Development of DNA-targeted gene editing tools

Abstract

The invention relates to a Cas12 protein which comprises an amino acid sequence as shown in any one of SEQ ID NO: 1 to 104, or a functional fragment thereof, or an amino acid sequence with one or more amino acid substitution, insertion and / or deletion as shown in any one of SEQ ID NO: 1 to 104, and a CRISPR-Cas system comprising the Cas12 protein and application of the CRISPR-Cas system.

Description

Development of DNA-targeted gene editing tools

[0001] Related applications

[0002] This application claims priority to international application number PCT / CN2022 / 091550, filed on May 7, 2022, entitled “Development of DNA-targeted gene editing tools,” the entire contents of which are incorporated herein by reference.

[0003] Sequence listing file submitted at the same time

[0004] The entire contents of the following XML file are incorporated herein by reference in their entirety: Sequence Listing in Computer Readable Format (CRF) (Name: TFG00801 PCT-sequencelisting.xml, Date: 20230506, Size: 316KB). Technical Field

[0005] This application relates to the newly discovered Cas12 protein, which belongs to the field of gene editing biology research. Background Art

[0006] The CRISPR-Cas system is an acquired immune system in prokaryotes. It functions as an adaptive immune mechanism in microorganisms such as bacteria and archaea, defending against viruses and other foreign nucleic acids. The CRISPR-Cas immune response primarily consists of three phases: adaptation, expression and processing, and interference. Similar to other immune mechanisms, the CRISPR-Cas system evolved in the context of constant competition with mobile genetic elements, resulting in extreme diversity in Cas protein sequences and CRISPR-Cas loci architecture.

[0007] Since 2011, CRISPR-Cas systems have been classified into two broad categories based on their genetic makeup, locus structure, and sequence similarity clustering. Class 1 systems feature effector modules composed of multiple Cas proteins, some of which form crRNA-binding complexes that mediate pre-crRNA processing and interference via additional Cas proteins. Class 2 systems consist of a single Cas effector protein with a multifunctional binding domain that binds to crRNA and performs all the activities required for interference, including, in some variants, pre-crRNA maturation. Currently, Class 2 CRISPR-Cas systems are primarily categorized into three subtypes: type II (e.g., Cas9), type V (e.g., Cas12), and type VI (e.g., Cas13). Type VI effector Cas proteins primarily target RNA, while type II and type V subtypes primarily target DNA.

[0008] At present, researchers have conducted a lot of research on Cas12 protein and have also developed related Crispr-Cas12 gene editing tools, but there are still some shortcomings: on the one hand, most of the Cas12 proteins discovered so far are large. When using the CRISPR-Cas12 system, a delivery medium is usually required to deliver the related plasmid. Commonly used delivery media are retroviruses, adenoviruses or adeno-associated viruses. Due to their limited loading capacity, such as the currently commonly used AAV delivery vector, the loading capacity is only 4.7kb, which is not conducive to the packaging of CRISPR-Cas related tools with large molecular weight into AAV; on the other hand, Cas12 protein has a strong DNA sequence preference (PAM) when targeting DNA, which to a certain extent limits the use of Cas12 protein. Some researchers have tried to obtain non-PAM-dependent Cas12 protein, but this will reduce the enzyme cleavage activity.

[0009] Therefore, there is still a need to find Cas12 proteins with low molecular weight, easy delivery, or non-PAM dependence.

[0010] Summary of the Invention

[0011] In response to the shortcomings of existing Cas12 proteins, this application provides a new Cas12 protein family, which not only has small molecules but also has good gene editing capabilities.

[0012] The technical problem solved by the present disclosure is to find candidate CRISPR-Cas12 proteins and their systems with more novel DNA enzyme cleavage activity domains (such as RuvC, Cas12 superfamily, InsQ superfamily, etc.); verify the activity of candidate CRISPR-Cas12 proteins and their systems; and finally obtain a variety of novel Cas12 proteins.

[0013] The present disclosure achieves the following technical effects:

[0014] (1) Developed an analytical method for rapid screening of novel Cas12 family proteins. This method can analyze newly updated prokaryotic microbial DNA sequences and metagenomic sequences using the CRIPSR array system and screen for related effector proteins.

[0015] (2) Screening of new Cas12 family members to expand the application scope of CRISPR-Cas12. On the one hand, the vast majority of the new candidate Cas12 family members screened in this application are less than 400 amino acids in length, some are less than 300 amino acids, and even some are less than 200 amino acids, which are significantly lower than the Cas12 family members in the prior art. These candidate Cas12 proteins have low molecular weights and can be well packaged through delivery vectors such as adeno-associated viruses, thereby achieving the diagnosis and treatment of related diseases, such as the diagnosis and treatment of neurodegenerative diseases. On the other hand, although some candidate Cas12 proteins have large molecular weights, they have different PAM preferences, which expands the toolbox for nucleic acid detection. In addition, candidate proteins can also be used for research on breeding, adverse stress, etc. in the field of plants, and for the transformation of related engineered bacteria in the field of microorganisms;

[0016] (3) In the screening process, the method of the present application not only uses the known RuvC domain of the Cas12 protein for screening, but also includes conserved domains with DNA cleavage activity in other types of proteins, thereby providing the possibility of screening new Cas12 proteins. Moreover, the identification of these new functional domains in these new Cas12 proteins provides new ideas and possibilities for further modification of the Cas12 protein.

[0017] In one aspect of the present disclosure, a Cas12 protein is provided.

[0018] In a preferred embodiment, the Cas12 protein comprises an amino acid sequence as described in any one of SEQ ID NOs: 1-104, or a functional fragment thereof, or an amino acid sequence as described in any one of SEQ ID NOs: 1-104 having conservative amino acid substitutions of one or more residues, or an amino acid sequence as described in any one of SEQ ID NOs: 1 to 104 having one or more amino acid substitutions, insertions, and / or deletions.

[0019] In a preferred embodiment, the Cas12 protein is a fragment of the amino acid sequence of any one of SEQ ID NOs: 1-104, or a fragment of the amino acid sequence of any one of SEQ ID NOs: 1-104 having one or more amino acid substitutions, insertions, and / or deletions.

