Target spot and method for reducing LmrS efflux activity, LmrS activity inhibitor and application

Abstract

The invention discloses a target and a method for reducing the efflux activity of LmrS, an LmrS activity inhibitor and application, N29 and Q30 of a multi-drug efflux pump LmrS are key amino acids influencing the efflux activity of the LmrS, the 29th N and / or 30th amino acid Q of TM1 of the LmrS are / is taken as the target, and the efflux activity of the LmrS to antibiotics can be reduced by singly or jointly mutating the N29 and the Q30 into non-polar amino acids. In addition, the invention further provides a traditional Chinese medicine plant source compound inhibitor targeting the N29 or Q30 target spot of the LmrS, the efflux activity of the LmrS to antibiotics can be reduced, the inhibitor can serve as an adjuvant of the antibiotics to improve the drug sensitivity of staphylococcus aureus to the corresponding antibiotics, then the cure rate of staphylococcus aureus infection is increased, and the traditional Chinese medicine plant source compound inhibitor is suitable for being further applied and popularized.

Description

Technical Field

[0001] The invention belongs to the field of biology, and specifically relates to a target point and method for reducing the efflux activity of LmrS, and an LmrS activity inhibitor and application thereof. Background Art

[0002] With the discovery and widespread use of antimicrobial drugs, the emergence and spread of drug-resistant pathogens have become a major public health problem. Staphylococcus aureus (S. aureus) is an infectious pathogen that widely infects humans and animals and is most prone to drug resistance. At present, the bovine milk-derived S. aureus isolated in my country is generally multi-drug resistant. Studies have shown that most isolates in my country are resistant to more than five drugs, and 90% of the strains carry drug-resistant genes, including zoonotic strains of various genotypes. Severely drug-resistant bovine milk-derived S. aureus poses a serious threat to public health security and causes huge economic losses to my country's dairy farming industry every year.

[0003] The rich and diverse drug resistance mechanisms of Staphylococcus aureus make it resistant to almost all antimicrobial drugs currently in use. Drug efflux pumps have attracted widespread attention because they can efflux a variety of drugs with different structures. The multidrug efflux pump LmrS (lincomycin resistance protein of S. aureus) carried by Staphylococcus aureus can efficiently efflux a variety of antimicrobial drugs with different structures, and calcium ions (Ca 2+ ) significantly enhances its efflux activity and has attracted attention. 2+ LmrS, which enhances efflux activity, works together with nonspecific resistance mechanisms such as biofilm formation and membrane permeability changes to reduce the concentration of some types of drugs in the bacteria to sublethal levels, forming simple resistant strains that are resistant to a small number of drugs; in addition to this effect, in strains carrying resistance genes, LmrS works together with these specific resistance mechanisms to further increase the drug sensitivity threshold of the strain and form multidrug-resistant strains. 2+ In the environment, LmrS may promote the formation and development of clinical drug resistance and drug resistance mechanisms of bovine milk-derived Staphylococcus aureus. Efflux pump inhibitors are considered as potential tools to restore the efficacy of antimicrobial therapy. By analyzing the key amino acids in the substrate binding domain of LmrS that interact with the substrate and cause conformational changes in efflux activity, the essential chemical groups of the substrate can be revealed, thereby guiding the screening or derivatization of efflux pump inhibitors from plant-derived natural compounds for the treatment of clinical mastitis. Summary of the invention

[0004] In view of the above problems, the present invention provides a target and method for reducing the efflux activity of LmrS, and an LmrS activity inhibitor and application.

[0005] The present invention is achieved through the following technical solutions:

[0006] A target for reducing the efflux activity of LmrS, wherein the target for reducing the efflux activity of LmrS is the 29th and / or 30th amino acid of TM1 of LmrS.

[0007] As a possible implementation manner, further, the 29th amino acid of TM1 of the LmrS is N, and the 30th amino acid of TM1 of the LmrS is Q.

[0008] The present invention also provides a method for reducing the efflux activity of LmrS, wherein the 29th amino acid N and / or the 30th amino acid Q of TM1 of the LmrS are mutated into non-polar amino acids.

[0009] Based on the above, the present invention provides a LmrS activity inhibitor, which targets the above target.

[0010] As a possible implementation manner, further, the LmrS activity inhibitor may be any one of Bryophyllin A and its derivatives, 3-Epicabraleadiol and its derivatives, Pseudojervine and its derivatives.

[0011] The LmrS activity inhibitor can be used to inhibit the efflux activity of LmrS, reduce the efflux activity of LmrS to antibiotics, and prepare drugs for treating Staphylococcus aureus infection. The antibiotics include lincomycin hydrochloride, kanamycin sulfate, and fusidic acid.

