Molecular genetic marker YZU-GOOSE-FC-2 for goose dark and light feather color traits and application of molecular genetic marker YZU-GOOSE-FC-2

Abstract

The invention discloses a molecular genetic marker YZU-GOOSE-FC-2 for a deep and shallow feather color character of a goose and an application of the molecular genetic marker YZU-GOOSE-FC-2. The molecular genetic marker comprises an insertion molecular marker or a deletion molecular marker; the insertion molecular marker is an insertion base sequence AACT located between the G.126358 site and the G.126359 site of a gene where the molecular genetic marker YZU-GOOSE-FC-2 is located; the deletion molecular marker is a base sequence located between the G.126611 site and the G.126621 site of a gene where the molecular genetic marker YZU-GOOSE-FC-2 is located. According to the method, the accuracy of individual selection of the geese can be improved, the breeding population scale is reduced, the breeding cost is greatly saved, the breeding time is shortened, the breeding cost is reduced, and the breeding of the deep and shallow yellow feather auto-sexing commercial line is accelerated; the cost of gosling sex determination is reduced, and the disease transmission risk caused by sex determination through manual anal turning is reduced.

Description

Technical Field

[0001] The invention relates to a molecular genetic marker YZU-GOOSE-FC-2 for goose light and dark feather color traits and application thereof, belonging to the technical field of poultry breeding. Background Art

[0002] Feather color is one of the economic traits of poultry. Because it is easy to observe, feather color is often used for poultry breed classification, breed purity evaluation, and self-sexing. Breeding self-sexing matching lines based on sex-linked traits has been widely used in modern poultry farming. For example, the corresponding self-sexing matching lines are established using sex-linked fast and slow feathers, horizontal spotted feathers, and gold and silver feathers. Similar to chickens, the feather color of newborn goslings also differs between dark and light yellow feathers. However, since the molecular mechanism of goose feather color formation is not clear, the dark and light feather colors of geese cannot be used to determine the gender in current production.

[0003] At present, the method used for sex identification of geese is the traditional anal inversion method, but this method has many shortcomings, such as the high cost of sex identification, the identification personnel must be specially trained technicians, the accuracy of identification is difficult to guarantee, and the risk of disease transmission is increased. Breeding self-sexed strains based on sex-linked traits can avoid these shortcomings. Compared with the traditional artificial anal inversion method for sex identification, sex identification using self-sexed matching strains has the advantages of being fast, accurate, simple, not causing damage to poultry, and avoiding cross-infection of pathogens. The cost of molecular genetic markers is not expensive at present, and with the advancement of technology, it will become increasingly cheap. For most breeding companies, molecular genetic marker analysis is a simple and easy technology. More importantly, based on molecular genetic marker-assisted selection, the breeding of goose self-sexed matching strains can be accelerated. In short, finding molecular genetic markers that can accelerate the breeding of goose self-sexed matching strains has good application value.

[0004] Since the key to breeding self-sexed strains is to screen for molecular markers that are closely related to sex-linked traits, the accuracy and efficiency of selection can be improved through marker-assisted selection, thereby accelerating the breeding of self-sexed matching strains.

[0005] Although studies have shown that the dark and light yellow feathers of geese at birth are sex-linked, molecular genetic markers that are significantly associated with the sex-linked feather color traits of geese have not yet been screened in goose breeding. This seriously restricts the establishment of a matching strain of dark and light yellow feathers for both males and females. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a molecular genetic marker YZU-GOOSE-FC-2 for goose feather color traits and its application, which can improve the accuracy of goose individual selection and accelerate the breeding of male and female matching lines based on goose feather color.

[0007] Technical solution: To solve the above technical problems, the present invention provides a molecular genetic marker YZU-GOOSE-FC-2 for goose light and dark feather color traits, and uses the molecular genetic marker to purify the light and dark feather color phenotype of the goose to establish a male and female strain of goose light and dark feather color. The molecular genetic marker includes an insertion molecular marker and a deletion molecular marker; the insertion molecular marker is an insertion base sequence AACT located between G.126358 and G.126359 of the gene where YZU-GOOSE-FC-2 is located; the deletion molecular marker is a base sequence deleted between G.126611 and G.126621 of the gene where YZU-GOOSE-FC-2 is located. The accession number of the gene where the molecular genetic marker YZU-GOOSE-FC-2 is located is NC_089912.

[0008] The invention also provides a detection kit, which contains the molecular genetic marker.

[0009] The present invention also provides the application of the molecular genetic marker and the detection kit in genotype determination.