[0020] In a preferred embodiment, the Cas12 protein contains the amino acid sequence shown in SEQ ID NO: 13, 25, 31, 59, 61, 62, 63, 66, or 67; or a fragment containing the amino acid sequence shown in SEQ ID NO: 13, 25, 31, 59, 61, 62, 63, 66, or 67, or a mutant containing the amino acid sequence shown in SEQ ID NO: 13, 25, 31, 59, 61, 62, 63, 66, or 67.

[0021] In a preferred embodiment, the Cas12 protein contains the amino acid sequence shown in SEQ ID NO: 25, 31, 62, 63, or 66; or a fragment containing the amino acid sequence shown in SEQ ID NO: 25, 31, 62, 63, or 66, or a mutant containing the amino acid sequence shown in SEQ ID NO: 25, 31, 62, 63, or 66.

[0022] In a preferred embodiment, the DNA cleavage activity of the Cas12 protein is retained.

[0023] In a preferred embodiment, the Cas12 protein has the activity of knocking in, knocking out, or changing genes in DNA.

[0024] In a preferred embodiment, the Cas12 protein has a RuvC domain, a Cas12 superfamily domain and / or an InsQ superfamily domain, and at least one amino acid in its RuvC domain, Cas12 superfamily domain and / or InsQ superfamily domain is further modified or modified to reduce or eliminate its DNA cleavage activity, thereby becoming dCas12 (dead Cas12) with reduced or eliminated DNA cleavage activity.

[0025] In a preferred embodiment, the Cas12 protein has DNA editing activity, and preferably at least one of its RuvC domain, Cas12 superfamily domain and InsQ superfamily domain is further modified or transformed to reduce or eliminate its DNA cleavage activity to become dCas12 with reduced or eliminated DNA cleavage activity.

[0026] In a preferred embodiment, the Cas12 protein is fused to one or more heterologous functional domains.

[0027] In a preferred embodiment, the fusion is at the N-terminus, C-terminus or inside the Cas12 protein.

[0028] In a preferred embodiment, the heterologous functional domain is capable of cleaving one or more target sequences, or modifying the transcription or translation of a target sequence.

[0029] In a preferred embodiment, the one or more heterologous functional domains have the following activities: deaminase, such as cytidine deaminase and deoxyadenosine deaminase, methylase, demethylase, transcriptional activation, transcriptional repression, nuclease, single-stranded RNA cleavage, double-stranded RNA cleavage, single-stranded DNA cleavage, double-stranded DNA cleavage, DNA or RNA ligase, reporter protein, detection protein, localization signal, or any combination thereof.

[0030] In a preferred embodiment, the Cas12 protein contains a RuvC domain, a Cas12 superfamily domain, and / or an InsQ superfamily domain; preferably, the Cas12 protein contains a cas12k domain, a cas12b domain, a RuvC_1 domain, and / or an OrfB / InsQ domain.

[0031] In a preferred embodiment, the amino acid substitution, insertion, and / or deletion of the Cas12 protein of the present application is included in the RuvC domain, the Cas12 superfamily domain, and / or the InsQ superfamily domain. Preferably, it is included in the cas12k domain, the cas12b domain, the RuvC_1 domain, and / or the OrfB / InsQ domain. Substitution, insertion, and / or deletion.

[0032] In a preferred embodiment, after one or more amino acid substitutions, insertions, and / or deletions are made in the Cas12 protein of the present application, the activity of the Cas12 protein in knocking in, knocking out, or altering genes in DNA is reduced or eliminated.

[0033] In another aspect of the present disclosure, a nucleic acid molecule is provided, comprising a nucleotide sequence encoding the Cas12 protein of the present application.

[0034] In a preferred embodiment, the nucleic acid molecule is codon-optimized for expression in a specific host cell.

[0035] In a preferred embodiment, the host cell is a prokaryotic or eukaryotic cell, preferably a human cell.

[0036] In a preferred embodiment, the host cell is a prokaryotic cell or a eukaryotic cell, preferably an animal cell, a plant cell, or a microbial cell.

[0037] In a preferred embodiment, the nucleic acid molecule comprises a promoter operably linked to the nucleotide sequence encoding Cas12, which is a constitutive promoter, an inducible promoter, a synthetic promoter, a tissue-specific promoter, a chimeric promoter or a development-specific promoter.

[0038] In another aspect of the present disclosure, an expression vector is provided, which comprises the above-mentioned nucleic acid molecule and expresses the above-mentioned amino acid sequence or nucleotide sequence in the form of DNA, RNA, protein, etc.

[0039] In another aspect of the present disclosure, an expression vector is provided, which comprises the nucleic acid molecule of the present application.

[0040] In a preferred embodiment, the expression vector further comprises a crRNA sequence and / or a tracr RNA sequence.

[0041] In a preferred embodiment, the expression vector further comprises a regulatory element for regulating the nucleic acid molecule, a regulatory element for regulating the crRNA sequence, and / or a regulatory element for regulating the tracr RNA sequence.

[0042] In a preferred embodiment, the expression vector is a viral vector, nanoparticles, nanoliposome particles (LNP), cationic polymers (such as PEI), liposomes, exosomes, virus-like particles (VLP), microvesicles or gene guns.

[0043] In a preferred embodiment, the expression vector is adeno-associated virus (AAV), adenovirus, recombinant adeno-associated virus (rAAV), lentivirus, retrovirus, herpes simplex virus, oncolytic virus, etc.

[0044] In another aspect of the present disclosure, a delivery system is provided, comprising (1) the above-mentioned expression vector, or the above-mentioned Cas12 protein; and (2) a delivery vector.

[0045] In a preferred embodiment, the delivery vehicle is a nanoliposome particle (LNP), a cationic polymer (such as PEI), a virus-like particle (VLP), a nanoparticle, a liposome, an exosome, a microvesicle or a gene gun.