[0012] The beneficial effects of the invention are:

[0013] N29 and Q30 of the multidrug efflux pump LmrS provided by the present invention are key amino acids that affect its efflux activity. Single or combined mutations of N29 and Q30 to non-polar amino acids can reduce the efflux activity of LmrS to antibiotics. In addition, the present invention also provides a Chinese herbal plant-derived compound inhibitor targeting the N29 or Q30 target of LmrS, which can reduce the efflux activity of LmrS to antibiotics. The inhibitor can be used as an adjuvant of antibiotics to increase the drug sensitivity of Staphylococcus aureus to the corresponding antibiotics, thereby improving the cure rate of Staphylococcus aureus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The electrophoresis diagram of the LmrS gene fragment after PCR amplification; wherein, M: DNA molecular mass standard; 1: negative control; 2: LmrS gene PCR product.

[0015] Figure 2It is the double enzyme digestion identification of pET-32a(+)-LmrS; wherein, M: DNA molecular mass standard; 1: EcoR I and HindIII double enzyme digestion product, 2: EcoR I single enzyme digestion product, 3: Hind III single enzyme digestion product, 4: no enzyme digestion control.

[0016] Figure 3 SDS-PAGE analysis of LmrS protein expression; wherein, M: Marker; 1: BL21(DE3) / pET32a(+) / LmrS precipitate; 2: BL21(DE3) / pET32a(+) / LmrS supernatant; 3: BL21(DE3) / pET32a(+) precipitate; 4: BL21(DE3) / pET32a(+) supernatant; 5: BL21(DE3) precipitate; 6: BL21(DE3) supernatant.

[0017] Figure 4 Western Blot analysis of LmrS protein expression; M: Marker; 1: BL21(DE3) / pET32a(+) / LmrS supernatant; 2: BL21(DE3) / pET32a(+) / LmrS precipitate; 3: BL21(DE3) / pET32a(+) supernatant; 4: BL21(DE3) / pET32a(+) precipitate; 5: BL21(DE3) supernatant; 6: BL21(DE3) precipitate.

[0018] Figure 5 This is the sequencing result of N29-D.

[0019] Figure 6 This is the sequencing result of N29-S.

[0020] Figure 7 This is the sequencing result of N29-A.

[0021] Figure 8 This is the sequencing result of Q30-A.

[0022] Fig. 9 This is the sequencing result of Q30-E.

[0023] Fig.10 This is the sequencing result of Q30-S.

[0024] Fig.11 This is the sequencing result of Q30-N.

[0025] Fig.12 This is the sequencing result of N29Q30-SA.

[0026] Fig.13 This is the sequencing result of N29Q30-SS.

[0027] Fig.14 This is the sequencing result of N29Q30-AA.

[0028] Fig.15 This is the sequencing result of N29Q30-AS.

[0029] Fig.16 The efflux activity of the LmrS N29-A / S mutant was analyzed by ethidium bromide accumulation assay.

[0030] Fig.17 Ethidium bromide accumulation assay was used to analyze the efflux activity of the LmrS Q30-A / S mutant.

[0031] Fig.18 Ethidium bromide accumulation assay was used to analyze the efflux activity of the LmrS N29Q30-AA / SS combined mutant.

[0032] Fig.19 The efflux activity of LmrS N29-A / S mutant was analyzed by ethidium bromide efflux assay.

[0033] Fig. 20 The efflux activity of LmrS Q30-A / S mutant was analyzed by ethidium bromide efflux assay.

[0034] Fig.21 The efflux activity of LmrS N29Q30-AA / SS combined mutant was analyzed for ethidium bromide efflux assay.

[0035] Fig. 22 Construct the LmrS protein structure model for SWISS-MODEL.

[0036] Fig.23 Schematic diagram of the molecular docking of LmrS and 3-Epicabraleadiol based on AutoDockVina.

[0037] Fig.24 This is the 2D structure of the traditional Chinese medicine plant-derived compound 3-Epicabraleadiol.

[0038] Fig.25 The ethidium bromide accumulation assay was used to analyze the inhibitory activity of 3-Epicabraleadiol on LmrS efflux.

[0039] Fig.26 The ethidium bromide efflux assay was used to analyze the inhibitory activity of 3-Epicabraleadiol on LmrS efflux. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] The present invention provides a target for reducing the efflux activity of LmrS, wherein the target for reducing the efflux activity of LmrS is the 29th amino acid N (aspartic acid) and / or the 30th amino acid Q (glutamine) of Motif-D1 (TM1) in the LmrS substrate binding domain.

[0042] The present invention also provides a method for reducing the efflux activity of LmrS, wherein the 29th amino acid N and / or the 30th amino acid Q of TM1 of the LmrS are mutated into non-polar amino acids.

[0043] Based on the above, the present invention also provides an LmrS activity inhibitor, which targets the 29th amino acid N and / or the 30th amino acid Q of TM1 of LmrS, wherein the inhibitor can be selected from any one of BryophyllinA, 3-Epicabraleadiol (3-epicabraleadiol), and Pseudojervine.

