Primer combination for constructing chimera library, method and application

Abstract

The invention relates to a primer combination for constructing a chimera library, a method and application. The primer pair constructed by the chimera library comprises an upstream primer and a downstream primer, and the sequence of the upstream primer comprises a first universal primer sequence and a specific upstream primer sequence designed according to a target from the 5'end to the 3 'end; the sequence of the downstream primer comprises a second universal primer sequence and a specific downstream primer sequence designed according to a target from the 5'end to the 3 'end; wherein the first universal primer sequence and the second universal primer sequence are selected from part or all of a sequencing platform linker sequence. By adopting the primer combination, one-step library building can be realized, the library building time is shortened, the detection cost is reduced, the detection efficiency is improved, and the operation is simple; and meanwhile, the amplicon is short, so that the purposes of lower data volume and ultrahigh depth are achieved.

Description

Technical Field

[0001] The present application relates to biotechnology, and in particular to a primer combination, method and application for constructing a chimera library. Background Art

[0002] Mosaicism refers to when a person has two or more different cell lines composed of chromosomes in his body. It can occur at the chromosome level or at the gene level. And its distribution has many patterns, which may be distributed throughout the body or limited to a certain tissue. Its types include somatic cell mosaicism, germ cell and somatic cell mosaicism, and germ cell mosaicism. Among them, gonadal / germline mosaicism refers to the fact that the gonadal cells of an individual are not homozygous but mosaic. A common cause of gonadal mosaicism is heterologous mosaicism, that is, two sperms fuse with two eggs after fertilization, resulting in the gonads of the individual becoming a mosaic composed of two cell groups with different genotypes; in addition, gonadal cell mutations can also lead to gonadal mosaicism, that is, during embryonic development, a future gonadal cell mutates, resulting in the gonadal cells of the individual becoming mosaics.

[0003] Gonadal mosaicism is a very important issue in genetic diseases. Usually, no changes occur in other tissues except the gonads. The gonads themselves usually do not develop diseases. Peripheral blood DNA testing cannot detect corresponding gene abnormalities, but the gametes produced are normal and abnormal. When the offspring obtain abnormal gametes, especially males, they will develop diseases. Clinically, some children with rare diseases, especially those with dominant genetic diseases and sex chromosome genetic diseases, have clear pathogenic mutations found through genetic testing, but when verifying the parents, the parents do not carry pathogenic mutations. Is this a new mutation or gonadal mosaicism? As of the current situation, this situation is generally considered to be a new mutation. However, if the harmful mutation exists in the gonads in a mosaic manner, the gene mutation information cannot be detected from the peripheral blood DNA of the parents, but it is very likely that they will give birth to sick offspring, and the risk can be as high as 50%. Therefore, the detection and determination of chimeras can better clarify the cause and has important practical significance.

[0004] Currently, the technologies that can be used for chimera detection include Sanger sequencing, single-molecule molecular inversion probes, droplet digital PCR (ddPCR), and targeted capture combined with high-throughput sequencing. Sanger sequencing uses specific primers to enrich the target fragments by PCR, and then performs Sanger sequencing on the PCR enrichment products. However, the sensitivity of Sanger sequencing is only 10%-15%. If it is lower than this detection range, there is a risk of missed detection. Even if the suspected chimera is analyzed on the Sanger sequencing map, the chimera ratio cannot be determined. Although the single-molecule inversion probe technology can remove the redundant sequences caused by bias and PCR amplification, retain the real information in the original sample, and can detect low-frequency variations with MAF≤1%, in the process of capturing the target sequence, it is affected by the spatial effect of the target sequence length, which will affect the experimental results, and the experimental cycle is long and the cost is high. In addition, for some sites such as high GC content areas, it is currently difficult to effectively design probes, so the capture efficiency is poor. ddPCR can verify and quantitatively analyze most chimeric mutations, but it has extremely high requirements for the specificity of primers, and requires multiple primer screening and system optimization. Target sequence capture combined with ultra-high depth sequencing can amplify the detection sensitivity by at least 1000 times compared with conventional first-generation sequencing technology. However, this method requires targeted enrichment of several sequences upstream and downstream of the target site, and then construction of a fragmented library of the targeted enrichment product, which prolongs the detection cycle and increases the detection cost. Moreover, both targeted enrichment and library enrichment require PCR amplification, which invisibly increases the risk of introducing errors and greatly interferes with the judgment of the chimera ratio. At the same time, if the variant site is rich in high GC, it is necessary to add enhancers such as betaine and dimethyl sulfoxide during targeted enrichment to continuously optimize the amplification system, making the detection complicated. In addition, this method of chimera detection is also difficult to effectively detect CNV chimeras.