[0046] In another aspect of the present disclosure, a CRISPR-Cas system is provided, comprising: (1) the Cas12 protein described herein or the nucleic acid molecule described herein, or a derivative or functional fragment thereof; and (2) a gRNA sequence for targeting a target DNA or a gRNA sequence for targeting a target sequence.

[0047] In a preferred embodiment, the functional fragment of the Cas12 protein is a fragment of amino acids as described in any one of SEQ ID NOs: 1 to 104, which comprises a deletion of at least one amino terminus and retains the function of the Cas12 protein. Preferably, the functional fragment of the Cas12 protein comprises an insertion, deletion and / or substitution of at least one amino acid (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 residues) based on the amino acid sequence of any one of SEQ ID NOs: 1 to 104, preferably, the substitution is a conservative substitution and still has the function of the Cas12 protein.

[0048] In a preferred embodiment, the derivative of the Cas12 protein is a protein having 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more amino acid sequence identity with any one of SEQ ID NOs: 1 to 104 or a functional fragment thereof. Preferably, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids are inserted, deleted, and / or substituted based on the amino acid sequence of any one of SEQ ID NOs: 1 to 104.

[0049] In a preferred embodiment, a portion of the gRNA sequence comprises a direct repeat (DR) sequence, a trans-acting CRISPR RNA (tracrRNA), and a sequence of a spacer region targeting the target RNA portion (Spacer sequence).

[0050] In a preferred embodiment, the gRNA sequence comprises a direct repeat (DR) sequence, a trans-acting CRISPR RNA (tracrRNA) and a sequence of a spacer region targeting a portion of the target sequence.

[0051] In a preferred embodiment, the other part of the gRNA sequence comprises a direct repeat (DR) sequence and a sequence (Spacer sequence) targeting the spacer region of the target RNA portion.

[0052] In a preferred embodiment, the DR sequence is a sequence shown in Table 1; the tracrRNA sequence is a sequence shown in Table 2; and the spacer sequence is 10-60 nucleotides, preferably 15-25 nucleotides, and more preferably 19-21 nucleotides.

[0053] In a preferred embodiment, the DR sequence is a sequence shown in any one of SEQ ID NOs: 105 to 262 or a sequence shown in any one of SEQ ID NOs: 269 to 276.

[0054] In a preferred embodiment, the tracrRNA sequence is the sequence shown in any one of SEQ ID NOs: 263 to 268.

[0055] In a preferred embodiment, the spacer sequence is 10-50 nucleotides, preferably 15-25 nucleotides, more preferably 20 nucleotides.

[0056] In a preferred embodiment, the DR sequence may be a derivative corresponding to any of the following, wherein the derivative (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide additions, deletions, or substitutions compared to any of the sequences shown in Table 1; (ii) has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 97% sequence identity with any of the sequences shown in Table 1; (iii) hybridizes under stringent conditions with any of the sequences shown in Table 1, or with any of (i) and (ii); or (iv) is the complement of any of (i) to (iii), provided that the derivative is not any of the sequences shown in Table 1, and the derivative encodes an RNA, or is itself an RNA, that substantially maintains the same secondary structure as any of the RNAs encoded by SEQ ID NOs: 105-262.

[0057] In a preferred embodiment, the DR sequence is any one of the following derivatives (i) to (iv), wherein the derivative (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) nucleotide additions, deletions, or substitutions compared to the sequence shown in any one of SEQ ID NOs: 105 to 262 or any one of SEQ ID NOs: 269 to 276; the derivative (ii) has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 97% sequence identity to any one of the sequences shown in any one of SEQ ID NOs: 105 to 262 or any one of SEQ ID NOs: 269 to 276; the derivative (iii) has a sequence identity to any one of SEQ ID NOs: 105 to 262 or any one of SEQ ID NOs: 269 to 276 under stringent conditions. NO: any one of the sequences shown in any one of 269 to 276, or hybridizes with any one of (i) and (ii); or the derivative (iv) is the complement of any one of the derivatives (i)-(iii), provided that the derivative is not the sequence shown in any one of SEQ ID NO: 105 to 262 or any one of the sequences shown in any one of SEQ ID NO: 269 to 276, and the derivative encodes RNA, or is itself RNA, and the RNA maintains substantially the same secondary structure as any RNA encoded by any one of SEQ ID NO: 105-262 or SEQ ID NO: 269 to 276.

[0058] In a preferred embodiment, the tracrRNA sequence is a sequence shown in Table 2; the sequence comprises a pairing base segment that can be reverse complementary to the DR sequence, generally forming at least 6 base pairs, 8 base pairs, 10 base pairs, or 12 base pairs, which can be continuous pairings or intermittent pairings.

[0059] In a preferred embodiment, the tracrRNA sequence comprises a pairing base that can be reverse complementary to the DR sequence, preferably, the tracrRNA sequence and the DR sequence form at least 6 base pairings, 8 base pairings, 10 base pairings or 12 base pairings, and the base pairings are continuous pairings or intermittent pairings. Preferably, the tracrRNA sequence is the sequence shown in any one of SEQ ID NOs: 263 to 268.

[0060] In a preferred embodiment, the tracrRNA sequence may be a derivative corresponding to any of the following, wherein the derivative (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide additions, deletions, or substitutions compared to any of the sequences shown in Table 2; (ii) has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 97% sequence identity to any of the sequences shown in Table 2; (iii) hybridizes under stringent conditions to any of the sequences shown in Table 2, or to any of (i) and (ii); or (iv) is the complement of any of (i)-(iii), provided that the derivative is not any of the sequences shown in Table 2, and the derivative encodes an RNA, or is itself an RNA, that substantially maintains the same secondary structure as any of the RNAs encoded by SEQ ID NOs: 263-268.

[0061] In a preferred embodiment, the tracrRNA is any one of the following derivatives (i) to (iv), wherein the derivative (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) nucleotide additions, deletions, or substitutions compared to any one of the sequences shown in any one of SEQ ID NOs: 263 to 268; the derivative (ii) has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 97% sequence identity to any one of the sequences shown in any one of SEQ ID NOs: 263 to 268; the derivative (iii) is identical to any one of the sequences shown in any one of SEQ ID NOs: 263 to 268 under stringent conditions. NO: any one of the sequences shown in any one of 263 to 268, or hybridizes with any one of (i) and (ii); or the derivative (iv) is the complement of any one of the derivatives (i)-(iii), provided that the derivative is not any one of the sequences shown in any one of SEQ ID NO: 263 to 268, and the derivative encodes RNA, or is itself RNA, and the RNA maintains substantially the same secondary structure as any RNA encoded by SEQ ID NO: 263-268.

