Method for detecting diversity of aquatic organisms in Sanjiangyuan area

Abstract

The invention belongs to the technical field of animal molecular biology, and particularly relates to a method for detecting diversity of aquatic organisms in a three-river-source region. The biodiversity detection method specifically comprises the following steps: step 1, enriching and extracting eDNA in a water sample; 2, carrying out PCR (Polymerase Chain Reaction) amplification on the eDNA obtained in the step 1; a target gene subjected to PCR amplification is a cytochrome b gene; 3, sequencing the amplification product obtained in the step 2; and 4, analyzing the diversity of the aquatic organisms according to a sequencing result in the step 3. According to the method, the diversity of aquatic organisms in the three-river-source region can be accurately analyzed, and the method can be used for protecting and monitoring rare wild animals, detecting alien invasive species and the like, so that the water ecological environment of the three-river-source region is protected. Therefore, the method has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of animal molecular biology, and in particular relates to a method for detecting aquatic biodiversity in the Three Rivers Source region. Background Art

[0002] Environmental DNA (eDNA) technology can be used as a new type of biological monitoring method. eDNA refers to the total DNA of all organisms that have not been separated in advance and obtained from environmental samples such as water, sediment, soil and air. For large organisms such as fish, the DNA captured from the environment mainly comes from the interaction between the organism and the environment, and the genetic material is released into the environment through the shedding of skin cells, hair or scales and the excretion of metabolic waste. Compared with traditional fish monitoring methods, eDNA technology has a series of characteristics such as high detection sensitivity, high cost-effectiveness, saving a lot of manpower, material resources and time consumption, small sampling range and little interference with the ecosystem. Therefore, eDNA technology has shown great potential in the research field of fish ecology. However, there are still some problems in the application of eDNA technology.

[0003] The collection volume of eDNA water samples is generally concentrated in 15ml-10L, with 1L and 2L being the most common. In specific studies, the collection volume of water samples usually varies according to the needs of the experiment. Compared with tissue DNA, DNA in the water environment is trace, so after the water sample is collected, the DNA in the water body must be enriched first to increase the detection rate of the species. Different enrichment methods may significantly affect the results of subsequent sequencing experiments. Therefore, for a specific water sample, how to enrich eDNA is an important topic.

[0004] In addition, when using macrobarcoding for species diversity monitoring, high-throughput sequencing (NGS) is often required, mainly because high-throughput sequencing is fast, has a large amount of data and high accuracy. At present, the high-throughput sequencing used in the field of eDNA research is mainly amplicon sequencing. After sequencing, the data is analyzed. The first-generation sequencing data can be compared on NCBI to determine the presence or absence of the target species. The processing of the original data off the machine of high-throughput sequencing is more complicated. Its main processes include quality control, filtering, molecular operational taxonomic unit (MOTU) clustering, and BLAST comparison and species annotation of representative MOTU sequences.

[0005] The design of PCR primers and the selection of DNA barcode segments are also critical in the application of eDNA technology, which plays a decisive role in the accuracy of subsequent experimental results. Depending on the purpose of the experiment, it can usually be divided into specific monitoring of target species and diversity monitoring of a specific biological group. Specific monitoring mainly designs highly specific primers for a specific species so that only the gene sequence of the species can be amplified during the PCR process without amplifying the gene sequences of other related species. Diversity monitoring is to design universal primers for a specific biological group, which requires that the gene sequences of the biological group can be covered as much as possible. The ecology of different regions has different species distribution and composition. Therefore, how to choose appropriate target genes and primers for samples from different regions is also a problem that needs to be solved in eDNA technology.

[0006] In summary, for the application of eDNA technology in detecting species diversity in different regions, there are still problems such as DNA enrichment method design, target gene and primer screening. Summary of the invention

[0007] In view of the problems of the prior art, the present invention provides a method for detecting aquatic biodiversity in the Three Rivers Source region.

