SNP-498 locus associated with number of spikes per plant in wheat and its application

Abstract

The present invention discloses a SNP-498 site related to the number of spikes per plant in wheat and its application. The SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1. When the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B, and the number of spikes per plant is: wheat homozygous for genotype A is smaller than or a candidate is smaller than wheat homozygous for genotype B. The SNP of the present invention has high validity and potential application value. By detecting the SNP, wheat with a higher number of spikes per plant can be found, which is of great value in the research or application of breeding high-yield wheat varieties.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, in particular to a SNP-498 site related to the number of spikes per wheat plant and an application thereof. Background Art

[0002] As one of the world's major grain crops, increasing wheat yield and improving wheat quality are crucial for global food security. Ear number is one of the three key factors in determining yield, and research on wheat ear number is crucial for high-yield breeding and germplasm development. Therefore, identifying QTLs (quantitative trait loci) controlling wheat ear number per plant and their superior allelic variants, as well as mapping QTLs for various tillering traits, are crucial for understanding yield formation and molecular breeding for yield.

[0003] Previous studies have analyzed the genetic mechanisms of panicle number using different genetically segregating populations, and have located numerous QTLs associated with panicle number. Wan Jiale et al. (2021) used 135 DH populations of Annong 859 / Wunong 988 as research materials, measuring the phenotypic values of panicle number per plant under five different environments over two years. They also conducted QTL analysis of panicle number per plant based on 55K microarray data from the DH populations and developed CAPS molecular markers. The results showed that a total of 21 QTLs related to the number of ears per plant were detected on chromosomes 1B, 1D, 2A, 3D, 4A, 4B, 4D, 6A, and 7D. Among them, Qsn-ahau-4B.2 located on chromosome 4B was detected in five environments, with flanking markers AX-95004669-AX-109580651 and a physical interval of 2.65Mb. It can explain 16.92% to 49.98% of the expression variation, with an additive effect of 1.32 to 3.69 ears. The enhancing allele came from Annong 859 and is a major and stable QTL.

[0004] Yang Lin et al. (2013) constructed a genetic linkage map containing 169 molecular markers using an F2 population derived from a cross between Chinese Spring (female) and Lankao Large Grain (male). F2:3 families were planted in Qianxian, Qishan, and Yangling, Shaanxi Province. Complete interval mapping was used to conduct multi-environment joint QTL analysis for wheat tillering before winter, tillering in spring, and number of spikes per plant. A total of 21 additive QTL loci were detected. Among them, six QTLs for pre-winter tillering were located on chromosomes 2A, 2D, 5D, and 7A, with individual QTLs explaining 1.38% to 6.73% of the phenotypic variation. Seven QTLs for spring tillering were located on chromosomes 1A, 2D, 4B, 5D, 7A, and 7D, with individual QTLs explaining 1.97% to 2.60% of the phenotypic variation. Eight QTLs for panicle number per plant were located on chromosomes 1A, 2B, 2D, and 4B, with individual QTLs explaining 2.29% to 41.21% of the phenotypic variation. A total of 30 pairs of additive × additive epistatic QTLs were detected. One pair controlled pre-winter tillering, explaining 21% of the phenotypic variation; 20 pairs controlled spring tillering, for a total of 30 pairs of additive × additive epistatic QTLs. Among them, one pair controlled tillering before winter, which could explain 21% of the phenotypic variation; 20 pairs controlled tillering in spring.

[0005] Although many QTLs related to wheat spike number have been located, most of them have a small phenotypic contribution rate, require additive effects to be expressed, and have poor reproducibility across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of wheat spike number per plant. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a SNP-498 site related to the number of wheat ears per plant and an application thereof.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] A SNP site associated with the number of ears per plant in wheat, the SNP site corresponding to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the number of ears per plant is: wheat homozygous for genotype A is smaller than, or potentially smaller than, wheat homozygous for genotype B.

[0009] On the other hand, the present invention includes a primer combination for detecting single nucleotide polymorphisms at the following SNP sites in the wheat genome, wherein the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

[0010] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the number of ears per plant in wheat, which is used to detect the SNP site described in claim 1 and at least includes the primer combination described in claim 2 and the necessary restriction endonuclease components.

[0011] As a preferred technical solution of the present invention, the restriction endonuclease is SmaI enzyme.

[0012] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0013] As a preferred technical solution of the present invention, the reagent or kit also includes template DNA, a buffer solution required for PCR amplification, dNTPs and other necessary components for gene detection.

[0014] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the reagent or kit is designed to be 473-571 bp from the 5' end of SEQ ID NO.1.

[0015] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0016] On the other hand, the present invention also includes a method for identifying or assisting in identifying wheat genotypes, wherein any DNA fragment containing the SNP site described in claim 1 in the wheat genomic DNA to be tested is PCR amplified, and the PCR amplification product is enzyme digested and identified; the DNA fragment amplified by PCR is the 473-571bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0017] As a preferred technical solution of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 to 50 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using the restriction endonuclease SmaI to digest the PCR product; if the PCR product cannot be cut, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product can be cut, the nucleotide polymorphic site is G / G and the genotype is B; the number of ears per plant is: wheat homozygous for genotype A is smaller than, or candidate is smaller than, wheat homozygous for genotype B.