[0044] Example 1: Construction and expression of the multidrug efflux pump LmrS recombinant plasmid

[0045] 1.1. Amplification of LmrS gene fragment

[0046] According to the sequence fragment of the multidrug efflux pump LmrS gene (JF803474.1) in GenBank, upstream and downstream primers were designed (see Table 1). The amplification system and conditions are shown in Table 2. The amplified products were electrophoresed using 1% agarose gel (see Figure 1 ), determine the fragment size (1443bp) and use Gel DNA Recovery Kit to cut and purify the gel, and the recovered target fragment is connected to the cloning vector Peasy-Blunt Simple. The connection system is shown in Table 3. After gently mixing, incubate at 25℃ for 5min, immediately put on ice, heat shock transform Trans1-T1 competent cells, pick 5 positive clones for sequencing, and compare and confirm that the sequence is completely consistent with the expected one.

[0047] Table 1 Primers for amplification of LmrS gene fragment

[0048]

[0049]

[0050] Table 2 LmrS gene PCR amplification system and reaction conditions

[0051]

[0052] Table 3 Peasy-Blunt Simple / LmrS connection system

[0053]

[0054] 1.2. Construction of LmrS protein expression plasmid

[0055] The Peasy-Blunt Simple / LmrS positive clones identified by sequencing were selected for amplification and culture, and plasmid DNA was extracted. Double restriction enzyme digestion was performed using EcoR I and Hind III, and the digested fragments were recovered and connected to pET-32a (+) (Wuhan Miaoling Biotechnology Co., Ltd.) that was also double-digested and recovered. The ligation product was transformed into DH5α, plated and cultured overnight, and a single colony was selected to extract the plasmid and use the restriction enzyme sites on it for restriction enzyme digestion identification (see Figure 2 ), pET-32a(+) / LmrS plasmid was extracted from the identified positive colonies and transformed into BL21(DE3) competent cells, single clone colonies were picked and the connected target fragments were amplified by colony PCR using pET-32a(+) universal primers, the amplified positive colonies were amplified and cultured under 100 μg / mL ampicillin pressure, the plasmid was extracted, double enzyme digestion was performed with EcoR I and HindIII, the positive plasmid was identified and the recombinant was sequenced again for verification.

[0056] 1.3. Expression identification of BL21(DE3) / pET-32a(+) / LmrS

[0057] 1.3.1. SDS-PAGE analysis of expression products

[0058] The BL21(DE3) / pET-32a(+) / LmrS strain that was completely consistent with the expected result was streaked. On the second day, a single colony was picked and inoculated into LB liquid and cultured at 37°C and 200 r / min.

[0059] When the OD value reaches 0.6, add IPTG to a final concentration of 0.5 mmol·L -1After 3-4 hours of cultivation, take the bacterial solution without IPTG as a negative control. The recovered bacterial solution was centrifuged to recover the precipitate, resuspended in PBS, and 200μL of lysis buffer was added for every 5mL of original culture volume, and lysed at room temperature for 10 minutes. Centrifuge at 12000rpm for 10 minutes to separate the supernatant and inclusion body precipitate. Take 20μL of the sample and vortex to mix with 5μL of loading buffer, and treat it at high temperature in a water bath for 10 minutes to prepare the protein electrophoresis sample for SDS-PAGE electrophoresis (12.5% ​​gel, set the separation gel electrophoresis voltage to 80V, and the protein electrophoresis voltage to 150V). The target protein (55Ku) expressed by the positive clone is not obvious, see Figure 3 .

[0060] 1.3.2、Identification of expression products by western-blot

[0061] The LmrS protein band expressed by BL21(DE3) / pET-32a(+) / LmrS was not obvious in SDS-PAGE electrophoresis analysis. To further confirm the expression of LmrS, western-blot was used to further identify the LmrS protein expressed by BL21(DE3) / pET-32a(+) / LmrS. The primary antibody was mouse anti-His tag protein monoclonal antibody. The LmrS protein expressed by BL21(DE3) / pET-32a(+) / LmrS was consistent with the expected value (55Ku). Since LmrS protein is a transmembrane protein embedded in the cell membrane of bacteria, it is expressed in the bacterial lysis precipitate. Figure 4 .

[0062] In summary, this example successfully constructed the pET-32a(+) / LmrS plasmid expressing the Staphylococcus aureus multidrug efflux pump protein LmrS gene; the expression strain BL21(DE3) was used to identify the expression of the multidrug efflux pump protein LmrS.

[0063] Example 2: Construction of LmrS mutants and their effects on antibiotic efflux activity The purpose of this example is to verify the hypothesis that "LmrS substrates are hydrophobic compounds that can form hydrogen bonds with amide groups (-CONH2)", to analyze the key amino acids in the LmrS substrate binding domain, and to analyze the groups in the substrate that can trigger the efflux activity of LmrS.

