagnosing Cryptococcus neoformans infection, or in the detection of Cryptococcus neoformans, Cryptococcus globius, or hybrids thereof.

Images