Application of ACSS2 as hepatitis B treatment target
By regulating ACSS2 expression and developing therapeutic drugs for hepatitis B virus, the problem of unclear role of ACSS2 in HBV infection has been solved, significantly inhibiting or promoting HBV transcription and replication, providing new therapeutic strategies and potential market potential.
Patent Information
- Application Number
- CN202411174703.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-26
- Publication Date
- 2024-12-13
AI Technical Summary
Hepatitis B virus (HBV) infection affects liver lipid metabolism and leads to serious diseases, but the role of ACSS2 in the HBV life cycle is still unclear and there is a lack of effective therapeutic targets.
By promoting or inhibiting ACSS2 expression, drug or pharmaceutical compositions are developed to target hepatitis B virus infection, inhibit HBV transcription and replication, and to utilize ACSS2 expression promoters or inhibitors, including ACSS2 gene overexpression vectors, to target HBV infectious diseases Perform treatment.
In HBV transfected cell systems and mouse models, overexpression or knockdown of ACSS2 significantly reduces or promotes HBV transcription and replication, providing new therapeutic targets and strategies with wide application prospects.
Smart Images
Figure BDA0005010397210000031 
Figure HDA0005010397220000011 
Figure HDA0005010397220000012
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of ACSS2 as a target for the treatment of hepatitis B. Background Art
[0002] Hepatitis B virus (HBV) is considered a "metabolic virus" and is the most common chronic viral infection. HBV infection affects multiple metabolic pathways including liver lipid metabolism and can lead to a series of serious liver diseases, such as chronic hepatitis B, cirrhosis and hepatocellular carcinoma.
[0003] Acetyl-CoA synthetase 2 (ACSS2) is an important member of the acetyl-CoA synthetase family. It participates in lipid synthesis and promotes protein acetylation by generating acetyl-CoA, thereby playing a role in physiological and pathological processes such as material metabolism, tumor occurrence and development, and viral infection.
[0004] ACSS2 is a key enzyme in lipid metabolism, but its role in the HBV life cycle is still unclear. Summary of the invention
[0005] The purpose of the present invention is to provide an application of ACSS2 as a target for the treatment of hepatitis B in response to the above problems.
[0006] In order to achieve its purpose, the present invention adopts the following technical solution:
[0007] The first aspect of the present invention provides the use of ACSS2 as a target in screening drugs for treating hepatitis B virus infectious diseases or disorders.
[0008] The drug promotes the expression of ACSS2.
[0009] The second aspect of the present invention provides the use of ACSS2 as a target in screening products that inhibit hepatitis B surface antigen or screening products that inhibit HBV transcription and replication.
[0010] The product promotes the expression of ACSS2, and the product is a reagent or a drug.
[0011] The third aspect of the present invention provides use of an ACSS2 expression promoter in the preparation of a medicament for treating hepatitis B virus infectious diseases or disorders.
[0012] The ACSS2 expression promoter refers to a substance that can increase the expression level of the ACSS2 gene or protein.
[0013] In the application technology scheme described in the third aspect above, the drug has any one of the following functions: (1) inhibiting hepatitis B surface antigen; (2) inhibiting HBV transcription and replication.
[0014] Preferably, the active ingredient of the ACSS2 expression promoter contains an ACSS2 gene overexpression vector.
[0015] Preferably, the overexpression vector is obtained by transforming the pcDNA3.1(+) plasmid, that is, an insertion sequence containing the ACSS2 gene is inserted into the multiple cloning site region of the pcDNA3.1(+) plasmid.
[0016] The fourth aspect of the present invention provides a pharmaceutical composition for treating hepatitis B virus infectious diseases or conditions or for resisting hepatitis B virus, comprising an ACSS2 expression promoter as an active ingredient and a pharmaceutically acceptable carrier.
[0017] The beneficial effects of the present invention are:
[0018] The present invention studies have confirmed that: in HBV-transfected cell systems, overexpression of ACSS2 can significantly reduce the secreted HBsAg level and intracellular HBcAg level, and significantly inhibit HBV transcription and replication; in HBV-transfected cell systems, silencing ACSS2 promotes HBV transcription and replication in vitro; in AAV8-1.3HBV-infected mouse models, knocking out ACSS2 significantly promotes HBV transcription and replication. The present invention provides a new potential target for the treatment of hepatitis B and a new therapeutic strategy for clinical treatment, and has broad application prospects and market potential. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 The effects of overexpression of ACSS2 on HBV transcription and replication in HBV-transfected Huh7 cells, A: Effect of overexpression of ACSS2 on the level of hepatitis B virus core antigen (HBcAg) in Huh7 cells; B: Effect of overexpression of ACSS2 on the secretion of hepatitis B surface antigen (HBsAg) by Huh7 cells; C: Effect of overexpression of ACSS2 on the level of HBV total RNA in Huh7 cells; D: Effect of overexpression of ACSS2 on the level of HBV DNA in Huh7 cells; ** represents p<0.01.