[0064] In this example, N29 and Q30 of Motif-D1 in the substrate binding domain of LmrS were mutated, and the changes in substrate efflux activity were compared to verify the above hypothesis, so it was necessary to mutate N29 and Q30 in the amino acid sequence of LmrS: N29-D (N29-D means that the 29th amino acid N is changed to D), N29-S, N29-A, Q30-A, Q30-E, Q30-S, Q30-N, N29Q30-SA (N29Q30-SA means that the 29th amino acid N is changed to S, and the 30th amino acid Q is changed to A), N29Q30-SS, N29Q30-AA, N29Q30-AS, to construct LmrS mutants. The gene sequence was fused and cloned into the Nco I and Pml I positions of the vector pet32a (+) / LmrS using the PCR method.

[0065] Taking N29-D as an example, the construction of LmrS mutant is introduced.

[0066] 2.1. Nucleotide sequences upstream and downstream of the mutation site

[0067] The sequence to be mutated was fused into the Nco I and Pml I positions of pet32a(+) / LmrS using the PCR method. The sequence is as follows:

[0068] CCATGG CTGATATCGGATCCGAATTCATGATGGCTAAAGTTGA

[0069] ATTAACAACCCGGAGACGAAACTTCATAGTTGCTGTTATGTTTGAT

[0070] TAGTGCGTTTGTAGCTATTTTAGACCAAACATTATTAAATACAGC

[0071] GTTACCTAGTATAATGAGAGAATTAAATATTAATGAAAGTACATC

[0072] GCAATGGCTAGTTACTGGGTTTATGCTTGTTAATGGCGTCATGAT

[0073] ACCTCTGACGGCATATCTAATGGATAGGATTAAAACTAGACCTTT

[0074] ATACTTAGCAGCGATGGGGACATTTTTATTAGGTTCTATTGTTGC

[0075] AGCCTTAGCTCCGAATTTTGGAGTTTTAATGTTAG CACGTG

[0076] Primers were designed according to the above nucleotide sequences. Ten segments were required to construct each mutation. The primers designed in segments 1-3 and 5-10 were universal primers for constructing 11 mutants, named CS_1, CS_2, CS_3, CS_5, CS_6, CS_7, CS_8, CS_9, and CS_10. The primers in segment 4 were specific according to the mutated amino acids, named primer_N29-D, primer_N29-S, primer_N29-A, primer_Q30-A, primer_Q30-E, primer_Q30-S, primer_Q30-N, primer_N29Q30-SA, primer_N29Q30-SS, primer_N29Q30-AA, primer_

[0077] N29Q30-AS, see Table 4.

[0078] Table 4 Primers for constructing LmrS mutants

[0079]

[0080]

[0081] Taking the construction of N29-D as an example, the PCR reaction system is shown in Tables 5 and 6. The reaction conditions are 95℃ pre-denaturation for 3min; 95℃ denaturation for 25s, 60℃ annealing for 25s, 72℃ extension for 40s, a total of 25 cycles; 72℃ insulation for 1min, and maintained at 10℃ after the reaction is completed. 10μL of PCR reaction product was identified by agarose gel electrophoresis, connected to Nco I and Pml I in pet32a(+) / LmrS and sequenced.

[0082] Table 5 Full-length PCR one-round reaction system

[0083]

[0084]

[0085] Table 6 Full-length PCR second round reaction system

[0086]

[0087] 2.2. Base sequence of LmrS mutant site

[0088] The constructed pet32a(+) / LmrS mutant pet32a(+) / LmrS' was sequenced for LmrS', focusing on the base sequences of the mutation sites, N29-D, N29-S, N29-A, Q30-A, Q30-E, Q30-S, Q30-N, N29Q30-SA, N29Q30-SS, N29Q30-AA, N29Q30-AS. Sequencing showed that the mutation was successful. Figure 5 , Figure 6 , Figure 7 , Figure 8 , Fig. 9 , Fig.10 , Fig.11 , Fig.12 , Fig.13 , Fig.14 and Fig.15 .

[0089] 2.3. Base sequence of LmrS mutant site

[0090] The N29, Q30 single-point and combined mutant strains of BL21(DE3) / pET-32а(+), BL21(DE3) / pET-32а(+) / LmrS and LmrS were streaked on ampicillin-resistant LB culture plates, and single colonies were picked and inoculated into 1.5 mL of ampicillin-resistant LB liquid medium. The culture was cultured at 37°C and 200 r / min until the OD value was 0.6. IPTG was added to a final concentration of 0.8 mmol·L and cultured for 3-4 h. Two plates were centrifuged at 8000×g, and the cells were suspended and washed by centrifugation twice with 5 volumes of sterile MH(B). The cells were diluted to 0.5 McFarland turbidity using normal MH(B) medium. The minimum inhibitory concentrations (MICs) of lincomycin hydrochloride, kanamycin sulfate and fusidic acid against the above strains were determined by microbroth dilution method according to CLSI standards (CLSI, 2023). Three replicates were made for each strain and each antibiotic. Finally, the 96-well plate was covered and placed in a 37°C, CO2 constant temperature incubator for 20 h. The bacterial growth was observed and its MICs were recorded.

