Rhodotorula glutinis promoter and application thereof

Abstract

The invention discloses a promoter derived from Rhodotorula glutinis (Rhodotorula glutinis), the nucleotide sequence of the promoter is shown as SEQ ID NO: 1, and the nucleotide sequence of the promoter is shown as SEQ ID NO: 2. According to the invention, a glyceraldehyde-3-phosphate dehydrogenase gene 5 '-terminal nucleotide full-length sequence is cloned, so that a green fluorescent protein RtGFP gene is driven to be expressed in rhodosporidium, and the expression condition of RtGFP is judged by detecting fluorescence, so that whether the 5'-terminal nucleotide sequence of the glyceraldehyde-3-phosphate dehydrogenase gene with the length has promoter activity or not is determined; the promoter can effectively drive expression of exogenous genes in rhodosporidium, provides an important tool for metabolic engineering modification of rhodosporidium, and has important application value.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and specifically relates to a method for separating red yeast ( Rhodotorula glutinis ) Promoter of glyceraldehyde-3-phosphate dehydrogenase gene (gpd) of YM25079 and its application. Background Art

[0002] As a microorganism with unique physiological characteristics and wide industrial application potential, red yeast has gradually emerged in scientific research and industrial production in recent years. Its high cell density and ability to efficiently metabolize a variety of carbon and nitrogen sources enable red yeast to perform well in the fields of biotransformation, oil production, and carotenoid synthesis. In red yeast, whether studying metabolic regulation pathways or increasing the content of metabolites, it is usually necessary to overexpress related genes.

[0003] The fungal gpd promoter, or glyceraldehyde-3-phosphate dehydrogenase promoter, is a common constitutive promoter that can regulate gene expression under different conditions. The differences in activity of different fungal gpd promoters are mainly reflected in the strength and regulatory characteristics of the promoters. The gpd promoters of different fungi differ in their ability to drive gene expression. Some promoters may have stronger driving abilities, resulting in higher levels of gene expression, while others may be relatively weak. In addition, in addition to differences in strength, fungal gpd promoters also have different regulatory characteristics. For example, some gpd promoters may be affected by specific environmental conditions, such as temperature, nutritional status, etc., thereby exhibiting different activities. ‌ At present, there are certain obstacles in the use of gpd gene promoters between different species, mainly including promoter specificity, transcription factor differences, and differences in regulatory mechanisms. First, promoter specificity is a major obstacle. Promoters are RNA polymerase binding sites that determine when and where genes begin to be expressed. There may be significant differences in the sequence and structure of promoters in cells of different species, resulting in some promoters being effective in one organism but ineffective or inefficient in another. Secondly, differences in transcription factors are also an important factor. Transcription factors are proteins that regulate gene expression. The types and affinities of transcription factors in cells of different species may be different, which may cause foreign genes to be unable to be expressed correctly or at low levels in new species. Finally, differences in regulatory mechanisms are also a key obstacle. There may be significant differences in the regulatory mechanisms of gene expression in cells of different species, including differences in epigenetic modifications, chromatin structure, etc., all of which may affect the expression efficiency and stability of foreign genes. Summary of the invention

[0004] The present invention provides a method for preparing ... novel polysaccharide from red yeast ( Rhodotorula glutinis) YM25079 was isolated and obtained the promoter (RgPgpd) of the glyceraldehyde-3-phosphate dehydrogenase gene (gpd) and its application. The nucleotide sequence of the promoter is shown in SEQ ID NO: 1. The gene sequence is 3078 bp long. The promoter is connected to a vector and transferred into red winter spore yeast cells ( Rhodosporidium kratochvilovae ) is used to regulate the transcription and expression of exogenous target genes in red winter spore yeast.