[0005] There is an urgent need for a new method and product that is simple, efficient, low-cost, can resolve high GC regions, and can also detect CNV chimeras. Summary of the invention

[0006] Based on this, it is necessary to provide a primer combination for constructing a chimera library in one embodiment of the present application. Using this primer combination, only one step of PCR amplification is required to quickly build the library, which shortens the time for library construction, reduces the detection cost, and improves the detection efficiency. At the same time, it can accurately realize the chimera detection of SNVs, Indels and CNVs in high GC content regions.

[0007] The technical solutions include the following:

[0008] A primer combination for constructing a chimera library, wherein the primer combination comprises:

[0009] The sequence of the upstream primer includes a first universal primer sequence and a specific upstream primer sequence designed according to the target from the 5' end to the 3' end;

[0010] The sequence of the downstream primer includes the second universal primer sequence and the specific downstream primer sequence designed according to the target from the 5' end to the 3' end;

[0011] Wherein, the first universal primer sequence and the second universal primer sequence are selected from part or all of the sequencing platform adapter sequence.

[0012] In one embodiment, the second universal primer sequence contains a barcode sequence for distinguishing different samples.

[0013] In one embodiment, the length of the barcode sequence is 6 bp to 12 bp.

[0014] In one embodiment, the sequencing platform includes the BGI sequencing platform or the Illumina sequencing platform.

[0015] In one embodiment, the first universal primer sequence includes GAACGACATGGCTACGATCCGACTT, and the second universal primer sequence includes TGTGAGCCAAGGAGTTG-barcode sequence-TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT.

[0016] In one embodiment, the first universal primer sequence includes AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, and the second universal primer sequence includes CAAGCAGAAGACGGCATACGAGAT-barcode sequence-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC.

[0017] In one embodiment, the target position corresponding to the last base at the 3' end of the specific upstream primer sequence and the specific downstream primer sequence cannot be a SNP site.

[0018] In one embodiment, the target position corresponding to the last 4 bases at the 3' end of the specific upstream primer sequence and the specific downstream primer sequence cannot be a SNP site.

[0019] In one embodiment, the lengths of the specific upstream primer sequence and the specific downstream primer sequence are 18 bp to 38 bp, respectively.

[0020] In one embodiment, the length of the amplicon amplified by the specific upstream primer sequence and the specific downstream primer sequence is 100 bp to 600 bp.

[0021] In one embodiment, the GC content of the specific upstream primer sequence or the specific downstream primer sequence is 20% to 80%.

[0022] In one embodiment, the GC content of the specific upstream primer sequence and the specific downstream primer sequence differs by 0% to 30%.

[0023] In one embodiment, the Tm value of the specific upstream primer sequence or the specific downstream primer sequence is 55°C to 80°C.

[0024] In one embodiment, the Tm value of the specific upstream primer sequence and the specific downstream primer sequence is 67°C to 80°C.

[0025] In one embodiment, the Tm value of the specific upstream primer sequence and the specific downstream primer sequence is 67°C to 72°C.

[0026] In one embodiment, the Tm value of the specific upstream primer sequence differs from that of the specific downstream primer sequence by no more than 5°C, optionally, by no more than 2°C, optionally, by no more than 1°C.

[0027] In one embodiment, when the chimera is a SNVs or Indels chimera, the distance between the variant position and the first base of the 5' end of the specific upstream primer sequence or the specific downstream primer sequence is 50 bp to 300 bp.

[0028] In one embodiment, the method includes the step of performing PCR amplification using the primer combination.

[0029] In one embodiment, one-step PCR amplification is used for library construction.

[0030] In one embodiment, the PCR amplification program includes pre-denaturation at 94°C to 95°C for 2min to 5min; denaturation at 95°C to 98°C for 12s to 15s, annealing at 58°C to 72°C for 15s, extension at 68°C to 72°C for 30s / Kb, and 30-40 cycles.

[0031] In one embodiment, annealing and extension are combined into one step in the PCR amplification procedure.

[0032] In one embodiment, the temperature of the annealing and extension after the combined step is 68-72°C.

[0033] In one embodiment, the PCR amplification system includes one or more of a buffer, dNTPs, a DNA polymerase, the upstream primer and the downstream primer.

[0034] A kit for detecting chimeras, comprising the primer combination.

[0035] In one embodiment, the kit further comprises one or more of a nucleic acid extraction reagent and a PCR amplification reagent.

[0036] In one embodiment, the PCR amplification reagents include buffer, dNTPs, and DNA polymerase.

[0037] In one embodiment, the DNA polymerase comprises a high-fidelity enzyme.

[0038] In one embodiment, the test sample includes one or more of peripheral blood, semen, urinary tract exfoliated cells and oral mucosal epithelial cells.

[0039] The primer combination is used in preparing a product for chimera detection.