[0062] In a preferred embodiment, the CRISPR-Cas system further comprises: (3) target RNA.

[0063] In a preferred embodiment, the CRISPR-Cas system causes cleavage, sequence insertion or deletion, single-base editing, sequence modification (including epigenetic modification), sequence alteration or degradation of the target DNA sequence.

[0064] In a preferred embodiment, the target DNA is double-stranded DNA, single-stranded DNA, double-stranded circular DNA or single-stranded circular DNA.

[0065] In a preferred embodiment, the system is capable of delivering an epigenetic modifier or a transcriptional or translational activation or repression signal at or near a target sequence.

[0066] In another aspect of the present disclosure, a cell is provided, comprising the above-mentioned Cas12 protein, nucleic acid molecule, expression vector, delivery system or CRISPR-Cas system.

[0067] In a preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell, preferably a human cell.

[0068] In another aspect of the present disclosure, a method for degrading or cutting target DNA in a target cell, or changing or modifying the sequence of the target DNA in a target cell is provided, which comprises using the Cas12 protein described above in the present application, the nucleic acid molecule described above in the present application, the expression vector described above in the present application, the delivery vector described above in the present application, or the CRISPR-Cas system described above in the present application.

[0069] In a preferred embodiment, the target cell is a prokaryotic cell or a eukaryotic cell, preferably a human cell.

[0070] In a preferred embodiment, the target cell is a prokaryotic cell or a eukaryotic cell, preferably an animal cell, a plant cell, or a microbial cell.

[0071] In a preferred embodiment, the target cell is an in vitro cell, an in vitro cell or an in vivo cell.

[0072] In another aspect of the present disclosure, a target DNA detection method is provided, which utilizes the Cas12 protein or its derivative or functional fragment described in the present application, the Cas12 protein or its derivative or functional fragment expressed by the nucleic acid molecule described in the present application, the Cas12 protein or its derivative or functional fragment expressed by the expression vector described in the present application, or the CRISPR-Cas system described in the present application to detect target DNA.

[0073] In a preferred embodiment, the target DNA detection method also uses sgRNA targeting the target DNA and a reporter detection molecule, and utilizes the Cas12 protein described in this application or its derivative or functional fragment, the Cas12 protein or its derivative or functional fragment expressed by the nucleic acid molecule described in this application, the Cas12 protein or its derivative or functional fragment expressed by the expression vector described in this application, or the CRISPR-Cas system described in this application to bind to the target DNA so as to exert the DNA cleavage activity of the Cas12 protein to cut the reporter molecule and detect the signal emitted by the reporter detection molecule. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1: Shows the results of DZ356 protein cutting the endogenous gene TYR in the 293T cell line. It can be seen that when the DZ356 protein was co-transfected with the guide RNA (sgMix), two faults appeared near sg1 (the first sgRNA targeting TYR). However, no fault information was detected in the control group px377 (a tool plasmid with the same DZ356 plasmid backbone but without DZ356 protein) and sgMix, indicating that it could not cut.

[0075] Figure 2 shows the results of DZ738 protein cleavage of the endogenous gene TYR in the 293T cell line. Figure 2A shows the results of the experimental group. Multiple faults were observed near sg1 (the first sgRNA targeting TYR) and sg2 (the second sgRNA targeting TYR) in both experimental groups. Furthermore, an indel mutation was detected near sg2 in experimental group 1, indicating that the candidate protein DZ738 cleaved near the sgRNA, resulting in a large deletion. Figure 2B shows the results of the control group, where DZ738 protein cleaved the endogenous gene TYR in the 293T cell line. Both control groups showed no mutations or faults near sg1 or sg2, indicating a clean background in the control group.

[0076] Figure 3: Shows the results of the experimental and control groups in which DZ761 protein cut the endogenous gene TYR in the 293T cell line. It can be seen that the experimental group had many faults near sg1, while the control group had no deletions.

[0077] Figure 4 shows the results of DZ837 protein cleavage of the endogenous gene TYR in the 293T cell line. Figure 4A shows that the experimental group had large-scale faults (deletions) near sg1 and sg2, and indel mutations were also detected in experimental group 2. The control group (px262 is an empty plasmid without sgRNA, and px377 is an empty plasmid without DZ837.) had a clean background, indicating the ability of DZ837 to cleave endogenous genes. Figure 4B shows that the experimental group had large-scale faults (deletions) near sg1 and sg2, and indel mutations were also detected in experimental group 2. The control group (px262 is an empty plasmid without sgRNA, and px377 is an empty plasmid without DZ837.) had a clean background, indicating that DZ837 has the ability to cleave endogenous genes.

[0078] Figure 5 shows the results of the positive control LbCas12 cleaving the endogenous gene TYR in the 293T cell line. It can be seen that near sg1 and sg2, the experimental group has large-scale faults (deletions) and indel mutations, while the control group has a clean background. This further demonstrates the ability of our positive control protein to cleave endogenous genes.

[0079] Figure 6: Shows the flow cytometric analysis of the candidate protein DZ402 after targeted knockout of mCherry fluorescent protein in 293T cells. The horizontal axis represents the intensity of green light, and the vertical axis represents the intensity of red light. The Q2 group represents the cell population that simultaneously expresses the red fluorescent protein mCherry and the green fluorescent protein EGFP. Compared with the control group, the sgRNA in the experimental group successfully knocked out the mCherry fluorescent protein, that is, the proportion of red and green double-positive cells in Q2 decreased.