[0091] The results showed that compared with the BL21(DE3) / pET32a(+) strain, the MICs of lincomycin hydrochloride, kanamycin sulfate and fusidic acid against BL21(DE3) / pET-32а(+) / LmrS increased by 1 times, that is, the drug resistance increased by 1 times; the MICs values ​​of the tested antibiotics against the LmrS strains carrying single-point and combined mutations of N29 and Q30 were consistent with those of the control strain BL21(DE3) / pET32a(+), indicating that the mutation reduced the efflux activity of LmrS, see Table 7.

[0092] Table 7 Effects of amino acid mutations on the activity of the multidrug efflux pump LmrS

[0093]

[0094] In summary, in this example, the segmented PCR method was used to perform single or combined mutations on the coding nucleotides of the target amino acids N29 and Q30 at the Nco I and Pml I positions in pet32a(+) / LmrS, and 11 LmrS mutants were constructed. The MICs of lincomycin hydrochloride, kanamycin sulfate, and fusidic acid against strains carrying LmrS and N29 and Q30 mutants were tested, confirming that the mutations reduced the efflux activity of LmrS.

[0095] Example 3: Effects of key amino acid mutations on LmrS efflux activity

[0096] In this example, the hypothesis that "the LmrS substrate is a hydrophobic compound that can form a hydrogen bond with an amide group (-CONH2)" was verified. The key amino acids in the LmrS substrate binding domain were analyzed, and the groups in the substrate that can trigger the efflux activity of LmrS were analyzed. N29 and Q30 of Motif-D1 in the substrate binding domain of LmrS were mutated, and 11 mutants were constructed. Ethidium bromide accumulation and efflux tests were used to verify the effects of mutations in N29 and Q30 on the efflux activity of LmrS.

[0097] 3.1 Ethidium bromide accumulation test

[0098] The ethidium bromide accumulation test verifies the efflux effect of the multidrug efflux pump LmrS on ethidium bromide in host bacterial cells. If the activity of the LmrS mutant is weakened or lost, the ethidium bromide content in the host bacterial cells increases and the fluorescence intensity increases. The detailed operation is as follows:

[0099] 1) Plasmids BL21(DE3) / pET-32a(+), BL21(DE3) / pET-32a(+) / LmrS, BL21(DE3) / pET-32a(+) / LmrS_N29-S, BL21(DE3) / pET-32a(+) / LmrS_N29-A, BL21(DE3) / pET-32a(+) / LmrS_Q30-A, BL21(DE3) / pET-32a Bacteria expressing (+) / LmrS_Q30-S, BL21(DE3) / pET-32a(+) / LmrS_N29Q30-SS, and BL21(DE3) / pET-32a(+) / LmrS_N29Q30-AA were streaked on ampicillin-resistant LB agar plates, and single colonies were extracted and grown in LB broth containing 20 mM potassium lactate and 100 μg / ml ampicillin at 37°C to the mid-colony stage (OD625 of 0.5).

[0100] 2) Add IPTG to 0.5 mM and culture at 37°C, 200 rpm for 4 h;

[0101] 3) Wash the bacterial cells twice in M9 minimal salt solution and adjust the OD to 0.2. Take 200 μL of the bacterial solution and add it to a 96-well black opaque 96-well plate;

[0102] 4) Add ethidium bromide to a final concentration of 5 μM 60 s before measurement using a SpectraMax iD5 microplate reader;

[0103] 5) Measure fluorescence at emission and excitation wavelengths of 580 nm and 500 nm for 300 s, once every 100 s for a total of 4 times;

[0104] 6) At 500 s, CCCP (CCCP, i.e. Carbonyl cyanide 3-chlorophenyl hydrazone, a proton carrier (H + ionophore, a potent uncoupler of mitochondrial oxidative phosphorylation, which promotes the mitochondrial inner membrane to + The final concentration was 100 μM and the fluorescence was measured for 500 s, with each measurement being performed every 100 s for a total of 6 times.

[0105] The results showed that when the N29 or Q30 of TM1 of LmrS was mutated to non-polar amino acid A, its efflux activity to ethidium bromide was almost lost. When it was mutated to polar amino acid S, its efflux activity to ethidium bromide still existed, but was significantly lower than that of wild-type LmrS. Fig.16 and Fig.17 When N29Q30 of TM1 of LmrS is combined with non-polar amino acid A, its efflux activity to ethidium bromide is lost. When N29Q30 is combined with non-polar amino acid S, its efflux activity to ethidium bromide is significantly weakened. Fig.18 .