[0040] In one embodiment, the mosaic detection includes one or more of distinguishing between de novo variants and mosaic variants, distinguishing between types of mosaic variants, or clarifying mosaic ratios.

[0041] In one embodiment, the chimera includes one or more of SNVs, Indels and CNV chimeras.

[0042] In one embodiment, the chimera includes one or more of reproductive chimera and somatic chimera.

[0043] A chimera detection method, comprising constructing a library using the chimera library construction method.

[0044] In one embodiment, the method further comprises the step of sequencing the library.

[0045] Compared with the traditional technology, this application has the following beneficial effects:

[0046] The primer combination of the present application can realize one-step library construction, which not only shortens the library construction time, but also reduces the detection cost, improves the detection efficiency and accuracy, and is simple to operate; at the same time, due to the short amplicon, the purpose of low data volume and ultra-high depth is achieved.

[0047] The primer combination and method for constructing the chimera library of the present application can be used to detect both SNVs and Indels chimeras and CNV chimeras, and can clarify both the type of variation (chimera / de novo) and the chimera ratio.

[0048] The primer combination and method of the present application does not require a large number of primer screening, nor does it require the addition of blockers, nor does it require the sample gradient dilution to determine the detection sensitivity and the addition of probes like ddPCR, nor does it require multiple repetitions, which saves time, effort, and cost. It is also not affected by high GC regions, and the detection results are accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0050] Figure 1 This is the IGV spectrum of three samples: peripheral blood, oral swab and semen. The order of samples from top to bottom is peripheral blood, oral swab and semen;

[0051] Figure 2 The results of Sanger sequencing; the position indicated by the red arrow is: chr8:144811464, and the position indicated by the green arrow is: chr8:144945875;

[0052] Figure 3 Provide sanger sequencing maps for third parties;

[0053] Figure 4 It is an agarose gel electrophoresis diagram, note: M: DL2000; Lane 1: product targeted and enriched by the primers of this application; Lane 2: product targeted and enriched by conventional primers; Lane 3: blank control;

[0054] Figure 5 It is the electrophoresis diagram of GJB2 gene, note: M: DL2000; Lane 1: product enriched by primer targeting of the present application; Lane 2: product enriched by conventional primer targeting. DETAILED DESCRIPTION

[0055] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail below. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0056] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0057] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0058] In this article, the explanations of the English abbreviations involved are as follows:

[0059] SNV: single nucleotide variant;

[0060] SNP: single nucleotide polymorphism;

[0061] Indel: insertion or deletion, insertion or deletion.

[0062] One embodiment of the present application provides a primer pair for constructing a chimera library, which primer pair includes an upstream primer and a downstream primer; the sequence of the upstream primer includes a first universal primer sequence and a specific upstream primer sequence designed according to the target from the 5' end to the 3' end; the sequence of the downstream primer includes a second universal primer sequence and a specific downstream primer sequence designed according to the target from the 5' end to the 3' end.

[0063] In a specific example, the first universal primer sequence and the second universal primer sequence are selected from part or all of the sequencing platform adapter sequence.

[0064] In a specific example, the sequencing platform includes the BGI sequencing platform or the Illumina sequencing platform. The universal primer sequence in the primer of the present application can be combined with the sequencing primer of the platform to perform sequence sequencing.

[0065] In a specific example, the second universal primer sequence contains a barcode sequence for distinguishing different samples.

[0066] In a specific example, the length of the barcode sequence is 6 bp to 12 bp. Optionally, the length of the barcode sequence is 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, or a range between any two of the above values.

[0067] In a specific example, the first universal primer sequence includes GAACGACATGGCTACGATCCGACTT (SEQ ID NO: 1), and the second universal primer sequence includes TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 2).

[0068] In a specific example, the first universal primer sequence includes AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 3), and the second universal primer sequence includes CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (SEQ ID NO: 4).

[0069] In a specific example, NNNNNNNNNN is a barcode sequence, wherein each N independently represents a base A, C, G or T / U.

[0070] In a specific example, the target position corresponding to the last base of the 3' end of the specific upstream primer sequence and the specific downstream primer sequence cannot be a SNP site. This can prevent amplification from being disconnected or the amplification uniformity of the two chains being inconsistent, resulting in inaccurate test results or false negatives, and inaccurate judgment of the chimerism ratio.

[0071] In a specific example, the target position corresponding to the last 4 bases at the 3' end of the specific upstream primer sequence and the specific downstream primer sequence cannot be a variant site. Alternatively, the target position corresponding to the last 4 bases at the 3' end of the specific upstream primer sequence and the specific downstream primer sequence cannot be a SNP site.