[0080] Figure 7 shows a flow cytometric analysis of the candidate protein DZ428 after targeted knockout of mCherry fluorescent protein in 293T cells. The horizontal axis represents the intensity of green light, and the vertical axis represents the intensity of red light. The Q2 population represents cells expressing both the red fluorescent protein mCherry and the green fluorescent protein EGFP. Compared to the control group, the experimental group's sgRNA successfully knocked out mCherry fluorescent protein, as evidenced by a decrease in the proportion of cells expressing both red and green fluorescent proteins in Q2.

[0081] Figure 8 shows a flow cytometric analysis of the candidate protein DZ738 after targeted knockout of mCherry fluorescent protein in 293T cells. The horizontal axis represents the intensity of green light, and the vertical axis represents the intensity of red light. The Q2 population represents cells expressing both the red fluorescent protein mCherry and the green fluorescent protein EGFP. Compared to the control group, the experimental group's sgRNA successfully knocked out the mCherry fluorescent protein, as evidenced by a decrease in the proportion of cells expressing both red and green fluorescent proteins in Q2.

[0082] Figure 9 shows a flow cytometric analysis of the candidate protein DZ761 after targeted knockout of mCherry fluorescent protein in 293T cells. The horizontal axis represents the intensity of green light, and the vertical axis represents the intensity of red light. The Q2 population represents cells expressing both the red fluorescent protein mCherry and the green fluorescent protein EGFP. Compared to the control group, the experimental group's sgRNA successfully knocked out the mCherry fluorescent protein, as evidenced by a decrease in the proportion of cells expressing both red and green fluorescent proteins in Q2.

[0083] Figure 10: Shows a bar chart summarizing the remaining cell population percentages for mCherry and EGFP following targeted knockout of mCherry in 293T cells using candidate proteins DZ402, DZ428, DZ738, and DZ761. As can be seen, compared to the control group, several sgRNAs successfully knocked out mCherry in each of these experimental groups, indicating a decrease in the proportion of red and green positive cells in Q2. DZ738 and DZ761 proteins demonstrated the most significant knockout effects.

[0084] Figure 11 shows the results of a positive protein SpCas9 positive screening system experiment, showing the colony formation of E. coli in the experimental and control groups on solid culture plates. The number of E. coli colonies in the experimental group corresponding to the SpCas9 protein was significantly higher than that in the control group, demonstrating the reliability of the forward screening system we constructed.

[0085] Figure 12 shows the results of DNA enzyme cleavage positive screening experiments using candidate proteins DZ402, DZ428, DZ832, DZ833, and DZ836. Figures 12A, 12B, 12C, 12D, and 12E show the colony growth of candidate proteins DZ402, DZ428, DZ832, DZ833, and DZ836, respectively. Figure 12F shows a statistical comparison of the number of E. coli colonies in the experimental and control groups for DZ402, DZ428, DZ832, DZ833, and DZ836 in the positive screening system experiment. It can be seen that the number of E. coli colonies in the experimental groups corresponding to these proteins is significantly greater than that in the control group.

[0086] Figure 13: Shows the PAM screening results of the candidate protein DZ428. It can be seen that there are significant differences in the E. coli clone colonies between the experimental group and the control group. Through second-generation sequencing and analysis, it was found that the protein has a significant base sequence preference at the 5' end, and its potential motif is 5'-NNNNNT-Spacer-3'.

[0087] Figure 14: Shows the PAM screening results of the candidate protein DZ832. It can be seen that there are significant differences in the E. coli clone colonies between the experimental group and the control group. Through second-generation sequencing and analysis, it was found that the protein has a significant base sequence preference at the 5' end, and its potential motif is 5'-NNNTNN-Spacer-3'.

[0088] Figure 15: Shows the evolutionary lineage of candidate proteins and the known Cas12 protein family, where N1 to N7 represent the Cas12 family we screened. The protein size of this family is generally very small, with most of them being less than 400 amino acids. DETAILED DESCRIPTION

[0089] This application provides a new Cas12 protein family. The protein length of the new Cas12 family members screened in this application is at least composed of 105 amino acids, and a large number of them are composed of about 200 or 300 amino acids. Such Cas12 proteins are much smaller than the existing Cas12 proteins. Such low-molecular-weight Cas12 proteins can be well packaged by delivery vectors such as adeno-associated viruses, thereby achieving the diagnosis and treatment of related diseases.

[0090] Furthermore, the proteins of the novel Cas12 family members screened in this application have different PAM preferences, expanding the toolbox for nucleic acid detection. Furthermore, the candidate proteins can be used for research in plant breeding and stress response, and in the microbial field for the transformation of related engineered bacteria.

[0091] In addition, the candidate proteins of this application, especially those less than 400 amino acids, are mostly new families (Figure 15). They are inconsistent with the evolutionary branches of the currently known cas12 family proteins. Not only have they expanded the cas12 protein family members, but they have also helped us deepen our understanding of the ultra-small cas12 protein family from an evolutionary perspective.

[0092] The following examples describe embodiments of the present invention in detail. However, those skilled in the art will appreciate that the following examples are intended to illustrate the present invention only and are not to be construed as limiting the scope of the present invention. In the examples, where specific conditions are not specified, the experiments were performed under conventional conditions or manufacturer's recommended conditions. All cell lines, reagents, or instruments used, for which the manufacturer is not specified, are commercially available conventional products.

[0093] As used in the specification, a noun without a quantifier may mean one or more than one. As used in the claims, when used in conjunction with the word "comprises", a noun without a quantifier may mean one or more than one.

[0094] The use of the term "or" in the claims is intended to mean "and / or" unless explicitly stated to refer only to alternatives or the alternatives are mutually exclusive, although this disclosure supports a limitation referring only to alternatives and "and / or." As used herein, "another" may mean at least a second or more.

[0095] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of the device error, the method being employed to determine the value, or the inherent variation that exists between the subjects. Such inherent variation may be a variation of ±10% of the stated value.

[0096] Throughout the application, unless otherwise indicated, nucleotide sequences are listed in 5' to 3' direction and amino acid sequences are listed in N-terminal to C-terminal direction.

[0097] Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that although some preferred embodiments of the present invention are shown, the detailed description and specific examples are given by way of illustration only, because various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art based on this detailed description.