[0010] The present invention also provides application of the molecular genetic marker and the detection kit in selecting individuals with dark and light feather colors of geese.

[0011] This includes the application of inserted molecular markers in the selection of individuals with dark and light feather colors in geese.

[0012] This includes the application of missing molecular markers in the selection of individuals with dark and light feather colors in geese.

[0013] The present invention also provides the use of the molecular genetic marker or the detection kit in establishing a dark and light yellow feather self-differentiated male and female matching system of geese.

[0014] The specific technical solution adopted by the present invention includes: selecting a goose group to be tested, drawing blood from the individuals to be tested and extracting DNA, using the provided kit to perform polymerase chain reaction (PCR) and detect the product, sending the PCR product to a sequencing company for sequencing and determining the genotype, and selecting qualified individuals for breeding based on the genotype.

[0015] 1) Select the individuals to be tested: select individuals whose appearance meets the requirements from the breeding population.

[0016] 2) Draw blood and extract DNA: Draw 0.1 mL of blood from the wing vein of the test individual and use a DNA extraction kit to extract the DNA template.

[0017] 3) Polymerase chain reaction and product detection: Use the extracted DNA as a template in PCR and the provided PCR kit to perform PCR. Take 5 μL of the product for 1% agarose gel electrophoresis. If a single band of 557 bp is present, send the PCR product to a sequencing company for detection.

[0018] 4) Sequencing and determining mutation type: Send the PCR product and primers to a sequencing company for sequencing, and determine the mutation type based on the sequencing results.

[0019] 5) Select qualified individuals based on mutation type. Most homozygous individuals with Insertion1 at the polymorphic site have light feathers, while most homozygous individuals with Deletion have dark feathers. Determine the retained individuals based on the breeding goal of feather color traits.

[0020] The technical problem that the present invention focuses on solving is to screen out molecular markers that are closely related to the sex-linked trait - the dark and light yellow feather trait of goslings, so as to provide a scientific basis for individual selection in the process of breeding self-sexed matching lines.

[0021] The present invention targets genes related to feather color traits on chromosome Z (such as SLC45A2 and PRLR genes) and their adjacent genes, screens their single nucleotide polymorphism markers, analyzes the association between these markers and the dark or light yellow feather traits of newborn geese, and thereby obtains molecular genetic markers closely associated with the trait, so as to be applied to the breeding of dark or light yellow feather self-differentiated male and female strains of geese.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0023] 1) The present invention can improve the accuracy of individual goose selection, reduce the scale of breeding groups and greatly save breeding costs, shorten the breeding time, reduce breeding costs, and accelerate the breeding of dark and light yellow feather self-differentiated male and female matching lines;

[0024] 2) The self-sexing matching lines bred by the present invention will help reduce the cost of sex identification of goslings, reduce the risk of disease transmission caused by artificial anal inversion for sex determination, reduce the workload of technicians, and be beneficial to the healthy development of the goose farming industry, creating certain social and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The electrophoresis diagram of PCR products of DNA samples from 13 geese;

[0026] Figure 2The sequencing peaks corresponding to the homozygotes of different genotypes at the deletion / insertion mutation sites of the marker gene: Figure A represents homozygotes without Insertion1 (wild type), Figure B represents homozygotes with Insertion1, Figure C represents homozygotes without Deletion (wild type), and Figure D represents homozygotes with Deletion;

[0027] Figure 3 This is an example of sequencing results of different individuals at the marker gene Insertion1 site;

[0028] Figure 4 This is an example of sequencing results of different individuals at the deletion site of the marker gene. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0030] 1) Select the individuals of the cross-eyed geese to be tested: 90 individuals with dark yellow feathers and light yellow feathers were selected from a group of newborn cross-eyed geese (derived from the National Waterfowl Gene Bank in Taizhou City, Jiangsu Province).

[0031] 2) Drawing blood and extracting DNA: 0.1 mL of blood was drawn from the wing vein of the test individual, and a DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP348) was used to extract the DNA template according to the instructions of the kit.

[0032] 3) Polymerase chain reaction and product detection: Use the extracted DNA as a template in PCR, and perform PCR amplification according to the operating instructions of 2×RapidTaq Master Mix (Novozyme Biotechnology Co., Ltd., P222-01). The primers used in the PCR reaction include: upstream primer sequence 5'-CAAGCTCAACCACTCTGTTATCAA-3', downstream primer sequence 5'-TGGAGTTTCTCTTCAGCCCTA-3'. Take 5 μL of the product for 1% agarose gel electrophoresis, if a single band of about 557 bp is present (the reference sequence is SEQ ID NO.1 in the attachment, and the band electrophoresis diagram is in the attachment Figure 1 ).