[0072] In a specific example, the lengths of the specific upstream primer sequence and the specific downstream primer sequence are 18bp to 38bp, respectively; optionally, the lengths of the specific upstream primer sequence and the specific downstream primer sequence are 18bp, 19bp, 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, 35bp, 38bp, respectively, or a range between any two of the above values.

[0073] In a specific example, the length of the amplicon obtained by the specific upstream primer sequence and the specific downstream primer sequence is 100bp to 600bp. Optionally, the length of the amplicon obtained by the specific upstream primer sequence and the specific downstream primer sequence is 100bp, 150bp, 200bp, 250bp, 300bp, 350bp, 400bp, 400bp, 450bp, 500bp, 550bp, 600bp, or a range between any two of the above values. Due to the short amplicon, the purpose of lower data volume and ultra-high depth is achieved.

[0074] In a specific example, the Tm value of the specific upstream primer sequence or the specific downstream primer sequence is 55° C. to 80° C. Optionally, the Tm value of the specific upstream primer sequence or the specific downstream primer sequence is 55° C., 57° C., 58° C., 60° C., 62° C., 65° C., 67° C., 68° C., 69° C., 70° C., 71° C., 72° C., 75° C., 78° C., 80° C., or a range between any two of the above values.

[0075] In a specific example, in high GC region chimera detection, the Tm value of the specific upstream primer sequence and the specific downstream primer sequence is 67°C to 80°C, preferably, the Tm value of the heterosexual upstream primer sequence and the specific downstream primer sequence is 67°C to 72°C.

[0076] It should be noted that primer design for non-high GC content region chimera detection can also be performed in the same manner as high GC content region detection, thus satisfying both conventional GC content chimera detection and high GC region chimera detection.

[0077] In a specific example, the Tm value of the specific upstream primer sequence differs from that of the specific downstream primer sequence by no more than 5°C, optionally, by no more than 2°C, optionally, by no more than 1°C.

[0078] In a specific example, when the chimera is a SNVs or Indels chimera, the distance between the variant position and the first base of the 5' end of the specific upstream primer sequence or the specific downstream primer sequence is 50bp to 300bp, optionally, the distance is 50bp, 80bp, 100bp, 150bp, 300bp, or a range between any two of the above values.

[0079] Exemplarily, the specific upstream primer sequence includes GAAGAGCACAGTGAGCAAAGATTA, and the specific downstream primer sequence includes TTAGGAACATTCAGTCAAGGGTAT.

[0080] Exemplarily, the specific upstream primer sequence includes GCAGGATGTAGACTGGGACCCGA, and the specific downstream primer sequence includes GCTTGTTTCACAGTGGTCGTGGGTG.

[0081] Exemplarily, the specific upstream primer sequence includes TGGGACCCGCCCTGCTTTCT, and the specific downstream primer sequence includes CTGCCTCCTCCCATACTTGGCTCTATT.

[0082] Exemplarily, the specific upstream primer sequence includes TGCCGTAGTCCGAGCCCGAG, and the specific downstream primer sequence includes CGGCCATCTCCGTGGGCA.

[0083] Exemplarily, the specific upstream primer sequence includes GCCCTGCGAGCTATTTGAAAGTGA, and the specific downstream primer sequence includes CCGCAGCACCAGCCACCTACTC.

[0084] Exemplarily, the specific upstream primer sequence includes ACATCGGCGACACCACAAACCTC, and the specific downstream primer sequence includes CCACGGCGGGAGACAGGTGTT.

[0085] Conventional primer design generally requires that the GC content of the upstream primer and the downstream primer should be maintained at a similar level, and the primer GC should be between 40% and 60%. The primers designed in this application have no special requirements for the GC content, which can be greater than 60% or 65%, or less than 40%, or even close to 20%; the GC content in the upstream and downstream primers can differ by about 10%, or greater than 10%, or even greater than 18%.

[0086] The primer of the present application may contain more than 6 consecutive identical bases or the last 4 bases at the 3' end may be ≥3 consecutive identical bases, and the last base at the 3' end may be any one of A, T, C and G.

[0087] One embodiment of the present application also provides a method for constructing a chimera library, which includes the step of performing PCR amplification using the primer combination.

[0088] In one specific example, one-step PCR amplification is used for library construction.

[0089] In a specific example, the PCR amplification program includes pre-denaturation at 94°C to 95°C for 2min to 5min; denaturation at 95°C to 98°C for 12s to 15s, annealing at 58°C to 72°C for 12s to 15s, extension at 68°C to 72°C for 30s / Kb, and 30-40 cycles.

[0090] In a specific example, annealing and extension are combined into one step in the PCR amplification procedure; optionally, the temperature of annealing and extension after combining into one step is 68° C. to 72° C., and the time is 25s to 35s.

[0091] In a specific example, the PCR amplification system includes a buffer, dNTPs, a DNA polymerase, an upstream primer, and a downstream primer.