[0005] The purpose of the present invention is achieved through the following technical solutions: (1) The genomic DNA of Rhodotorula glutinosus was extracted using a DNA extraction kit. The genomic DNA was used as a template and specific primers RgPgpd-F and RgPgpd-R were used to amplify the amplified product. R , the vector pRH2034 (containing RtGFP Gene) and R The fragments were connected to obtain a recombinant plasmid pRgpd, and the connection product was transformed into Escherichia coli. The positive single clone was screened by PCR. The recombinant plasmid pRgpd was verified by PCR using specific primers of the gpd promoter. After the positive clones were cultured, the plasmids were extracted and sequenced to obtain the recombinant plasmid pRgpd containing the glyceraldehyde-3-phosphate dehydrogenase gene promoter; (2) The recombinant vector pRgpd was transformed into red winter spore yeast YM25235 using the PEG-mediated protoplast method, and the fluorescence was detected to determine RtGFP The expression of the glyceraldehyde-3-phosphate dehydrogenase gene was determined to determine whether the 5' end nucleotide sequence of the glyceraldehyde-3-phosphate dehydrogenase gene had promoter activity; and the expression of RtGFP fluorescent protein in red winter spore yeast YM25235 was detected by Western blot experiment to determine the strength of the promoter.

[0006] Advantages and technical effects of the present invention: The present invention clones the 5' end nucleotide sequence of the promoter of the glyceraldehyde-3-phosphate dehydrogenase gene in Rhodotorula glutinosus and expresses it in Rhodotorula glutinosus YM25235. RtGFP The expression of the glyceraldehyde-3-phosphate dehydrogenase gene can be determined by measuring the 5' end nucleotide sequence of the glyceraldehyde-3-phosphate dehydrogenase gene of the length, and then determining whether the 5' end nucleotide sequence of the glyceraldehyde-3-phosphate dehydrogenase gene has promoter activity and promoter strength. The present invention provides a new promoter sequence for heterologous expression, which has important research significance and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] Figure 1The PCR amplification diagram of the promoter fragment of the glyceraldehyde-3-phosphate dehydrogenase gene of Rhodotorula glutinosus YM25079 of the present invention; 1. DNA molecular weight marker DL5000; 2. negative control; 3. promoter fragment of the glyceraldehyde-3-phosphate dehydrogenase gene; Figure 2 is the plasmid map of the recombinant plasmid pRgpd; Figure 3 This is the electrophoresis diagram for colony PCR verification; 1. DNA molecular weight marker DL5000; 2. Negative control; 3. gpd promoter fragment; 4-5 are transformants; Figure 4 Verification of positive clones of the recombinant plasmid pRgpd transformed red winter spore yeast YM25235, including 1. DNA molecular scaler DL5000; 2. negative control; 3. PCR product amplified from the YM25235 genome; 4. PCR product amplified from plasmid pRgpd; 5. PCR product amplified from the YM25235 / pRgpd strain genome; Figure 5 The expression of green fluorescent protein in red winter spore yeast protoplasts (objective lens 20×); Figure 6 The Western blot results of the fluorescent protein RtGFP expression of strain YM25235 / pRH2034, strain YM25235 / pRgpd and control strain YM25235 are shown in Figure 1. The lanes from left to right are red winter spore yeast YM25235, transformant YM25235 / pRH2034, and YM25235 / pRgpd; Figure 7 These are the results of Western blot protein band grayscale analysis of the expression levels of the fluorescent protein RtGFP in strains YM25235 / pRH2034, strain YM25235 / pRgpd and control strain YM25235. DETAILED DESCRIPTION