[0008] A kit for detecting aquatic biodiversity in the Three Rivers Source region is a PCR kit comprising amplification primers, the nucleotide sequences of the amplification primers are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0009] Preferably, it further comprises a filter membrane, wherein the filter membrane is selected from a mixed cellulose filter membrane or a nylon membrane.

[0010] The present invention also provides a method for detecting aquatic biodiversity in the Three Rivers Source region, comprising:

[0011] Step 1, enriching and extracting eDNA in water samples;

[0012] Step 2, performing PCR amplification on the eDNA obtained in step 1; the target gene of the PCR amplification is the cytochrome b gene;

[0013] Step 3, sequencing the amplified product obtained in step 2;

[0014] Step 4, analyzing the aquatic biodiversity of the sequencing results of step 3.

[0015] Preferably, in step 1, the enrichment method is to use membrane filtration, and the extraction is to extract the DNA in the membrane after the filtration is completed.

[0016] Preferably, the filter membrane is selected from a mixed cellulose filter membrane or a nylon membrane.

[0017] Preferably, in step 2, the nucleotide sequences of the amplification primers are as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0018] Preferably, in step 3, the sequencing is third-generation sequencing.

[0019] Preferably, in step 4, the analysis includes: obtaining fish OTUs from cluster analysis results, performing BLAST comparison in a genome database, selecting the species name with the highest similarity, and determining that the species is detected.

[0020] Preferably, the genome database includes the NCBI database and / or a self-constructed local database.

[0021] Preferably, the local database includes mitochondrial genome sequence data of Yellow River yarrow, Longshe plateau loach, Chaka plateau loach and Slender plateau loach.

[0022] The present invention provides a kit and a detection method for the purpose of detecting aquatic biodiversity in the source of three rivers. Specifically, by conducting a water sample enrichment experiment on filter membranes of different materials, and recording the time for a single filter membrane to filter 1L of water, the most efficient type of filter membrane for enriching DNA suitable for aquatic biodiversity detection in the source of three rivers is determined, and eDNA in the water body can be collected more effectively and quickly. By screening different target genes, since its mitochondrial gene sequence is longer than the sequence of other target genes, during sequencing cluster analysis, the species richness of aquatic organisms can be detected more accurately and diversely in a larger sequence interval, so that the diversity of aquatic organisms in the source of three rivers can be analyzed more quickly and conveniently, greatly shortening the investigation time of aquatic resources in the region, and saving a lot of manpower and material resources. In addition, the fragment length of the primer designed by the present invention is greater than that of the universal primer, so the sequencing results of the eDNA sample can be spliced ​​in a wider range, and the comparison results of the species comparison with OTUS are more accurate than those of the universal primer. The present invention can provide technical support for the protection and monitoring of various rare wild animals, can detect alien invasive species in various water systems in the Three Rivers Source region in real time, and protect the water ecological environment in the Three Rivers Source region. Therefore, the present invention has a good application prospect.

[0023] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0024] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a schematic diagram of the optimization process of the aquatic biodiversity detection method in the Sanjiangyuan area in Experimental Example 1.

[0026] Figure 2 This is the electrophoresis diagram of DNA quality inspection of 1L water sample enriched by filter membranes of different materials in Experimental Example 1 (in the figure: 1-4 are sample numbers, schematic diagram of Marker bands, from left to right are negative control and positive respectively).

[0027] Figure 3 Comparison of eDNA enrichment concentrations using filters of different materials in Experimental Example 1.

[0028] Figure 4 Comparison of the purity of eDNA enriched by filter membranes of different materials in Experimental Example 1.

[0029] Figure 5 This is the primer length diagram for the Cytb gene as the target gene in Experimental Example 1.

[0030] Figure 6 Species classification heat map for the species taxonomy annotation of the three samples CR_1, CR_2, and CR_3 in Experimental Example 1.

[0031] Figure 7 This is a pie chart showing the classification of fish eDNA species detected in the Yellow River waters of Jiangcuo Village, Huanghe Township, Maduo County, Sanjiangyuan region. DETAILED DESCRIPTION

[0032] In the following examples and experimental examples, reagents and raw materials not specifically described are all commercially available products.