[0092] In a specific example, the PCR amplification system further includes DMSO and / or betaine.

[0093] One embodiment of the present application also provides a kit for detecting chimeras, comprising the primer combination.

[0094] In a specific example, the kit further comprises one or more of a nucleic acid extraction reagent, a PCR amplification reagent, and a negative control. In a specific example, the PCR amplification reagent comprises one or more of a buffer, dNTPs, and a DNA polymerase. Optionally, the DNA polymerase comprises a high-fidelity enzyme.

[0095] In order to improve the detection sensitivity and specificity, high-fidelity enzymes were used to enrich the target region and negative controls were added to perform quality control on lower chimerism ratios.

[0096] In a specific example, the test sample includes one or more of peripheral blood, semen, urinary tract exfoliated cells, and oral mucosal epithelial cells.

[0097] One embodiment of the present application also provides the use of the primer set in preparing a product for chimera detection.

[0098] In a specific example, mosaicism detection includes one or more of distinguishing between de novo variants and mosaic variants, distinguishing between types of mosaic variants, or clarifying mosaicism ratios.

[0099] In a specific example, the mosaic includes one or more of SNVs, Indels, and CNV mosaics.

[0100] In a specific example, the chimera includes one or more of germ chimera and somatic chimera.

[0101] One embodiment of the present application also provides a chimera detection method, which comprises constructing a library using the chimera library construction method;

[0102] In a specific example, the method further comprises the step of sequencing the library. It can be used for on-board sequencing on the BGI platform or on-board sequencing on the Illumina platform. It is understandable that other detection methods or platforms may also be applicable.

[0103] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0104] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0105] The samples involved in the following embodiments include peripheral blood, semen, urinary tract exfoliated cells or oral mucosal epithelial cells.

[0106] The following experimental procedures are involved in the examples:

[0107] gDNA was extracted from peripheral blood, semen, urinary tract exfoliated cells or oral mucosal epithelial cells using nucleic acid extraction or purification reagents [Susu Medical Equipment No. 20210902].

[0108] The following examples are designed according to the following principles:

[0109] The targeted enrichment primers consist of a universal sequence at the 5' end and a specific sequence at the 3' end.

[0110] a. Universal primer

[0111] The universal sequence at the 5' end of the upstream primer is GAACGACATGGCTACGATCCGACTT, and the universal sequence at the 5' end of the downstream primer is TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT. That is, the upstream primer sequence is GAACGACATGGCTACGATCCGACTT+specific sequence; the downstream primer sequence is TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT+specific sequence; or,

[0112] The universal sequence at the 5' end of the upstream primer is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, and the universal sequence at the 5' end of the downstream primer is CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC. That is, the upstream primer sequence is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT+specific sequence; the downstream primer sequence is CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC+specific sequence. NNNNNNNN represents the barcode sequence, which is used to distinguish different samples.

[0113] b. Specific primers

[0114] The specific primer sequence selects several sequences upstream and downstream of the gene and its special variation site for primer design, and uses the website https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome and https: / / www.ncbi.nlm.nih.gov / variation / view / to perform primer specificity analysis and avoid the SNP site at the last base of the 3' end of the primer. The specific primer sequence amplicon length is 100bp-600bp. When detecting SNVs and Indels chimeras, the variation position must be within 50bp, 100bp, 150bp and 300bp from the first base of the 5' end of the upstream primer or the downstream primer. The variation position of Example 1 is 77bp away from the first base of the 5' end of the upstream primer, the variation position of Example 3 is 66bp away from the first base of the 5' end of the downstream primer, and the variation position of Example 4 is 75bp away from the first base of the 5' end of the upstream primer).

[0115] Primer Tm calculation based on Salt Adjusted method or primer design and primer Tm calculation based on Primer5 or using https: / / crm.vazyme.com / cetool / tmcal.html, primer Tm value is 55℃-80℃, wherein in high GC region, primer Tm value is 67℃-80℃, preferably 67℃-72℃. PCR amplification annealing temperature and extension temperature can be combined into one, and the same temperature is used for PCR amplification cycle, and the annealing temperature and extension temperature are both 68℃-72℃. The difference between upstream and downstream primer Tm is no more than 2℃, preferably no more than 1℃.

[0116] The GC content of the primers is 20% to 80%, and the GC content of the upstream and downstream primers differs by 0% to 30%.

[0117] More than 6 consecutive identical bases may appear in the primer, or the last 4 bases at the 3' end may be ≥3 consecutive identical bases, and the last base at the 3' end may be any one of A, T, C and G.