[0008] The present invention is further described in detail below in conjunction with the accompanying drawings and examples, but the protection scope of the present invention is not limited to the above contents. The reagents and methods used in the examples, unless otherwise specified, are conventional reagents and methods. Example 1: Cloning of the promoter of glyceraldehyde-3-phosphate dehydrogenase gene and construction of expression vector pRgpd 1. The genomic DNA of Rhodotorula glutinosus was extracted according to the steps in the instruction manual of the DNA extraction kit (purchased from Shanghai Sangon Biotechnology Co., Ltd.). According to the promoter RgPgpd sequence obtained in the transcriptome sequencing, specific primers RgPgpd-F and RgPgpd-R were designed. The DNA template obtained above was used to perform PCR amplification in a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.) using primers RgPgpd-F and RgPgpd-R. The primers, amplification system and amplification conditions used in the reaction were as follows: RgPgpd-F:5'- CTAGAACTAGGACGGCCATATG TCGTTGGCGGTGTCGGGT-3' (double underline indicates the homologous sequence at the end of the upstream vector, single underline indicates N Ⅰ restriction site) RgPgpd-R:5'- CTTCGAGACCGGATCCGCCATGG GTTTCGAGTGTGCAGGG-3' (double underline indicates the downstream vector end homologous sequence, single underline indicates Nco Ⅰ restriction site); The PCR amplification system was as follows (50 μL): Template cDNA 1 μL, RgPgpd-F 2 μL, RgPgpd-F 2 μL, dNTPs Mix (10 mM each) 1 μL, Vazyme 2× Phanta Max Buffer 25 μL, Vazyme Phanta MaxSuper-Fidelity DNA Polymerase 1 μL, ddH O added to 50 μL; Amplification conditions: 95℃ pre-denaturation for 3min, then 95℃ denaturation for 15s, 63℃ annealing for 15s, 72℃ extension for 3min15s, a total of 30 cycles, and finally 72℃ extension for 5min; after the reaction, take 1μL of the product and perform electrophoresis analysis in 1% agarose gel. The results are as follows: Figure 1 As shown; the amplified fragment of about 3078 bp was named R ; 2. Extract plasmid pRH2034 (OMEGA Plasmid Mini Kit I, OMEGA, USA), measure the concentration, and store at -20°C for future use. N Ⅰ 、Nco Ⅰ Two restriction endonucleases were used for double digestion, and the digestion products were recovered using a multifunctional DNA recovery kit (Beijing Biotech Biotechnology Co., Ltd., product number: DP1502). The recovered fragments were compared with the gene fragments. RThe seamless cloning kit (ClonExpress II One Step CloningKit C112, Nanjing Novogene Biotechnology Co., Ltd.) was used to connect to obtain the recombinant plasmid pRgpd. The connection system was as follows (20 μL): Exnase TM Ⅱ2μL, R 82.2 ng of fragment, 200 ng of linearized pRH2034, 4 μL of 5×CEⅡBuffer, and the rest of ddH2O; use a pipette to gently pipette and mix, centrifuge briefly to collect the reaction solution to the bottom of the tube, and then react in a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.) at 37°C for 30 min; cool to 4°C or immediately place on ice; 3. Take 10µL of the ligation product and add it to 100µL of DH5α competent cells. Tap the tube wall to mix. Place it on ice for 30 minutes. Heat shock it in a 42℃ water bath for 90 seconds and immediately place it on ice to cool for 90 seconds. Add 900µL of LB liquid culture medium to the ligation system. Incubate it at 37℃ and 100rpm for 1 hour. Centrifuge it at 5000rpm for 10 minutes and discard 900µL of supernatant. Gently blow the remaining 100µL of LB culture medium to suspend the bacteria and spread it on an LB solid plate (containing 100µg / mL spectinomycin). Invert and culture it at 37℃ for 12-16 hours. Randomly pick two white colonies growing on the plate and number them 1-2. Verify the positive clones by colony PCR. The results are shown in the figure. Figure 3 , it can be seen from the figure that the two selected monoclonal strains amplified specific bands with the same size as the target fragment through colony PCR, indicating that the recombinant plasmid was successfully transferred into the two selected DH5α strains; the positive clones were inoculated into LB liquid culture medium (containing 100μg / mL spectinomycin) for overnight culture, and the bacteria were collected and the plasmids were extracted (OMEGA PlasmidMini Kit I, OMEGA, USA). The plasmids verified by PCR were sent for sequencing for further verification. After sequencing (Kunming Shuoqing Biotechnology Co., Ltd.), the sequencing results showed that the size of the amplified fragment was 3078bp, which was consistent with the transcriptome sequence, and the nucleotide sequence was shown in SEQ ID NO: 1; 4. Pick a single clone of the DH5α strain that has been successfully transferred with the correct recombinant vector pRgpd and inoculate it into LB liquid medium (containing 100µg / mL spectinomycin) for overnight culture, extract the plasmid (OMEGA Plasmid Mini Kit I, OMEGA, USA), measure the concentration, and store it at -20℃ for later use. The recombinant vector pRgpd was transformed into red winter spore yeast YM25235 using the PEG-mediated protoplast transformation method. The specific method is as follows: Pick a single colony of red winter spore yeast YM25235 and inoculate it into 5mL YPD liquid medium, shake and culture it at 28℃ and 160rpm overnight, and use it as seed liquid; transfer the seed liquid to 50mL YPD liquid medium at an inoculation rate of 1%, and shake and culture it at 28℃ and 160rpm until the bacterial liquid OD reaches 0. 