[0098] definition

[0099] NCBI (https: / / www.ncbi.nlm.nih.gov / ) refers to the National Center for Bioinformation in the United States. It is a public database for the whole world. Technicians in this field can use the nucleic acid database provided by this database to download prokaryotic genomes, proteome-related databases, etc., and can also use the blast comparison software provided by this database to perform sequence comparison analysis.

[0100] IMG (https: / / img.jgi.doe.gov / ) stands for the Integrated Microbial Genome Database and represents a new generation of genome databases. It not only fully integrates the content of existing databases but also provides enhanced data upload, annotation, and analysis services, storing sequencing data in the IMG / M database. This database allows downloading of pure culture bacterial sequenced genomes, metagenomes, metagenome-assembled genomes, and single-cell sequenced genomes.

[0101] The term "CRISPR" (clustered regularly interspaced short palindromic repeats) is a locus of a nucleic acid cutting system, for example, a locus used by bacteria to destroy foreign DNA (Horvath and Barrangou, 2010, Science (327): 167-170; WO 2007 / 025097). The CRISPR locus contains a short variable DNA sequence (called a 'spacer') and a short direct repeat sequence (DR sequence). Prokaryotes, mainly referring to a string of DNA sequences in bacteria and archaea, include direct repeat (DR) regions and non-repeating spacer regions. The term "CRIPSR-Cas system" includes not only the CRISPR array locus, but also the related effector protein, i.e., the Cas protein. Together, they constitute the immune system of prokaryotes (bacteria and archaea) that defends against foreign viral invasion.

[0102] The term "RuvC domain" refers to the cleavage domain of an endogenous nuclease that cuts DNA. Currently, there are three types, including RuvCI, RuvCII, and RuvCIII, which are important DNA-cutting domains of the Cas12 protein.

[0103] The term "ABE system" is short for Adenine base editors, which refers to purine base conversion technology that can achieve single-base changes from A / T to G / C. The most commonly used enzyme is adar enzyme (adenosine deaminases acting on RNA, an adenosine deaminase acting on RNA). It mainly achieves the mutation of A / T to G / C by deaminating adenine to inosine, which is read as G when reading in DNA or RNA. Because cells are insensitive to inosine excision repair, this mutation can maintain a high product purity.

[0104] The term "CBE system" is the abbreviation of Cytidine base editor, which is a pyrimidine base conversion technology. Currently, there are BE1, BE2 and BE3 tools, among which BE3 has the highest efficiency and is therefore widely used in gene therapy, animal model preparation, and functional gene screening.

[0105] The term "protospacer adjacent motif" refers to the preference of the effector protein of the CRISPR-Cas system for the protospacer adjacent motif (PAM) and / or protospacer flanking sequence (PFS) of the target sequence when targeting the target nucleic acid sequence (target sequence).

[0106] The term "nucleic acid" means a polynucleotide and includes a single-stranded or double-stranded polymer of deoxyribonucleotides or ribonucleotide bases. Nucleic acids can also include fragments and modified nucleotides. Therefore, the terms "polynucleotide," "nucleic acid sequence," "nucleotide sequence," and "nucleic acid fragment" are used interchangeably to represent single-stranded or double-stranded RNA and / or DNA and / or RNA-DNA polymers, optionally containing synthetic, non-natural, or altered nucleotide bases. Nucleotides (usually found in their 5'-monophosphate form) are represented by their single-letter names as follows: "A" represents adenosine or deoxyadenosine (for RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0107] The term "endogenous" refers to a sequence or other molecule that occurs naturally in a cell or organism.

[0108] The terms "knockout," "cleavage," and "gene editing" are used interchangeably herein. These refer to the partial or complete inactivation of a cell's DNA sequence by gene editing using a gene editing tool (e.g., the Crispr-Cas system); for example, such a DNA sequence may have encoded an amino acid sequence or may have had a regulatory function (e.g., a promoter) prior to knockout.

[0109] "Domain" means a continuous stretch of nucleotides (which can be RNA, DNA and / or combined RNA-DNA sequences) or amino acids.

[0110] The term "conserved domain" or "motif" refers to a group of polynucleotides or amino acids that are conserved at specific positions along aligned sequences of evolutionarily related proteins. While amino acids at other positions can vary between homologous proteins, amino acids that are highly conserved at specific positions indicate that they are essential for the structure, stability, or activity of the protein. Because they are identified by their high conservation in aligned sequences of a family of protein homologs, they can be used as identifiers or "signatures" to determine whether a protein with a newly identified sequence belongs to a previously identified protein family.

[0111] A "codon-modified gene" or "codon-biased gene" or "codon-optimized gene" is a gene whose frequency of codon usage has been designed to mimic the frequency of preferred codon usage of the host cell.

[0112] An "optimized" polynucleotide is a sequence that has been optimized for improved expression in a particular heterologous host cell.

[0113] A "plant-optimized nucleotide sequence" is a nucleotide sequence optimized for expression in plants, particularly for increased expression in plants. Plant-optimized nucleotide sequences include codon-optimized genes. Plant-preferred nucleotide sequences can be synthesized by modifying the nucleotide sequence encoding a protein, such as the Cas endonucleases disclosed herein, using one or more plant-preferred codons to improve expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage.

[0114] "Promoter" is a DNA region that participates in the recognition and binding of RNA polymerase and other proteins to initiate transcription. The promoter sequence is composed of a proximal element and a more distal upstream element, the latter element being commonly referred to as an enhancer. An "enhancer" is a DNA sequence that can stimulate promoter activity and can be an intrinsic element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of the promoter. Promoters can all be derived from natural genes, or can be composed of different elements derived from different promoters existing in nature, and / or can comprise synthetic DNA segments. It will be understood by those skilled in the art that different promoters may guide the expression of genes in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. It is further recognized that, since the exact boundaries of regulatory sequences are not yet fully defined in most cases, some variant DNA fragments may have the same promoter activity.