[0118] The chimera detection method in the following examples:

[0119] 1. Targeted enrichment of target region - library construction (one-step library construction)

[0120] a) Use gDNA as template for regional targeted enrichment. Prepare the amplification reaction mix on an ice box according to Table 1:

[0121] Table 1

[0122] Components Volume (μL) Buffer 12.5 dNTP Mix (10 mM each) 0.5 DNA Polymerase 0.5 F Primer 1 R Primer 1 gDNA (20ng-50ng) X Nuclease-free water 9.5-X Total volume 25

[0123] b) Vortex to mix and centrifuge briefly.

[0124] c) Place the above PCR tube on the PCR instrument, select "105°C" for "Hot Cover", tighten the hot cover, and it is recommended to set the reaction parameters according to Table 2:

[0125] Table 2

[0126]

[0127] Wherein, the reaction parameters of Example 1 are:

[0128] 95℃ 3min; 95℃ 15s, 60℃ 15s, 72℃ 30s, 30 cycles; 4℃ hold.

[0129] Reaction parameters of Examples 2 to 4:

[0130] 94℃ 3min;

[0131] 98℃ 10s, 68℃ 30s, 30 cycles; 4℃ hold.

[0132] 2. Enrichment product purification - library purification

[0133] Add AMPure XP magnetic beads to the targeted enrichment product at 1.8× volume, mix with a gun, leave at room temperature for 5 minutes, place on a magnetic stand, wait for the liquid to become clear, remove the supernatant, wash with 200 μL of 70% alcohol, repeat once, dry the magnetic beads at room temperature, resuspend the magnetic beads with 25 μL Low TE, and elute the DNA. Quantification was performed using the Qubit dsDNA HS Assay Kit.

[0134] On the sequencing machine, select the appropriate sequencing method to sequence the library according to the size of the amplicon.

[0135] In the following examples, chimera ratio = variant reads / total reads.

[0136] Example 1 Family Indel Mosaic Detection

[0137] A family that had undergone WES (Whole Exome Sequencing) testing was recruited and the child was found to have NM_001845.4(COL4A1):c.3508_3523del.

[0138] After sanger sequencing, the gDNA in the blood of both men and women was detected and it was found that the female variant site was wild type, and the male was suspected of having a low-proportion mosaic variant of NM_001845.4:c.3508_3523del. Therefore, it is necessary to re-test the variant site to determine the authenticity and proportion of the mosaicism. Peripheral blood, oral swab and semen samples are now taken from the male. This detection method is used for detection and verification. Three different types of sample genomic DNA from the male were extracted using nucleic acid extraction or purification reagents [Su Su Medical Preparation No. 20210902]. For details of the subsequent experiments using this application, see the above experimental work flow details.

[0139] The primer sequences for one-step library construction are shown in Table 3:

[0140] Table 3

[0141]

[0142] Note: The underlined sequence is the barcode sequence, which is used to distinguish different samples; the bold part is the specific sequence.

[0143] The test results are shown in Table 4:

[0144] Table 4

[0145]

[0146] The IGV spectra of the three samples are shown in Figure 2. Figure 1 As shown, there is mosaicism in three different types of sample deletions.

[0147] Example 2: CNV germline mosaicism detection in a family

[0148] A family was recruited, and both of the two children had a deletion in the 8q24.3 region. Whole genome sequencing revealed that the deletion region ranged from chr8:144810001 to 144950000, so it was suspected that the male partner might have gonadal mosaicism. Therefore, this detection method was used to test and verify the male partner's semen sample to determine whether there was gonadal mosaicism and the proportion of mosaicism.

[0149] Since the whole gene sequencing gave the approximate breakpoints, GAP-PCR (primers such as F and GAP-R in Table 5) was used to accurately detect the breakpoints. After Sanger sequencing, the precise breakpoints were chr8:144811465 and chr8:144945874. The Sanger sequencing results are as follows Figure 2 shown.

[0150] The precise breakpoints were known, and the one-step library construction of the present application was further adopted for next-generation sequencing. The chimerism ratio was determined according to the sequencing results. The chimerism ratio of this sample was about 32% ((29228237-19675996) / 29228237).

[0151] The primer sequences for constructing the one-step library of this application are shown in Table 5:

[0152] Table 5

[0153]

[0154] Note: The underlined sequence is the barcode sequence, which is used to distinguish different samples; the bold part is the specific sequence.

[0155] Example 3 Family SNV germline mosaicism detection

[0156] One family was recruited, and the child had compound heterozygosity of ADA gene. Sanger sequencing was detected in the blood gDNA of both men and women, and it was found that one of the heterozygous variants came from the female, and the other heterozygous site NM_000022:c.704G>A, and neither the male nor the female was wild-type. The specific Sanger sequencing map of the third party is as follows Figure 3Therefore, it is necessary to determine whether the variation is new or male gonadal mosaicism. Therefore, the detection method of this application is used to test and verify the male's peripheral blood and semen samples to determine whether the variation is new or male gonadal mosaicism and the mosaicism ratio.