[0106] 3.2 Ethidium bromide efflux test

[0107] In order to further confirm the effect of multidrug efflux pump LmrS on the efflux of ethidium bromide in host bacterial cells, an ethidium bromide efflux test was further carried out in addition to the ethidium bromide accumulation test. If the activity of the LmrS mutant is weakened or lost, the ethidium bromide content in the host bacterial cells will decrease and the fluorescence intensity will weaken. The detailed operation is as follows:

[0108] 1) BL21(DE3) / pET-32a(+), BL21(DE3) / pET-32a(+) / LmrS, BL21(DE3) / pET-32a(+) / LmrS_N29-S, BL21(DE3) / pET-32a(+) / LmrS_N29-A, BL21(DE3) / pET-32a(+) / LmrS_Q30-A, BL21(DE3) / pET-32a(+) Bacteria of BL21(DE3) / pET-32a(+) / LmrS_N29Q30-SS, BL21(DE3) / pET-32a(+) / LmrS_N29Q30-AA were streaked on ampicillin-resistant LB agar plates, and single colonies were extracted and grown in LB broth containing 20 mM potassium lactate and 100 μg / ml ampicillin at 37°C to the mid-colony phase (OD625 of 0.5) and divided into 8 groups;

[0109] 2) Add IPTG to 0.5 mM and culture at 37°C, 200 rpm for 4 h;

[0110] 3) Wash the bacterial cells twice in M9 minimal salt solution and adjust the OD to 0.2. Take 200 μL of bacterial solution and add it to 96 black opaque 96-well plates, then resuspend it in M9 basic salt solution mixed with 10 μM ethidium bromide and 0.01 mM CCCP, and incubate at 37°C for 6 minutes;

[0111] 4) The cells were pelleted at 13,000 rpm for 1 min, resuspended in M9 basal salt solution mixed with 10 μM ethidium bromide, and 200 μL of the bacterial solution was added to a 96-well black opaque plate;

[0112] 5) Use SpectraMax iD5 microplate reader for measurement. Emission wavelength 500, excitation wavelength 580, 100s, measure once every 100s for a total of 2 times;

[0113] 6) Add potassium lactate to a final concentration of 20 mM and measure for 300 s, measuring every 100 s for a total of 4 times;

[0114] 7) The final concentration of CCCP in the first 8 groups was 100 μM, and 10 μL 2500 μg / mL 3-Epicabraleadiol was added to the ninth group. The test was performed for 400 s, and the test was performed every 100 s for a total of 5 times.

[0115] The results showed that when the N29 or Q30 of TM1 of LmrS was mutated to non-polar amino acid A, its efflux activity to ethidium bromide was lost. When it was mutated to polar amino acid S, its efflux activity to ethidium bromide still existed, but was significantly lower than that of wild-type LmrS. Fig.19 and Fig. 20 When N29Q30 of TM1 of LmrS is combined with non-polar amino acid A, its efflux activity to ethidium bromide is lost. When N29Q30 is combined with non-polar amino acid S, its efflux activity to ethidium bromide is significantly weakened. Fig.21 .

[0116] In summary, the ethidium bromide accumulation test and ethidium bromide efflux test in this example show that the key to LmrS efflux of ethidium bromide is that the 29th and 30th amino acids of TM1 must be polar amino acids. The polar groups of amino acids are the basis for forming hydrogen bonds with the substrate, confirming that the LmrS substrate is a hydrophobic compound that can form hydrogen bonds with the amide group (-CONH2).

[0117] Example 4: Screening and verification of plant-derived compounds targeting key amino acids that bind to LmrS activity

[0118] In this example, N29 and Q30 of TM1 of LmrS were used as targets, and small molecule screening was performed through a cloud computing platform to preliminarily screen inhibitors of LmrS, which were verified by ethidium bromide accumulation and efflux tests.

[0119] 4.1. Screening of plant-derived inhibitors of LmrS

[0120] In the discovery and design of EPIs, structure-guided drug design methods are commonly used: mimicking the structure of the substrate so that it has a similar binding site to the target efflux pump and then occupies the binding site but does not trigger efflux activity (conformational change). In this study, N29 and Q30 of TM1 of LmrS were used as targets to perform small molecule screening on a cloud computing platform to initially screen inhibitors of LmrS, as follows:

[0121] 1) Use SWISS-MODEL (SWISS-MODEL (expasy.org)) to construct a structural model of the multidrug efflux pump LmrS protein (see Fig. 22 ), download its pdb format file;

[0122] 2) Using Yinfu Cloud Computing Platform (yinfu cloud computing platform (yinfotek.com)) to select plant-derived compound database for small molecule screening to preliminarily screen inhibitors of LmrS: Based on AutoDockVina screening docking and selecting TCM traditional Chinese medicine database, the docking amino acid target was specified as N 29 and Q 30 To screen;

[0123] 3) Select the inhibitor based on the screening results by selecting the result with the lowest affinity (kcal / mol);

[0124] 4) Find the corresponding compound in the ZINC compound library (ZINC (docking.org)) according to the compound ID of the screening result;

[0125] 5) The inhibitor information was found in PubChem database (PubChem (nih.gov)) based on the SMILES information in the Zinc database.

[0126] Three LmrS herbal compound inhibitors were screened by AutoDockVina, two of which had amino acid targets N29 and Q30 (see Table 8), Bryophyllin and 3-Epicabraleadiol (see Fig.23 and Fig.24 ), only 3-Epicabraleadiol was available, and its docking affinity (kcal / mol) with LmrS was -8.3.