[0018] In the final aspect, the present invention also includes the use of the SNP site in identifying or assisting in identifying the trait of the number of ears per plant in wheat.

[0019] The beneficial effect of adopting the above technical solution is that: the research team of the present invention discovered 1 SNP through genetic variation analysis of genes in the natural variation population of wheat, which corresponds to the 498th position from the 5' end of Sequence Table 1. By designing a dCAPS marker for the SNP site, it was found that the SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis proved that in the homozygous types of these two genotypes, the number of ears per plant is: wheat homozygous for genotype A < wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of ears per plant can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in agricultural practice and / or related scientific research for breeding high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a diagram of the gene structure pattern and SNP site;

[0021] Figure 2Schematic diagram of the electrophoresis detection results of the SNP development dCAPS labeling enzyme digestion products of the present invention; wherein, M is used as a molecular weight standard; lane A is a band that can be cut by KpnI, lane C is a band that cannot be cut by SmaI, and lane G is a band that can be cut by SmaI;

[0022] Figure 3 This is a schematic diagram of the association analysis of the number of ears per plant;

[0023] Figure 4 This is a schematic diagram of gene SNP sites and typing in 385 wheat population materials. DETAILED DESCRIPTION

[0024] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through commercial purchase. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can all be obtained from commercial channels. The wheat materials used in the following examples are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm). Material information can be found on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn. It should be understood that when used in this application specification and the appended claims, the term "including" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in this application specification and the appended claims refers to any combination and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0025] As used in this specification and the appended claims, the term "if" can be interpreted as "when..." or "upon..." or "in response to determining..." or "in response to detecting," depending on the context. Similarly, the phrases "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "upon determination," "in response to determining," or "upon detecting [the described condition or event]," or "in response to detecting [the described condition or event]," depending on the context. In addition, in the description of this specification and the appended claims, the terms "first," "second," "third," etc. are used solely to distinguish descriptions and are not to be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this specification mean that a particular feature, structure, or characteristic described in connection with that embodiment is included in one or more embodiments of the present application. Thus, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in other embodiments," etc., appearing at different locations in this specification, do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "include", "comprising", "having" and variations thereof mean "including but not limited to", unless specifically emphasized otherwise.

[0026] Example 1. Detection of SNPs Related to the Number of Ears per Plant in Wheat and Their PCR-Enzyme Digestion Polymorphism

[0027] 1. Specific primers for amplifying the genomic fragment containing the wheat SNP and sequence analysis

[0028] like Figure 1 As shown, a SNP was found in the gene coding region of the wheat genome, corresponding to position 498 from the 5' end of SEQ ID NO. 1 in the sequence listing. By designing a dCAPS marker for this SNP site, it was found that there are two genotypes at this site in the natural variation population of wheat:

[0029] Genotype A: C

[0030] Genotype B: G

[0031] Based on the sequence differences of different wheat genomes, specific primers were designed to PCR amplify DNA fragments containing the SNP sites:

[0032] F1: CGACCATGCCGTACGCCGGC (SEQ ID NO: 2);

[0033] R1: CACATTAGTACGTGGTCCGT (SEQ ID NO: 3);

[0034] F2: ACCACAGGGGCCCGGGCGCCGGCCC (SEQ ID NO: 4);

[0035] R2: TGCTGCCGCGCACGTCCATC (SEQ ID NO: 5);

[0036] The target sequence amplified by PCR using primers F1 and R1 is the sequence 383-1441 shown in SEQ ID NO: 1 of the sequence listing; the target sequence amplified by PCR using primers F2 and R2 is the sequence 473-571 shown in SEQ ID NO: 1 of the sequence listing. Enzyme digestion analysis showed that the polymorphisms were recognized by SmaI.

[0037] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping methods

[0038] 1) Extracting genomic DNA from the wheat to be tested;

[0039] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (20 μL) was as follows: 16.8 μL ddH2O, 0.2 μL KOD, 1 μL dNTP, 0.5 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (50-100 ng / μL).

[0040] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0041] 3) The PCR product from step 2) was diluted 20- to 50-fold and used as a template for PCR amplification using primers F2 and R2. The PCR amplification system (20 μL) was as follows: 7 μL ddH2O, 10 μL 2× TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).

[0042] PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 10 s, 72°C for 10-12 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0043] 4) The PCR product obtained in step 3) was digested with SmaI to obtain a digestion product, which was detected by 4% agarose gel electrophoresis. It was recorded whether the PCR product was cut into two fragments. The status of the wheat to be tested at the site was determined and recorded according to the following method:

[0044] If the enzyme cleavage product is one or larger fragments, the wheat to be tested is C homozygous (expressed as C / C) at the site (e.g. Figure 2 Lane C in

[0045] If the enzyme cleavage product is two or smaller fragments, the wheat to be tested is G homozygous (expressed as G / G) at the site (e.g. Figure 2 Lane G in Figure 5).