[0020] Figure 2The effects of silencing ACSS2 on HBV transcription and replication in HBV-transfected Huh7 cells, where A: the effect of silencing ACSS2 on HBcAg levels in Huh7 cells; B: the effect of silencing ACSS2 on HBsAg secretion in Huh7 cells; C: the effect of silencing ACSS2 on HBV total RNA levels in Huh7 cells; D: the effect of silencing ACSS2 on HBV DNA levels in Huh7 cells; ** represents p<0.01.
[0021] Figure 3 The effect of ACSS2 knockout on HBV replication in the AAV8-1.3HBV infected mouse model, where A: experimental process; B: effect of ACSS2 knockout on HBcAg level in liver tissue; C: effect of ACSS2 knockout on HBV total RNA level in liver tissue; D: effect of ACSS2 knockout on HBV DNA level in liver tissue; ** represents p<0.01. DETAILED DESCRIPTION
[0022] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.
[0023] The experimental methods in the following examples are conventional methods unless otherwise specified.
[0024] The primer sequences of Realtime qPCR and Realtime RT-qPCR in the embodiments of the present invention are shown in Table 1:
[0025] Table 1
[0026]
[0027] Example 1: Study on the effect of overexpression of ACSS2 on HBV replication in HBV-transfected Huh7 cells
[0028] 1. Experimental Methods
[0029] Huh7 cells were co-transfected with 1 μg of HBV expression plasmid pHBV1.3 and 1 μg of ACSS2 overexpression plasmid pcDNA3.1-ACSS2 (expressing human ACSS2 gene transcript NM_018677.4, whose nucleotide sequence is shown in SEQ ID NO.1) or its empty control pcDNA3.1-Flag. The overexpression plasmid pcDNA3.1-ACSS2 was obtained by inserting the ACSS2 gene sequence shown in SEQ ID NO.1 into the multiple cloning site region of the pcDNA3.1(+) plasmid.
[0030] 2. Experimental Results
[0031] 72h after transfection, the total HBcAg level in the cell lysate was detected by Western blot using anti-HBc (Dako, B0586), the experimental results are shown in Figure 2. Figure 1 As shown in A, it can be seen that overexpression of ACSS2 can significantly reduce the intracellular HBcAg level.
[0032] The cell supernatant was collected and the HBsAg level secreted in the cell supernatant was detected using a hepatitis B virus surface antigen (HBsAg) diagnostic kit (enzyme-linked immunosorbent assay; Shanghai Kehua, SI0910113). Figure 1 As shown in B, it can be seen that overexpression of ACSS2 can significantly reduce the level of secreted HBsAg.
[0033] Realtime qPCR (TB Premix Ex Taq TM II (Tli RNaseH Plus), TaKaRa, RR820) and Realtime RT-qPCR (One Step TB PrimeScript TM RT-PCR Kit II (Perfect Real Time, TaKaRa, RR086A) was used to detect the effect of overexpression of ACSS2 on the levels of total HBV RNA and DNA in cells. Figure 1 As shown in C and 1D, it can be seen that overexpression of ACSS2 can significantly reduce the levels of intracellular HBV RNA and DNA.
[0034] The experimental results showed that in the HBV-transfected cell system, overexpression of ACSS2 could significantly reduce the level of secreted HBsAg and intracellular HBcAg, and significantly inhibit HBV transcription and replication.
[0035] Example 2: Study on the effect of silencing ACSS2 on HBV transcription and replication in HBV-transfected Huh7 cells
[0036] 1. Experimental Methods
[0037] Huh7 cells were co-transfected with 1 μg of HBV expression plasmid pHBV1.3 (containing 1.3 copies of HBV genome (Genbank accession NO.AY220698.1), donated by Researcher Chen Xinwen from Wuhan Institute of Virology, Chinese Academy of Sciences) and 40 nM siACSS2 (siRNA targeting inhibition of ACSS2 gene expression, containing SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, SEQ ID NO.5 sequences, custom synthesized by Shanghai Jima) or its negative control siNC (siRNA of non-specific target, custom synthesized by Shanghai Jima).
[0038] siACSS2_1 and siACSS2_2 that silence the ACSS2 gene:
[0039] Sense strand of siACSS2_1: CAGGAUUGAUGACAUGCUCAATT (SEQ ID NO. 2);
[0040] Antisense strand of siACSS2_1: UUGAGCAUGUCAUCAAUCCUGTT (SEQ ID NO. 3);
[0041] Sense strand of siACSS2_2: GUUCUGCUACUUUCCCAUUTT (SEQ ID NO. 4);
[0042] The antisense strand of siACSS2_2: AAUGGGAAAGUAGCAGAACCG (SEQ ID NO. 5).