[0033] Example 1 Kit and method for detecting aquatic biodiversity in the Three Rivers Source region

[0034] 1. Test kit

[0035] The composition of the material of this embodiment is:

[0036] Table 1 Reagent material composition

[0037]

[0038] The primers used to amplify cytochrome b (Cytb) have the following sequences:

[0039] Forward primer L14724 (SEQ ID NO. 1): 5′GACTTGAAAAACCACCGTTG-3′;

[0040] Reverse primer H15915 (SEQ ID NO.2):

[0041] 5'-CTCCGATCTCCGGATTACAAGAC-3'.

[0042] 2. Methods for detecting aquatic biodiversity in the Three Rivers Source region

[0043] The above kit is used to detect aquatic biodiversity in the Sanjiangyuan area. The specific steps are as follows:

[0044] Step 1: Enrich and extract eDNA from water samples:

[0045] 1L of water sample from the Sanjiangyuan area was taken and filtered with a mixed cellulose membrane with a pore size of 0.45 μm. After the filtration, the DNA in the filter membrane was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd.).

[0046] Step 2: PCR amplification of the eDNA enriched and extracted from 1L water sample:

[0047] 1. Total DNA extraction For genomic samples from various sources, the most appropriate genomic total DNA extraction method was selected based on past project experience, and the quality of DNA extraction was tested by 0.8% agarose gel electrophoresis, and the DNA was quantified using an ultraviolet spectrophotometer.

[0048] 2. Sequencing library preparation Taking Illumina NovaSeq sequencing as an example, the standard library construction process of Illumina's TruSeq DNA PCR-free prep kit reagents was used to prepare the sequencing library.

[0049] 1) First, the extracted DNA was randomly sheared by ultrasound and the sequence ends were repaired. The protruding bases at the 5' end of the DNA sequence were removed by EndRepair Mix2 in the kit, and a phosphate group was added to fill the missing bases at the 3' end.

[0050] 2) Adding an A base to the 3' end of the DNA sequence to prevent the DNA fragment from self-ligating and to ensure that the target sequence can be connected to the sequencing adapter (there is a protruding T base at the 3' end of the sequencing adapter);

[0051] 3) Add a sequencing adapter containing a library-specific tag (i.e., Index sequence) to the 5' end of the sequence so that the DNA molecule can be fixed on the Flow Cell;

[0052] 4) BECKMAN AMPure XP Beads were used to remove the adapter self-ligated fragments through magnetic bead screening and purify the library system after adding the adapter;

[0053] 5) PCR amplification of the DNA fragments connected to the adapters is performed to enrich the sequencing library templates, and the library enrichment products are purified again using BECKMAN AMPure XP Beads;

[0054] 6) Perform final fragment selection and purification of the library by 2% agarose gel electrophoresis. The library insert fragment is ~450 bp

[0055] PCR uses NEB Q5 DNA high-fidelity polymerase, the system is shown in the table below:

[0056]

[0057] The procedure is:

[0058]

[0059] After the components required for the PCR reaction are configured, pre-denature at 98°C for 5 minutes on the PCR instrument to fully denature the template DNA, and then enter the amplification cycle. In each cycle, first keep it at 98°C for 30 seconds to denature the template, then lower the temperature to 60°C and keep it for 30 seconds to fully anneal the primers to the template; keep it at 72°C for 45 seconds to extend the primers on the template and synthesize DNA to complete a cycle. Repeat this cycle 35 times to enrich the amplified DNA fragments. Finally, keep it at 72°C for 5 minutes to fully extend the product and store it at 12°C. The amplification results are subjected to 2% agarose gel electrophoresis, and the target fragment is cut out and the target fragment is recovered by the sorting magnetic bead recovery method.