[0033] Sequencing and determining mutation type: Send PCR products and primers to a sequencing company for sequencing, and determine the mutation type based on the sequencing results (see Appendix Figure 2 , 3 , 4). In the attached Figure 2In the sequencing chromatograms shown, Figure A is the chromatogram of the wild-type sequence at the mutation site, and its corresponding sequence is CTCACGACTA; Figure B is the chromatogram of the insertion mutation sequence (named Insertion1 site), and its corresponding sequence is CTCAC(AACT)GACTA, wherein AACT is the inserted base compared with the wild-type sequence, and the insertion sequence is located at the G.126358→G.126359 position of the PRLR gene in GenBank; Figure C is the chromatogram of the wild-type sequence at the mutation site, and its corresponding sequence is GTCTATAAGAATTTGTCAGTA; Figure D is the chromatogram of the deletion mutation sequence (named Deletion site), and its corresponding sequence is GTCTA(***********)CAGTA, wherein ************ represents the base TAAGAATTTGT deleted compared with the wild-type sequence, and the deletion sequence is located at the G.126611→G.126621 position of the PRLR gene in GenBank. Attachment Figure 3 and attached Figure 4 The following are examples of sequencing results of different individuals near the Insertion1 and Deletion sites. Figure 3 In the figure, the red base sequence AACT is an insertion mutation sequence. Figure 4 In the sequence, the base sequence TAAGAATTTGT is a deletion mutation sequence. (Note: For the reference sequence of the wild-type gene of YZU-GOOSE-FC-2, see the PRLR gene accession number in GenBank: NC_089912)

[0034] Significance analysis: In order to analyze the degree of association between molecular markers and feather color traits, a chi-square test was performed on the association between the mutation types and feather color of this batch of open-eyed geese (see Table 1 for details).

[0035] Table 1 Correlation between mutation types of marker gene polymorphism sites and plumage color

[0036]

[0037]

[0038] The results showed that there was a very significant correlation between mutation type and feather color (P<0.01). Note: This step can be skipped when the invention is actually applied. According to the breeding goal of feather color traits, the corresponding genotype is selected. 77.6% of individuals with Insertion1 homozygous mutation type at the polymorphic site have light feathers, and 61.1% of individuals with Deletion homozygous mutation type have dark feathers.

[0039] Analysis of discrimination accuracy: Genomic DNA was extracted from blood samples of 47 newborn geese using the above method, and PCR and sequencing analysis were performed. Without considering the heterozygous genotype, the genotypes of two molecular markers (Insertion1 and Deletion) in the intron region of the PRLR gene were used to discriminate the light and dark feather color of the goose, and the feather color discrimination accuracy of the molecular markers was analyzed by conventional naked eye phenotypic observation methods (see Table 2 for details).

[0040] Table 2 Analysis of feather color discrimination accuracy of molecular markers

[0041]

[0042] The results showed that the accuracy of determining light-colored feathers with the Insertion1 homozygous mutation type was as high as 80.6%, and the accuracy of determining dark-colored feathers with the Deletion homozygous mutation type was as high as 88.9%. This step can be skipped in actual application of the invention.

Claims

1. A molecular genetic marker YZU-GOOSE-FC-2 for goose feather color traits, characterized in that: The molecular genetic marker includes an insertion molecular marker and a deletion molecular marker; the insertion molecular marker is an insertion base sequence AACT located between positions G.126358 and G.126359 of the PRLR gene; the deletion molecular marker is a deleted base sequence located between positions G.126611 and G.126621 of the PRLR gene; the accession number of the gene where the molecular genetic marker YZU-GOOSE-FC-2 is located is NC_089912.

2. A detection kit, characterized in that: It contains the molecular genetic marker YZU-GOOSE-FC-2 according to claim 1.

3. Use of the molecular genetic markers described in claim 1 and the detection kit described in claim 2 in determining the genotype of the dark and light feather color traits of geese.

4. Use of the molecular genetic marker according to claim 1 or the detection kit according to claim 2 in selecting individuals with dark or light feather color in geese.

5. The use according to claim 4, characterized in that: This includes the application of inserted molecular markers in the selection of individuals with dark and light feather colors in geese.

6. The use according to claim 4, characterized in that: Including the application of missing molecular markers in the selection of individuals with dark and light feather colors in geese.

7. Use of the molecular genetic marker according to claim 1 or the detection kit according to claim 2 in establishing a self-differentiated male and female matching system of goose with dark and light yellow feathers.

Images