600The concentration of the bacterial solution was between 0.45 and 0.5, and the bacterial solution was centrifuged at 4°C and 4500rpm for 5 min to collect the bacterial cells; the collected bacterial cells were washed twice with a previously prepared citric acid buffer (30mmol / L citric acid, 83mmol / L sodium citrate, 600mmol / L mannitol, and NaOH adjusted to pH 5.4), and the bacterial cells were suspended in 800-1000μL citric acid buffer and placed on ice for later use; an enzymatic solution (0.075g snail enzyme, 0.03g Sigma lytic enzyme, 0.03g Guangdong microbial lytic enzyme, and citric acid) was prepared. 4 mL of enzyme solution was mixed with 800-1000 μL of bacteria suspended in citric acid buffer and then placed in 28°C, 90 rpm shaking culture for 2.5-3 h for enzymolysis. A small amount of bacterial solution was taken to observe the enzymolysis efficiency under a microscope. When the amount of enzymolysis was confirmed to be sufficient, the culture was centrifuged at 4°C, 1300 rpm for 10 min to collect the bacteria; 10 mL of STC buffer (1.2 mol / L sorbitol, 10 mmol / L The collected cells were washed twice on ice with 500-1000 μL of STC buffer to prepare yeast competent cells; the cells were suspended with 800-1000 μL of STC buffer and dispensed into 5 mL sterile centrifuge tubes at 100 μL per tube for later use; 10 μL of pRgpd recombinant plasmid at a concentration of 209.92 μg / mL was added to 100 μL competent cells and gently mixed, incubated on ice for 10 min, 200 μL of pre-cooled PTC buffer (50% PEG, 10 mmol / L Tris-HCl, 100 mmol / L CaCl2) was added, ice bathed for 10 min, 200 μL of pre-cooled PTC buffer was added again, ice bathed for 10 min, and finally 800 μL of pre-cooled PTC buffer was added, and gently mixed, and water bathed at 42°C for 30 min. After the water bath, the cells were collected by centrifugation at 4°C and 1500 rpm for 10 min, 1 mL of supernatant was discarded, and 1 mL The cells were suspended in 0.4 mol / L sucrose YPD liquid medium and cultured at 28°C and 90 rpm for 24 h to revive the cells. The revived cells were collected by centrifugation at 1300 rpm for 10 min, the supernatant was discarded, and the remaining 100 μL medium was used to suspend the cells. Finally, the cells were spread on a plate containing 0.4 mol / L sucrose on YPD solid medium (containing 40 μg / mL hygromycin B), inverted culture at 28°C for 3-4 days. When the solid medium grows, the transformants are numbered and transferred to YPD solid medium containing 150 μg / mL hygromycin B, inverted culture at 28°C for two days; the obtained transformants are inoculated into a test tube containing 5 mL YPD liquid medium, shaken and cultured at 28°C and 160 rpm for 24 hours, and the wild strain YM25235 is used as a control. Then, the genomic DNA of the yeast transformants is extracted according to the steps in the instructions of the DNA extraction kit (purchased from Shanghai Sangon Biotechnology Co., Ltd.), and then PCR verification is performed. The results are as follows. Figure 4 As shown in the figure, it can be seen that the transformant genome can be used as a template by PCR to amplify R The cDNA fragments of the same size bands, the gene verification of the recombinant transformant is correct, indicating that R The recombinant plasmid pRgpd was successfully introduced into the genome of the yeast transformant. Using the YM25235 strain as a control, the positive transformants screened were propagated for 6 generations on YPD solid medium containing 150 μg / mL hygromycin B. RtGFP The expression of Figure 5 As shown, this indicates that the gpd promoter of Rhodotorula glutinosus can effectively promote the expression of the fluorescent protein gene in Rhodotorula glutinosus. It can be seen that the vector constructed above can effectively express foreign genes in Rhodotorula glutinosus. Example 2: Strength detection of the gpd promoter of Rhodotorula glutinosus The original plasmid pRH2034 (the plasmid promoter is derived from Rhodosporidium toruloides R. toruloides ATCC10657) and the above-mentioned recombinant plasmid pRgpd were transformed into red winter spore yeast YM25235 according to the above-mentioned protoplast transformation method, and the positive clones of the two plasmids were screened by fluorescence detection.