[0060] Step 3, performing third-generation sequencing on the amplified product;

[0061] (1) Library quality control and quantification

[0062] Take 1 μL of the library and perform a 2100 quality check on the library using the Agilent High Sensitivity DNA Kit on the Agilent Bioanalyzer machine. A qualified library should have a single peak without a connector. Use the Quant-iT PicoGreends DNA Assay Kit on the Promega QuantiFluor to quantify the library. The calculated concentration of a qualified library should be above 2 nM.

[0063] (2) Sequencing

[0064] For qualified libraries, we used the NovaSeq 6000SP ReagentKit (500 cycles) on the Illumina NovaSeq machine to perform 2×250bp double-end sequencing. First, the library to be loaded on the machine (Index cannot be repeated) was diluted to 2nM, and then mixed according to the required data volume ratio. The mixed library was denatured into a single strand with 0.1N NaOH for sequencing. The amount of library loaded can be controlled between 15-18pM according to the actual situation.

[0065] Step 4, the sequencing results were used to obtain OTUs based on 98% cluster analysis, and the fish OTUs were obtained from the cluster analysis results. BLAST comparison was performed in the local database, and the species name with the highest similarity was selected to determine whether the species was detected in the sample.

[0066] The technical solution of the present invention is further illustrated by experiments below.

[0067] Experimental Example 1 Optimization and verification of conditions for detecting aquatic biodiversity in the Sanjiangyuan area

[0068] This experimental example optimizes the various steps in the method for detecting aquatic biodiversity in the Sanjiangyuan area. The specific process is as follows: Figure 1 shown.

[0069] 1. Establishment of water eDNA enrichment method:

[0070] (1) Selection of filter membranes of different materials: we selected polycarbonate membrane; pore size 0.2μm (Product: 10417612 Whatman Made in Germany), glass fiber membrane; pore size 0.45μm (CATNo.1825-047 Whatman Made in UK), nylon membrane; pore size 0.45μm (Product: 7404-004 Whatman Made in USA), mixed cellulose membrane; pore size 0.45μm (Shanghai Xinya), nitrocellulose membrane; pore size 0.45μm (Product: 10417612 Whatman Made in Germany), and screened out the best filter membrane for DNA enrichment from these five filter membranes. One filter of each filter membrane was selected, and 5L of water sample was extracted from the laboratory fish tank. Each filter membrane filtered 1L of water, and three replicates and a set of blank controls were performed. After the filtration, the DNA in the filter membrane was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd.), and then the DNA enrichment and concentration of each filter membrane were measured.

[0071] Electrophoresis was performed on three experimental groups and one blank control group. The results are as follows: Figure 2As shown in Figure 2, the DNA content extracted by the mixed cellulose membrane (MCE) was the highest among the three groups. The concentration and purity of eDNA extracted by the five different filter membranes were measured by Nanodrop. The results are shown in Figure 2. Figure 3 , 4 As shown in the figure, the average DNA concentration and purity of the mixed cellulose membrane (MCE) are also the highest. In summary, the mixed cellulose membrane has the best DNA enrichment effect, followed by the nylon membrane.

[0072] (2) Comparison of filtration time of membranes with different materials

[0073] By enriching 1L of water sample with five different filter membranes, the difference in filtration enrichment time per unit area of ​​a filter membrane was calculated (the water samples taken were the same; 3 experimental groups and 1 control group), and the results are as follows:

[0074] Filtration time / minute

[0075]

[0076] The comparison of single enrichment time of 5 kinds of filter membranes is as follows:

[0077] Polycarbonate membrane (188.75±116.001) min > mixed cellulose membrane (128.50±83.401) min > cellulose acetate membrane (59.25±36.927) min > nylon membrane (33.50±20.567) min > glass fiber membrane (4.5±1.291) min.

[0078] Considering the comprehensive enrichment effect and enrichment time, mixed cellulose membrane is the best choice.