[0115] "Host" refers to an organism or cell into which a heterologous component (polynucleotide, polypeptide, other molecule, cell) has been introduced. As used herein, "host cell" refers to a eukaryotic cell, a prokaryotic cell (e.g., a bacterial or archaeal cell) in vivo or in vitro, or a cell (e.g., a cell line) from a multicellular organism cultured as a unicellular entity, into which a heterologous polynucleotide or polypeptide has been introduced. In some embodiments, the cell is selected from the group consisting of a protocell, a bacterial cell, a eukaryotic cell, a eukaryotic unicellular organism, a somatic cell, a germ cell, a stem cell, a plant cell, an algae cell, an animal cell, an invertebrate cell, a vertebrate cell, a fish cell, a frog cell, a bird cell, an insect cell, a mammalian cell, a pig cell, a bovine cell, a goat cell, a sheep cell, a rodent cell, a rat cell, a mouse cell, a non-human primate cell, and a human cell. In some cases, the cell is an in vitro cell. In some cases, the cell is an in vivo cell.

[0116] In one embodiment, the prokaryotic cell is an Escherichia coli cell, or a Bacillus cell, or a Lactobacillus cell, or a Corynebacterium cell, or a yeast cell (Saccharomyces, Candida, or Pichia). In a further embodiment, the cell is an Escherichia coli cell, or a Bacillus subtilis cell, or a Lactobacillus acidophilus cell, or a Corynebacterium cell, or a Pichia pastoris cell.

[0117] In one embodiment, the prokaryotic cell is an E. coli K12 cell or an E. coli B cell.

[0118] In one embodiment, the prokaryotic cell is an Escherichia coli K12 cell having the genotype: thi-1, ompT, pyrF, acnA, aceA, icd (parent strain) and the genotype: thi-1, ompT, pyrF, ndh, acnA, aceA, icd (modified strain), wherein the polypeptide encoded by the acnA gene comprises an S68G mutation, the polypeptide encoded by the aceA gene comprises an S522G mutation, and the polypeptide encoded by the icd gene comprises D398E and D410E mutations. In addition, the parent and modified strains lack the following e14 phage genes: ymfD, ymfE, lit, intE, xisE, ymfI, ymfJ, cohE, croE, ymfL, ymfM, owe, ymfR, bee, jayE, ymfQ, stfP, tfaP, tfaE, stfE, pinE, mcrA.

[0119] In this application, "eukaryotic cells" can be mammalian cells, including human cells (e.g., human primary cells, established human cell lines, or cells in vivo) and non-human mammalian cells (e.g., from non-human primates (e.g., monkeys), cows / bulls / cattle, sheep, goats, pigs, horses, dogs, cats, rodents (e.g., rabbits, mice, rats, hamsters), etc.).

[0120] In this application, "host cell" can be from fish (e.g., salmon), birds (e.g., fowl, including chickens, ducks, geese), reptiles, shellfish (e.g., oysters, clams, lobsters, shrimp), insects, worms, yeast, etc. "Host cell" can also be from plants, such as monocots or dicots. The plant can be a food crop, such as barley, cassava, cotton, peanuts, corn, millet, oil palm fruit, potatoes, beans, rapeseed or canola, rice, rye, sorghum, soybeans, sugarcane, sugar beet, sunflower, and wheat. The plant can be a cereal (e.g., barley, corn, millet, rice, rye, sorghum, and wheat). The plant can be a tuber (e.g., cassava and potatoes). In some embodiments, the plant can be a sugar crop (e.g., beet and sugarcane). The plant can be an oil-bearing crop (e.g., soybean, peanuts, rapeseed or canola, sunflower, and oil palm fruit). The plant can be a fiber crop (e.g., cotton). The plant can be a tree, such as a peach or nectarine tree, an apple tree, a pear tree, an apricot tree, a walnut tree, a pistachio tree, a citrus tree (such as an orange, grapefruit, or lemon tree), a grass, a vegetable, a fruit, or an algae. The plant can be a nightshade plant; a Brassica plant; a Lactuca plant; a Spinacia plant; a Capsicum plant; cotton, tobacco, asparagus, carrots, cabbage, broccoli, cauliflower, tomatoes, eggplant, peppers, lettuce, spinach, strawberries, blueberries, raspberries, blackberries, grapes, coffee, cocoa, etc.

[0121] The term "recombinant" refers to the artificial combination of two originally separate sequence segments, for example, by chemical synthesis or by manipulation of isolated nucleic acid segments through genetic engineering techniques.

[0122] The term "plasmid" refers to a linear or circular extrachromosomal element, usually carrying a portion of a gene and usually in the form of double-stranded DNA. Such an element can be a self-replicating sequence, a genome-integrating sequence, a phage, or a nucleotide sequence derived from any source, single-stranded or double-stranded DNA or RNA, in linear or circular form, wherein a plurality of nucleotide sequences have been joined or recombined into a unique structure capable of introducing a polynucleotide of interest into a cell.

[0123] The term "expression cassette" refers to a specific vector that contains a gene and has elements other than the gene that allow the gene to be expressed in a host.

[0124] The terms "recombinant DNA molecule," "recombinant DNA construct," "expression construct," "construct," and "recombinant construct" are used interchangeably herein. A recombinant DNA construct comprises an engineered combination of nucleic acid sequences, such as regulatory sequences and coding sequences that are not all found together in nature. For example, a recombinant DNA construct can comprise regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source but arranged in a manner different from that which occurs naturally. Such constructs can be used alone or in combination with a vector. If a vector is used, the choice of vector depends on the method that will be used to introduce the vector into the host cell, as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is fully aware of the genetic elements that must be present on the vector in order to successfully transform, select, and propagate the host cell. Those skilled in the art will also recognize that different independent transformation events may result in different expression levels and patterns (Jones et al., (1985) EMBO J [European Molecular Biology Organization Journal] 4: 2411-2418; De Almeida et al., (1989) Mol Gen Genetics [Molecular Genetics and General Genetics] 218: 78-86), and therefore typically multiple events are screened to obtain lines that display the desired expression levels and patterns. Such screening can be accomplished using standard molecular biology assays, biochemical assays, and other assays, including Southern blot analysis, Northern analysis of mRNA expression, PCR, real-time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), immunoblot analysis of protein expression, enzyme assays or activity assays, and / or phenotypic analysis.