[0009] The positive transformants were inoculated into 50 mL YPD liquid medium, respectively. After fermentation at 28°C and 160 rpm for 48 h, the cells were collected in 2 mL centrifuge tubes by centrifugation at 4500 rpm for 6 min, washed twice with pre-cooled ddH2O, and finally centrifuged at 12000 rpm for 5 min to completely remove residual water. The cells were then immediately frozen with liquid nitrogen and stored at -80°C.

[0010] Sample lysis: Sample lysis is performed using conventional methods, such as ultrasonic disruption or chemical lysis.

[0011] Sample preparation: The lysed sample was centrifuged at 10,000 rpm for 10 min, the precipitate was discarded, the supernatant was taken out, 5× loading buffer was added, and the sample was treated at 100°C for 5-10 min; SDS-PAGE electrophoresis: Take 10ul of sample for SDS-PAGE electrophoresis, voltage 80V, current 60mA, run gel for 30min. When the marker is colored, switch to voltage 120V, current 80mA and continue running gel for 1h 30min. Transfer: Immediately after electrophoresis, transfer the gel to deionized water and soak for 2 min. The nitrocellulose membrane or PVDF membrane used for transfer is balanced with methanol for 15 min. The instrument used for semi-dry transfer is S-TRANS fast multi-channel semi-dry transfer instrument. According to the instructions of the instrument manual, first fully soak the high-efficiency transfer gasket with buffer. The S-TRANS high-efficiency transfer gasket soaked with S-TRANS anode buffer must be used on the anode plate side, and the S-TRANS high-efficiency transfer gasket soaked with S-TRANS cathode buffer must be used on the cathode plate side. The bottom of the transfer box is the anode plate, and the cover of the transfer box is the cathode plate; assemble the transfer "sandwich structure" in the semi-dry transfer box, remove bubbles, slide the transfer box into the transfer tank, set the voltage to 130V, and the current to 350A to transfer for 1.5h-2h; Washing: transfer the PVDF membrane to PBST after transfer, and wash it by shaking on a decolorizing shaker at room temperature. Wash for 10 minutes each time, for a total of 2 times; Blocking: Prepare 35% skim milk as blocking solution and block at room temperature for 2 hours; Washing: transfer the blocked PVDF membrane to PBST and wash it on a decolorizing shaker at room temperature for 10 minutes each time for a total of 3 times. Drain the washing solution with filter paper and then incubate with the primary antibody. Primary antibody incubation: dilute the primary antibody in the antibody dilution box according to the dilution ratio in the antibody manual, the dilution volume is 10mL, place the antibody dilution box in a 4℃ shaker, and incubate overnight with shaking; Wash the membrane with primary antibody: transfer the incubated membrane to PBST and wash it on a decolorizing shaker at room temperature for 10 minutes each time, for a total of 3 washes; Secondary antibody incubation: dilute the secondary antibody in the antibody dilution box according to the dilution ratio in the antibody manual, the dilution volume is 10mL, place the antibody dilution box in a 37℃ shaker, and incubate for 1h; Wash the membrane with secondary antibody: transfer the incubated membrane to PBST and wash it on a decolorizing shaker at room temperature for 10 minutes each time, for a total of 3 washes; Color development: Use ECL color developing solution for color development. After 3-5 minutes of color development, take pictures and record them on a fully automatic chemiluminescence image analyzer. Figure 6 .

[0012] Band digitization: The Western Blot bands were analyzed by Image J software. Figure 7 .

[0013] The results showed that the gpd promoter from Rhodotorula glutinosus could effectively promote the fluorescent protein gene in red spore mother RtGFP It can be seen that the gpd promoter can effectively express foreign genes in red winter spore yeast, and the promoter strength is higher than that of the promoter of plasmid pRH2034.

Claims

1. A promoter derived from Rhodotorula glutinosus ( Rhodotorula glutinis ), whose nucleotide sequence is shown in SEQ ID NO:

1.

2. The promoter of claim 1 is expressed in Rhodosporidium Rhodosporidium kratochvilovae ) expression system, characterized in that: Regulate the transcription and expression of exogenous target genes in red winter spore yeast.

Images