[0079] 2. Primer screening

[0080] The method of Example 1 was adopted, and the eDNA enriched in 1L water sample of the same water environment (Sanjiangyuan area) was amplified by PCR using three target genes: COⅠ, 12s, and Cyt b. The selected water samples were divided into three samples: CR_1, CR_2, and CR_3;

[0081] The fish species in the CR_1 water sample included Triplophysa sphenodon, Triplophysa sphenodon, Naked Carp of Qinghai Lake, Triplophysa sphenodon, Triplophysa sphenodon, Loach, Naked Carp of Yellow River, and Naked Carp of Spotted;

[0082] CR_2 In addition to the above species, there are also naked belly leaf barbel and long filament schizothorax;

[0083] CR_3 includes the species Schizothorax gazistomus and Platypharyngeus polaris in CR_1.

[0084] Subsequently, the amplification products of COⅠ, 12s, and Cyt b were subjected to second-generation sequencing, and the amplification products of Cyt b were subjected to third-generation sequencing. The results were obtained based on 98% cluster analysis. OTUs were compared visually for species taxonomic annotation results, such as Figure 6 As shown in Figure 2, 12s rRNA can only classify Triplophysa and Triplophysa in the genus Triplophysa, but cannot distinguish other species of Triplophysa. In addition, many non-fish species were detected in the results obtained by COⅠ gene. Therefore, species classification cannot be accurately performed. Cyt b cannot be amplified by second-generation sequencing, and data monitoring and comparison cannot be performed. The third-generation sequencing technology using Cyt b as primer has a fragment length of 1184bp (see Figure 5 ), which can better distinguish more species of schizothoracine and plateau loach, so we chose Cyt b third-generation sequencing technology. The classification results of the mitochondrial genes we selected in the experimental results are more accurate than those of the other two target genes, and there are more results classified to the species level.

[0085] Heat map obtained by classifying fish eDNA using Cyt b third-generation sequencing technology, such as Figure 6 We can see that among the three samples CR_1, CR_2, and CR_3, CR_1, as the basis, has separated different fish species from CR_2 and CR_3. For example, CR_2 has more naked leaf barbel fish and long filamentous schizothorax than CR_1; CR_3 has more schizothorax and polar lipopharyngeus than CR_1. Figure 7 It can be seen that the color stratification of the three samples is obvious. Therefore, it can further prove the correctness of primer screening.

[0086] The COⅠ gene primers are specifically:

[0087] FishF2t1 (SEQ ID NO.3): CGACTAATCATAAAGATATCGGCAC;

[0088] FishR2tl (SEQ ID NO.4): CTTCAGGGTGACCGAAGAATCAGAA;

[0089] FR1dt1 (SEQ ID NO.5): CCTCAGGGTGTCCGAARAAYCARAA;

[0090] VF2t1 (SEQ ID NO.6): CAACCAACCACAAAGACATTGGCAC;

[0091] The 12s gene primers are specifically:

[0092] MiFish-UF(SEQ ID NO.7):GTYGGTAAAWCTCGTGCCAGC;

[0093] MiFish-UR(SEQ ID NO.8):CATAGTGGGGTATCTAATCCYAGTTTG;

[0094] The Cyt b gene primers are specifically:

[0095] L14724 (SEQ ID NO. 1): 5'GACTTGAAAAACCACCGTTG-3';

[0096] H15915 (SEQ ID NO. 2): 5'-CTCCGATCTCCGGATTACAAGAC-3'.

[0097] Some of the above primers use a mixture of multiple degenerate sequences (ie, degenerate primers) in sequencing.

[0098] 3. Selection of BLAST comparison database

[0099] When performing diversity analysis, the present invention can use the NCBI database for BLAST comparison. At the same time, more species sequencing data missing from the NCBI database can be supplemented for comparison with fish in the Sanjiangyuan area. For example, the mitochondrial genome sequence data of four fish species, such as the Yellow River yarrow, the long snake plateau loach, the Chaka plateau loach, and the slender plateau loach, can be supplemented to construct a local database. BLAST comparison is performed together with the NCBI database and the local database. This makes the results of the diversity analysis more accurate and complete.