[0127] Table 8 LmrS plant-derived compound inhibitor screening results

[0128]

[0129] 4.2 Validation of LmrS inhibitors

[0130] Ethidium bromide accumulation test and ethidium bromide efflux test were used to verify the inhibitory effect of LmrS. For specific test methods, see "3.1, Ethidium bromide accumulation test" and "3.2, Ethidium bromide efflux test". After adding 10 μL 2500 μg / mL 3-Epicabraleadiol to the BL21(DE3) / pET-32a(+) / LmrS+ inhibitor group, the relative fluorescence curve of ethidium bromide accumulation in its bacteria was basically consistent with that of BL21(DE3) / pET-32a(+) and BL21(DE3) / pET-32a(+) / LmrS_N29Q30-AA, indicating that 3-Epicabraleadiol almost completely inhibited the efflux activity of LmrS, see Fig.25 The relative fluorescence curves of the ethidium bromide efflux assay were also basically consistent with those of BL21(DE3) / pET-32a(+) and BL21(DE3) / pET-32a(+) / LmrS_N29Q30-AA, which again indicated that 3-Epicabraleadiol almost completely inhibited the efflux activity of LmrS. Fig.26 .

[0131] In summary, in this example, three LmrS inhibitors of traditional Chinese medicinal plant origin were screened by targeting N29 and Q30 of TM1 of LmrS. Ethidium bromide accumulation test and ethidium bromide efflux test confirmed that 3-Epicabraleadiol (CAS: 19942-04-2) targeting Q30 can inhibit the activity of LmrS.

[0132] Example 5: Effect of LmrS inhibitors on antibiotic sensitivity of strains

[0133] This example further tests the inhibitory effect of 3-Epicabraleadiol on the efflux of antibiotics by the engineered strain carrying LmrS and the wild strain of Staphylococcus aureus.

[0134] 5.1 Effect of LmrS inhibitors on antibiotic sensitivity of engineered strains

[0135] BL21(DE3) / pET-32а(+) and BL21(DE3) / pET-32а(+) / LmrS were streaked on ampicillin-resistant LB culture dishes, and single colonies were picked and inoculated into 1.5 mL of ampicillin-resistant LB liquid culture medium. The culture was cultured at 37°C and 200 r / min until the OD value was 0.6. IPTG was added to a final concentration of 0.8 mmol / L and cultured for 3-4 hours. The cells were centrifuged at 8000×g for 2 minutes, and the cells were suspended and washed by centrifugation twice with 5 volumes of sterile MH(B). The cells were diluted to 0.5 McFarland turbidity using normal MH(B) culture medium. The minimum inhibitory concentrations (MICs) of lincomycin hydrochloride, kanamycin sulfate, and fusidic acid against the above strains were determined by the microbroth dilution method, referring to the CLSI standard (CLSI, 2023). Three parallels were made for each strain and each antibiotic, and the inhibitor addition group had a corresponding concentration of 3-Epicabraleadiol inhibitor in each well. Finally, the 96-well plate was covered and placed in a 37°C, CO2 constant temperature incubator for 20 h. The bacterial growth was observed and its MICs were recorded.

[0136] The results showed that when different concentrations of 3-Epicabraleadiol and antibiotics were used in combination, lincomycin hydrochloride, kanamycin sulfate and fusidic acid had no effect on the MICs of BL21(DE3) / pET32a(+) strains; while on BL21 / pET32a(+) / LmrS strains, when the concentration of the inhibitor 3-Epicabraleadiol was 8μg / mL and above, the MICs values ​​of lincomycin hydrochloride and fusidic acid against the strain were reduced by one-fold; when the concentration of the inhibitor 3-Epicabraleadiol was 16μg / mL and above, the MICs value of kanamycin sulfate against the strain was reduced by one-fold. This indicates that the inhibitor 3-Epicabraleadiol can inhibit the efflux activity of LmrS against lincomycin hydrochloride, kanamycin sulfate and fusidic acid, and this inhibition is not dose-dependent, as shown in Table 9.

[0137] Table 9 Effects of LmrS efflux pump inhibitors on antibiotic sensitivity of BL21(DE3) / pET32a(+) / LmrS

[0138]

[0139]

[0140] 5.2 Effect of LmrS inhibitors on antibiotic susceptibility of wild-type Staphylococcus aureus strains

[0141] Staphylococcus aureus is the main pathogen causing bovine mastitis. Compared with Staphylococcus aureus from other animals, the bovine milk strains isolated in my country generally show multi-drug resistance. The Staphylococcus aureus efflux pump LmrS can efficiently efflux a variety of drugs with different structures, including antibiotics used to treat mastitis, and is highly resistant to high calcium (Ca 2+ ) environment. The combined use of antibiotics and LmrS inhibitors may increase the sensitivity of Staphylococcus aureus to antibiotics and help improve the cure rate of Staphylococcus aureus. At present, 90% of the bovine Staphylococcus aureus isolates in my country carry at least one drug-resistant gene, and about 50% of the strains are resistant to more than five antibiotics at the same time. In order to clarify the inhibitor 3-Epicabraleadiol to assist in improving the sensitivity of Staphylococcus aureus to antibiotics, we selected a strain XJ69 that does not carry a specific drug-resistant gene as a test strain, see Table 10 and Table 11.