[0043] Negative control siNC gene sequence:
[0044] Sense strand of siNC: UUCUCCGAACGUGUCACGUTT (SEQ ID NO. 6);
[0045] The antisense strand of siNC: ACGUGACACGUUCGGAGAATT (SEQ ID NO. 7).
[0046] 2. Experimental Results
[0047] 72h after transfection, the total HBcAg expression level in the cell lysate was detected by Western blot. Figure 2 As shown in A, it can be seen that silencing ACSS2 can significantly increase the level of HBcAg in cells.
[0048] The cell supernatant was collected and the HBsAg level secreted in the cell supernatant was detected using a hepatitis B virus surface antigen (HBsAg) diagnostic kit (enzyme-linked immunosorbent assay). Figure 2 As shown in B, it can be seen that silencing ACSS2 can significantly promote HBsAg secretion.
[0049] Anti-HBc was used to detect the total HBcAg expression level in cell lysate by Western blot method. Figure 2 As shown in B, it can be seen that silencing ACSS2 can significantly increase the level of HBcAg in cells.
[0050] Realtime qPCR and Realtime RT-qPCR were used to detect the effects of silencing ACSS2 on the levels of HBV total RNA and DNA in cells. Figure 2 As shown in C and 2D, it can be seen that silencing ACSS2 can significantly increase the levels of intracellular HBV RNA and DNA.
[0051] Experimental results showed that in HBV-transfected cell systems, silencing ACSS2 promoted HBV transcription and replication in vitro.
[0052] Example 3: Study on the effect of knocking out ACSS2 on HBV transcription and replication in the AAV8-1.3HBV infected mouse model
[0053] 1. Experimental Methods
[0054] The AAV8-1.3HBV infection mouse model was successfully established 6 weeks later by intravenous injection of 100 μl AAV8-1.3HBV ayw virus suspension (1E+11vg; Beijing Wujiahe Gene Technology Co., Ltd., AMV-002) into wild-type or ACSS2-KO C57BL / 6J male mice (gift from Professor Hu Wenquan of Chongqing Medical University) at about 8 weeks of age. Blood was collected from the eye sockets of mice at different time points at 6, 10, and 14 weeks after injection to collect serum, and mice were killed at 14 weeks after injection to collect and extract liver samples.
[0055] 2. Experimental Results
[0056] At 6, 10, and 14 weeks after injection of AAV8-1.3HBV virus, mouse serum was collected and the HBsAg level secreted in the peripheral blood of mice was detected using a hepatitis B virus surface antigen diagnostic kit. Figure 3 As shown in A, it can be seen that knocking out ACSS2 can significantly increase the level of secreted HBsAg.
[0057] After 14 weeks, the mice were killed and liver tissue samples were collected to detect HBcAg levels by immunohistochemical staining. Figure 3 As shown in B, it can be seen that knocking out ACSS2 can significantly increase the level of HBcAg in the mouse liver.
[0058] Realtime RT-qPCR and Realtime qPCR were used to detect the effects of knocking out ACSS2 on the levels of HBV total RNA and HBV DNA in mouse liver. Figure 3 C and Figure 3 As shown in D, it can be seen that knocking out ACSS2 can significantly upregulate HBV RNA and DNA levels in liver tissue.
[0059] Experimental results showed that in the AAV8-1.3HBV infection mouse model, knocking out ACSS2 significantly promoted HBV transcription and replication.
Claims
1. Application of ACSS2 as a target in screening drugs for treating hepatitis B virus infectious diseases or conditions.
2. The use according to claim 1, characterized in that: The drug promotes the expression of ACSS2.
3. Application of ACSS2 as a target in screening products that inhibit hepatitis B surface antigen or products that inhibit HBV transcription and replication.
4. The use according to claim 3, characterized in that: The product promotes the expression of ACSS2, and the product is a reagent or a drug.
5. Use of an ACSS2 expression promoter in the preparation of a drug for treating hepatitis B virus infectious diseases or conditions.
6. The use according to claim 5, characterized in that: The ACSS2 expression promoter refers to a substance that can increase the expression level of the ACSS2 gene or protein.
7. The use according to claim 5 or 6, characterized in that: The drug has any one of the following functions: (1) inhibiting hepatitis B surface antigen; (2) inhibiting HBV transcription and replication.
8. The use according to claim 5 or 6, characterized in that: The active ingredient of the ACSS2 expression promoter contains an ACSS2 gene overexpression vector.
9. The use according to claim 5 or 6, characterized in that: The overexpression vector is obtained by transforming the pcDNA3.1(+) plasmid, that is, an insertion sequence containing the ACSS2 gene is inserted into the multiple cloning site region of the pcDNA3.1(+) plasmid.
10. A pharmaceutical composition for treating a disease or condition caused by hepatitis B virus infection or for fighting hepatitis B virus, characterized in that: The invention contains an ACSS2 expression promoter as an active ingredient and a pharmaceutically acceptable carrier.