[0157] The primer sequences for one-step library construction in this application are shown in Table 6:

[0158] Table 6

[0159]

[0160] Note: The underlined sequence is the barcode sequence, which is used to distinguish different samples; the bold part is the specific sequence.

[0161] The one-step library construction of the present application was followed by next generation sequencing. According to the sequencing results, the male partner did not have somatic mosaicism, but his semen sample had gonadal mosaicism, and the mosaicism ratio was 4.98% (16570 / 332721).

[0162] Example 4: Family SNV Germline Mosaicism Detection

[0163] One family was recruited, and the child had the NKX2-1 gene NM_001079668.3:c.1090_1091delGC. Sanger sequencing was performed in the blood gDNA of both men and women, and it was found that neither of them had the wild type. Therefore, it was necessary to determine whether the variation was new or the male had gonadal mosaicism. Therefore, the detection method of this application was used to detect and verify the male's semen sample to determine whether the variation was new or the male had gonadal mosaicism and the chimerism ratio.

[0164] The primer sequences for one-step library construction in this application are shown in Table 7:

[0165] Table 7

[0166]

[0167] Note: The underlined sequence is the barcode sequence, which is used to distinguish different samples; the bold part is the specific sequence.

[0168] The one-step library construction of this application was followed by next-generation sequencing. According to the sequencing results, there was no gonadal mosaicism in the male's semen sample (sequencing depth 511347).

[0169] Example 5 Sensitivity Test

[0170] Two genomic DNAs of the same batch with known genotypes of 5 SNP sites were quantified using Qubit3 and mixed at mass ratios of 9:1, 99:1, 999:1 and 1:0, respectively, as test samples 1, 2, 3 and 4, to simulate chimeric DNA of different proportions for sensitivity testing. The sequencing depth was greater than 100,000X. The specific results are as follows:

[0171] Table 8

[0172]

[0173] According to simulations with different proportions, chimerism ratios of 10%, 1% and 0.1% can all be effectively detected, and even lower ratios can be effectively detected. However, due to certain systematic errors in DNA polymerase and high-throughput sequencing, the accurate judgment of extremely low ratio chimerism is interfered with. Therefore, considering the accuracy and reliability of the test and the establishment of subsequent guidance, the sensitivity of this test is 1%.

[0174] Comparative Example 1

[0175] The content is roughly the same as that of Example 4, except that the specific primer sequence (bold part):

[0176] Upstream primer: SEQ ID NO: 17;

[0177] Downstream primer: SEQ ID NO:18.

[0178] The features of the primer designs of Example 4 and Comparative Example 1 are shown in Table 9:

[0179] Table 9

[0180]

[0181] Primer dimer: high Tm value, high temperature one-step annealing / verification, conventional primers require the absolute value of dimer Gibbs free energy to be less than 10 Kcals / mol, while the absolute value of primer dimer Gibbs free energy in Example 4 can be greater than 10 Kcals / mol.

[0182] The target region was targeted and enriched, and the quality was checked by agarose gel electrophoresis and Qubit. The concentration of the product targeted and enriched by the primers of the present application was 20.3 ng / μL, and the concentration of the product targeted and enriched by the conventional primers was 1.63 ng / μL. The results of agarose gel electrophoresis were as follows: Figure 4 As shown in the figure, in comparative example 1, the targeted enrichment failed and the sequencing could not be performed on the machine.

[0183] Comparative Example 2

[0184] The method of the present application was used to perform mosaic detection of related mutations in the DOK7 gene and the GJB2 gene (e.g., the DOK7 gene is a SNVs mutation: NM_173660.5: c.28del, and the GJB2 gene is a SNVs mutation: NM_004004.5: c.-23+1G>A). The method of the present application and the conventional method were used for comparative analysis of the detection. The specific information is as follows:

[0185] Table 10

[0186]

[0187] The target area was targeted for enrichment, and the quality was checked by agarose gel electrophoresis and Qubit. The specific quality inspection results are as follows:

[0188] Table 11

[0189]

[0190] The electrophoresis diagram of GJB2 gene is as follows Figure 5 shown.

[0191] According to the conventional primer design method, high GC and disconnection are not considered during primer design; if the GC content is greater than 70%, it is very easy to fail to amplify; the variant site is located in the SNP site dense area, which is very easy to disconnect, resulting in failure to judge the result. According to the primer design method of this application, the amplification success rate of Sanger sequencing verification for the high GC region of the WES test result can reach 100%.

[0192] In addition, the average sequencing depth of the method of the present application is greater than 1000X the required data volume: 0.001M; the library construction time of the present application takes 1h to 1.5h, and the library construction cost is low.

[0193] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0194] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description may be used to interpret the content of the claims.