[0046] According to the results of step 4), the wheat is divided into two types, I and II, as follows:

[0047] I: C / C (i.e., homozygous for genotype A);

[0048] II: G / G (i.e., homozygous for genotype B);

[0049] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0050] 3. Use dCAPS markers to genotype natural populations and conduct association analysis with the single-plant spike number trait

[0051] Each wheat in a natural population of 320 hexaploid wheats was used as the test wheat, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0052] Table 1 The situation of the polymorphic sites in natural wheat populations

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 2

[0059] Our technical team conducted exon capture sequencing on 385 materials and performed specific genotyping on these materials, including genotype A homozygous C / C and genotype B homozygous G / G. Figure 4 Among all 385 materials, 363 materials could be clearly distinguished as homozygous C / C of genotype A or homozygous G / G of genotype B, and the remaining 22 materials could not complete genotyping.

[0060] In addition, 320 of these 385 materials have multi-year and multi-point agronomic trait data, while the remaining 65 materials cannot meet the requirements of subsequent analysis due to insufficient data. Figure 3 As shown in the figure, only these 320 data points were used in the association analysis between the polymorphic loci in the natural population and the number of spikes per plant. However, 18 of these 320 data points were not genotyped, so the actual number of samples used in the association analysis was 302.

[0061] In 2018, the above natural population wheat was planted in the arid-hot land, dry land and hydrothermal land of the Luancheng Experimental Station of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng, Hebei); in 2019, the arid-hot land, dry land, hydrothermal land and water land of the Hengshui Experimental Farm of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng and Hengshui, Hebei); in 2020, the arid land and arid-hot land of the Institute of Crop Sciences of the Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station) were used to plant the wheat. The number of ears per plant of each wheat variety was investigated, and the association analysis between the number of ears per plant and the polymorphic loci was performed using Tassel2.1 software. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, and P<0.05 was set as the significance level. The results are shown in Table 2 and Table 2. Figure 3 shown.

[0062] Table 2 Results of association analysis between the status of gene polymorphisms in natural populations and the number of spikes per plant

[0063]

[0064] The results of the association analysis in Table 2 indicate that the differences in the number of spikes per plant between the two types of wheat from the natural population of 320 hexaploid wheat samples shown in Table 1 reached significant levels (P < 0.05) at eight environmental points. Among them, the number of spikes per plant in type I wheat was less than that in type II wheat. Across several environments, the number of spikes per plant in type I wheat materials was 0.30, 0.54, 0.44, 0.43, 0.72, 0.43, 0.07, 0.32, 0.25, and 0.62 fewer than in type II wheat, respectively. Studies on natural populations have shown that type II is an excellent genotype for increasing the number of spikes per plant in wheat.

[0065] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0066] From the above embodiments, it can be seen that the present invention discloses a SNP site related to the number of ears per plant of wheat and its application. Through the genetic variation analysis of the gene coding region of the natural variation population of wheat, the present invention found that there is a SNP, corresponding to the 498th position from the 5' end of Sequence Table 1, and the SNP has two genotypes: genotype A (C) and genotype B (G). It was proved by association analysis that in the homozygous types of these two genotypes, the number of ears per plant is: wheat homozygous for genotype A < wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of ears per plant can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research.

[0067] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. The use of SNP sites is characterized by: The SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B. The use is to identify or assist in identifying the trait of the number of ears per plant of wheat, where the trait of the number of ears per plant is: wheat homozygous for genotype A is smaller than or is a candidate to be smaller than wheat homozygous for genotype B.

2. The use of the primer combination is characterized by: The primer combination is primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; The use is to identify or assist in identifying the single-plant spike number trait of wheat by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the single-plant spike number trait is: wheat homozygous for genotype A is smaller than, or is potentially smaller than, wheat homozygous for genotype B.

3. Use of a reagent or kit, characterized in that: The reagent or kit comprises at least the primer combination according to claim 2 and necessary restriction endonuclease components; The invention is used to identify or assist in identifying the trait of the number of spikes per plant of wheat by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1; when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the trait of the number of spikes per plant is: wheat homozygous for genotype A is smaller than, or is potentially smaller than, wheat homozygous for genotype B; The restriction endonuclease is SmaI enzyme.

4. The use according to claim 3, characterized in that: The reagents or kit also include template DNA, buffer required for PCR amplification, dNTPs and other necessary components for gene detection.

5. The use according to claim 3 or 4, characterized in that: The target DNA fragment amplified by PCR in the reagent or kit is designed to be 473-571 bp from the 5' end of SEQ ID NO.

1.

6. A method for identifying or assisting in identifying the number of wheat ears per plant, characterized in that: A DNA fragment containing the SNP site of claim 1 in any section of the wheat genomic DNA to be tested is PCR amplified, and the PCR amplification product is subjected to enzyme digestion identification, wherein the enzyme digestion comprises the following steps: using the wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 to 50 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; digesting the PCR product with restriction endonuclease SmaI; if the PCR product cannot be cleaved, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphic site is G / G and the genotype is B; the number of ears per plant is: the wheat homozygous for genotype A is smaller than, or the candidate is smaller than, the wheat homozygous for genotype B; The DNA fragment amplified by PCR is 473-571 bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

Images