[0142] Table 10 ST type of bovine Staphylococcus aureus and clinical resistance information of antimicrobial drugs

[0143]

[0144] *E: Erythromycin, C: Clindamycin, F: Cefoxitin, P: Penicillin, SMZ: Sulfamethoxazole / Trimethoprim, D: Doxycycline, T: Tetracycline, Chl: Chloramphenicol, CIP: Ciprofloxacin, G: Gentamycin

[0145] Table 11 Drug-resistant genes carried by bovine Staphylococcus aureus

[0146]

[0147]

[0148] # indicates a perfect protein homology model, with 100% homology to the reference protein matching region and 100% consistency in length with the reference protein;

[0149] * indicates a strictly consistent protein homology model, with <100% homology with the reference protein matching region and 100% consistency with the reference protein length;

[0150] Mutations in GlpT1 and GlpT confer resistance to fonomycin;

[0151] murA 2 , murA mutation confers resistance to fotypecin.

[0152] The study of the antibiotic sensitivity of multidrug efflux pump LmrS inhibitor to Staphylococcus aureus XJ69 was performed as follows: about 10 μL was streaked from the bacterial culture tube and inoculated on a sheep blood plate, cultured at 37°C for 18-24 hours, and a single colony was picked and inoculated in 5 mL Columbia liquid culture, and cultured at 37°C in a shaker (170r / min) for 16-18 hours; the bacteria were diluted to 0.5 McFarland turbidimetric value with MH (B) medium, and then diluted 100 times, and the minimum inhibitory concentrations (MICs) of lincomycin hydrochloride, kanamycin sulfate, and fusidic acid against the above strains were determined by microbroth dilution method. Three parallels were made for each strain and each antibiotic, and the inhibitor group was added with the corresponding concentration of 3-Epicabraleadiol inhibitor in each well. Finally, the 96-well plate was covered and placed in a 37°C, CO2 constant temperature incubator for 24 hours, and the bacterial growth was observed and its MICs were recorded.

[0153] The results showed that when the concentration of the inhibitor 3-Epicabraleadiol was 2 μg / mL or above, the MICs of lincomycin hydrochloride, kanamycin sulfate and fusidic acid against the strain were reduced by more than one-fold. This indicates that 3-Epicabraleadiol can inhibit the efflux activity of LmrS against lincomycin hydrochloride, kanamycin sulfate and fusidic acid in wild-type Staphylococcus aureus carrying the LmrS gene, and this inhibition is not dose-dependent, as shown in Table 12.

[0154] Table 12 Effects of LmrS efflux pump inhibitors on antibiotic sensitivity of wild-type Staphylococcus aureus

[0155]

[0156]

[0157] In summary, this example demonstrates through experiments that the inhibitor 3-Epicabraleadiol can inhibit the efflux activity of LmrS to antibiotics in the modified Escherichia coli engineered strain, and this inhibition is not dose-dependent. In addition, this example also demonstrates through experiments that 3-Epicabraleadiol at a concentration of 2 μg / mL can increase the sensitivity of wild-type Staphylococcus aureus carrying the LmrS gene to lincomycin hydrochloride, kanamycin sulfate and fusidic acid, and the inhibition of LmrS efflux activity is not dose-dependent.

[0158] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A target for reducing LmrS efflux activity, characterized in that: The target for reducing the efflux activity of LmrS is the 29th and / or 30th amino acid of TM1 of LmrS.

2. The target for reducing LmrS efflux activity according to claim 1, characterized in that: The 29th amino acid of TM1 of the LmrS is N, and the 30th amino acid of TM1 of the LmrS is Q.

3. A method for reducing LmrS efflux activity, characterized in that: The 29th amino acid N and / or the 30th amino acid Q of TM1 of the LmrS are mutated into non-polar amino acids.

4. A LmrS activity inhibitor, characterized in that The LmrS activity inhibitor targets the target as described in claim 1 or 2.

5. The LmrS activity inhibitor according to claim 4, characterized in that The LmrS activity inhibitor can be any one of Bryophyllin A and its derivatives, 3-Epicabraleadiol and its derivatives, Pseudojervine and its derivatives.

6. Use of the LmrS activity inhibitor according to claim 4 or 5 in inhibiting LmrS efflux activity.

7. Use of the LmrS activity inhibitor as claimed in claim 4 or 5 in reducing the antibiotic efflux activity of LmrS.

8. The use according to claim 7, characterized in that: The antibiotics include lincomycin hydrochloride, kanamycin sulfate, and fusidic acid.

9. Use of the LmrS activity inhibitor according to claim 4 or 5 in the preparation of a drug for treating Staphylococcus aureus infection.

Images