[0100] 4. Comparison with the results of the fishing method

[0101] The method for detecting aquatic biodiversity in the Sanjiangyuan area in Example 1 was compared with the catch at the same location for reference, and the accuracy of using eDNA technology to detect aquatic biodiversity in the Sanjiangyuan area was further determined. Taking the Yellow River in Jiangcuo Village, Huanghe Township, Maduo County as an example, the eDNA detection obtained effective classification species through sequence alignment, including the contents in the following table:

[0102]

[0103]

[0104] The catches from the traditional fishing method - net fishing include: spotted naked carp (3), bony-lipped Yellow River fish (4), thick-lipped naked heavy-lipped fish (3), Yellow River naked split-necked fish (11), and Yellow River plateau loach (2).

[0105] Combining the above data Figure 7 , we can calculate the species richness of the site based on the OTU abundance, and we found that the eDNA analysis results are almost consistent with the species richness obtained by the traditional fishing method, and even detect more species than the fishing method, which is more sensitive. Therefore, we believe that eDNA technology has high sensitivity and accuracy.

[0106] Through the above embodiments and experimental examples, it can be seen that the present invention provides a kit and method for detecting aquatic biodiversity in the Three Rivers Source region. By optimizing the eDNA enrichment method and PCR amplification target gene. The present invention can accurately analyze the aquatic biodiversity in the Three Rivers Source region, and can be used for rare wildlife protection monitoring, alien invasive species detection, etc., so as to protect the water ecological environment in the Three Rivers Source region. Therefore, the present invention has a good application prospect.

Claims

1. A kit for detecting aquatic biodiversity in the Three Rivers Source region, characterized in that: The PCR kit comprises amplification primers, and the nucleotide sequences of the amplification primers are shown as SEQ ID NO.1 and SEQ ID NO.

2.

2. The kit for detecting aquatic biodiversity in the Three Rivers Source region according to claim 1, characterized in that: Also included is a filter membrane, which is selected from a mixed cellulose filter membrane or a nylon membrane.

3. A method for detecting aquatic biodiversity in the Three Rivers Source region, characterized in that: include: Step 1, enriching and extracting eDNA in water samples; Step 2, performing PCR amplification on the eDNA obtained in step 1; The target gene amplified by PCR is the cytochrome b gene; Step 3, sequencing the amplified product obtained in step 2; Step 4, analyzing the aquatic biodiversity of the sequencing results of step 3.

4. The method for detecting aquatic biodiversity in the Three Rivers Source region according to claim 3, characterized in that: In step 1, the enrichment method is to use membrane filtration, and the extraction is to extract the DNA in the membrane after the filtration is completed.

5. The method for detecting aquatic biodiversity in the Three Rivers Source region according to claim 4, characterized in that: The filter membrane is selected from a mixed cellulose filter membrane or a nylon membrane.

6. The method for detecting aquatic biodiversity in the Three Rivers Source region according to claim 3, characterized in that: In step 2, the nucleotide sequences of the amplification primers are shown in SEQ ID NO.1 and SEQ ID NO.

2.

7. The method for detecting aquatic biodiversity in the Three Rivers Source region according to claim 3, characterized in that: In step 3, the sequencing is third-generation sequencing.

8. The method for detecting aquatic biodiversity in the Three Rivers Source region according to claim 3, characterized in that: In step 4, the analysis includes: obtaining fish OTUs from cluster analysis results, performing BLAST comparison in a genome database, selecting the species name with the highest similarity, and determining that the species has been detected.

9. The method for detecting aquatic biodiversity in the Three Rivers Source region according to claim 8, characterized in that: The genome database includes the NCBI database and / or a self-constructed local database.

10. The method for detecting aquatic biodiversity in the Three Rivers Source region according to claim 9, characterized in that: The local database includes mitochondrial genome sequence data of Yellow River yarrow, Longshe plateau loach, Chaka plateau loach and Slender plateau loach.

Images