Claims

1. A primer combination for constructing a chimera library, characterized in that: In the primer combination, The sequence of the upstream primer includes a first universal primer sequence and a specific upstream primer sequence designed according to the target from the 5' end to the 3' end; The sequence of the downstream primer includes the second universal primer sequence and the specific downstream primer sequence designed according to the target from the 5' end to the 3' end; Wherein, the first universal primer sequence and the second universal primer sequence are selected from part or all of the sequencing platform adapter sequence.

2. The primer combination according to claim 1, characterized in that The second universal primer sequence contains a barcode sequence for distinguishing different samples; Optionally, the length of the barcode sequence is 6 bp to 12 bp.

3. The primer combination according to claim 1 or 2, characterized in that: The sequencing platform includes the BGI sequencing platform or the Illumina sequencing platform; Optionally, the first universal primer sequence includes GAACGACATGGCTACGATCCGACTT, and the second universal primer sequence includes TGTGAGCCAAGGAGTTG-barcode sequence-TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT; Optionally, the first universal primer sequence includes AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, and the second universal primer sequence includes CAAGCAGAAGACGGCATACGAGAT-barcode sequence-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC.

4. The primer combination according to claim 1 or 2, characterized in that: The target position corresponding to the last base at the 3' end of the specific upstream primer sequence and the specific downstream primer sequence cannot be a SNP site; Optionally, the target position corresponding to the last 4 bases at the 3' end of the specific upstream primer sequence and the specific downstream primer sequence cannot be a SNP site; Optionally, the lengths of the specific upstream primer sequence and the specific downstream primer sequence are 18 bp to 38 bp respectively; Optionally, the length of the amplicon amplified by the specific upstream primer sequence and the specific downstream primer sequence is 100 bp to 600 bp; Optionally, the GC content of the specific upstream primer sequence or the specific downstream primer sequence is 20% to 80%; Optionally, the GC content of the specific upstream primer sequence differs from that of the specific downstream primer sequence by 0% to 30%; Optionally, the Tm value of the specific upstream primer sequence or the specific downstream primer sequence is 55° C. to 80° C.; Optionally, the Tm value of the specific upstream primer sequence and the specific downstream primer sequence is 67° C. to 80° C.; Optionally, the Tm value of the specific upstream primer sequence and the specific downstream primer sequence is 67° C. to 72° C.; Optionally, the Tm value difference between the specific upstream primer sequence and the specific downstream primer sequence does not exceed 5°C, optionally, does not exceed 2°C, optionally, does not exceed 1°C.

5. The primer combination according to claim 4, characterized in that: When the chimera is a SNVs or Indels chimera, the distance between the variant position and the first base at the 5' end of the specific upstream primer sequence or the specific downstream primer sequence is 50 bp to 300 bp.

6. A method for constructing a chimera library, characterized in that: The method comprises the step of performing PCR amplification using the primer combination described in any one of claims 1 to 5.

7. The method according to claim 6, characterized in that One-step PCR amplification was used for library construction.

8. The method according to claim 6 or 7, characterized in that: The PCR amplification procedure includes pre-denaturation at 94°C~95°C for 2min~5min; denaturation at 95°C~98°C for 12s~15s, annealing at 58°C~72°C for 15s, extension at 68°C~72°C for 30s / Kb, and 30-40 cycles; Optionally, in the PCR amplification procedure, annealing and extension are combined into one step; Optionally, the temperature of the annealing extension after the one-step process is 68-72°C.

9. The method according to claim 6 or 7, characterized in that: The PCR amplification system includes one or more of a buffer, dNTPs, a DNA polymerase, the upstream primer and the downstream primer.

10. A kit for detecting chimeras, characterized in that: The kit comprises the primer combination described in claims 1 to 5; Optionally, it further includes one or more of a nucleic acid extraction reagent and a PCR amplification reagent; Optionally, the PCR amplification reagent includes a buffer, dNTPs, and a DNA polymerase; Optionally, the DNA polymerase comprises a high-fidelity enzyme; Optionally, the test sample includes one or more of peripheral blood, semen, urinary tract exfoliated cells and oral mucosal epithelial cells.

11. Use of the primer combination according to any one of claims 1 to 5 in preparing a product for chimera detection; Optionally, the mosaicism detection includes one or more of distinguishing between de novo variants and mosaic variants, distinguishing between types of mosaic variants, or clarifying mosaicism ratios; Optionally, the chimera includes one or more of SNVs, Indels and CNV chimeras; Optionally, the chimera comprises one or more of reproductive chimera and somatic cell chimera.

12. A chimera detection method, characterized in that: The method comprises constructing a library using the chimera library construction method described in any one of claims 6 to 9; Optionally, the method further comprises the step of sequencing the library.

Images