[0125] The term "heterologous" refers to the difference between the original environment, location or composition of a particular polynucleotide or polypeptide sequence and its current environment, location or composition. Non-limiting examples include taxonomically derived differences (e.g., if a polynucleotide sequence obtained from Zea mays is inserted into the genome of a rice (Oryza sativa) plant or the genome of a different variety or cultivar of maize, the polynucleotide sequence is heterologous; or if a polynucleotide obtained from bacteria is introduced into the cells of a plant, the polynucleotide sequence is heterologous) or differences in sequence (e.g., a polynucleotide sequence obtained from maize is isolated, modified and reintroduced into a maize plant). As used herein, "heterologous" with respect to a sequence can refer to a sequence that is derived from a different species, variant, alien species, or, if derived from the same species, a sequence that has been substantially modified from its native form in the composition and / or genomic locus by deliberate human intervention. For example, the promoter that is effectively linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide is derived, or, if from the same / similar species, one or both parties are substantially modified from their original form and / or genomic locus, or the promoter is not the native promoter of the polynucleotide that is effectively linked. Alternatively, one or more regulatory regions and / or polynucleotides provided herein can be synthesized in their entirety. In another example, the target polynucleotide for being cut by a Cas endonuclease can belong to an organism different from the Cas endonuclease. In another example, the Cas endonuclease and guide RNA can be introduced into the target polynucleotide together with another polynucleotide that is used as a template or donor for insertion into the target polynucleotide, wherein the other polynucleotide is heterologous to the target polynucleotide and / or the Cas endonuclease.

[0126] The term "expression" refers to the production of a functional end-product (eg, mRNA, guide RNA, or protein) in either precursor or mature form.

[0127] The terms "Cas protein", "Cas endonuclease", and "Cas enzyme" are used interchangeably herein and refer to polypeptides encoded by Cas (CRISPR-related) genes. Cas proteins include proteins encoded by genes in the cas locus and include adaptation molecules and interfering molecules. Interfering molecules of the bacterial adaptive immune complex include endonucleases. The Cas endonucleases described herein comprise one or more nuclease domains. Cas endonucleases include, but are not limited to, novel Cas12 proteins disclosed herein, Cas9 proteins, Cpf1 (Cas12) proteins, C2c1 proteins, C2c2 proteins, C2c3 proteins, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, Cas13, Cas14, or combinations or complexes of these. In the present application, the Cas12 protein may include proteins having one or more RuvC nuclease domains, InsQ superfamily domains, or Cas12 superfamily domains.

[0128] In the present application, the Cas protein is further defined as further comprising a functional fragment or derivative of a native Cas protein, such as a fragment or derivative having at least 50%, 50% to 55%, at least 55%, 55% to 60%, at least 60%, 60% to 65%, at least 65%, 65% to 70%, at least 70%, 70% to 75%, at least 75%, 75% to 80%, at least 80%, 80% to 90%, or more than 90% identical to a native Cas protein over at least 50, 50 to 100, at least 100, 100 to 150, at least 150, 150 to 200, at least 200, 200 to 250, at least 250, 250 to 300, at least 300, 300 to 350, at least 350, 350 to 400, at least 400, 400 to 450, at least 500, or more than 500 consecutive amino acids. or 100% sequence identity to a native sequence and retains at least some activity of the native sequence.

[0129] Methods for culturing prokaryotic cells are known to those skilled in the art (e.g., see Riesenberg, D., et al., Curr. Opin. Biotechnol. 2 (1991) 380-384). Any method can be used for culturing. In one embodiment, the culturing is batch culturing, fed-batch culturing, perfusion culturing, semi-continuous culturing, or culturing with full or partial cell retention.

[0130] The term "conservative amino acid substitution" refers to the interchangeability of amino acid residues with similar side chains in proteins. For example, the group of amino acids with aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; the group of amino acids with aliphatic-hydroxy side chains consists of serine and threonine; the group of amino acids with amide-containing side chains consists of asparagine and glutamine; the group of amino acids with aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; the group of amino acids with basic side chains consists of lysine, arginine, and histidine; the group of amino acids with acidic side chains consists of glutamic acid and aspartic acid; and the group of amino acids with sulfur-containing side chains consists of cysteine ​​and methionine. Exemplary conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine-glycine, and asparagine-glutamine.

[0131] Nucleic acid or polypeptide and another nucleic acid or polypeptide have certain " sequence identity " percentage, this means that when comparing the percentage of base or amino acid is identical, and when comparing two sequences, the base or amino acid is in the same relative position. Sequence identity can be determined in many different ways. In order to determine sequence identity, various convenient methods and computer programs (for example, BLAST, T-COFFEE, MUSCLE, MAFF T etc.) can be used to align sequences, and the methods and computer programs can be obtained by the world wide web at the website including ncbi.nl m.nili.gov / BLAST, ebi.ac.uk / Tools / msa / tcoffee / , ebi.ac.uk / Tools / msa / muscle / , mafft.cbrc.jp / alignment / software / . See, for example, Altschul et al. (1990), J.Mol.Bioi.215:403-10.

[0132] A DNA sequence that "encodes" a particular RNA is a DNA nucleotide sequence that is transcribed into RNA. A DNA polynucleotide can encode RNA (mRNA) that is converted into protein (thus, both DNA and mRNA encode protein), or a DNA polynucleotide can encode RNA that is not translated into protein (e.g., tRNA, rRNA, microRNA (miRNA), "non-coding" RNA (ncRNA), guide RNA, etc.).

[0133] A "protein coding sequence" or "sequence encoding a specific protein or polypeptide" refers to a nucleotide sequence that can be transcribed into mRNA (in the case of DNA) and translated into a polypeptide in vitro or in vivo (in the case of mRNA) under the control of appropriate regulatory sequences.

[0134] The terms "DNA regulatory sequence," "control element," and "regulatory element," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and / or regulate the transcription of a non-coding sequence (e.g., a guide RNA) or a coding sequence (e.g., an RNA-guided endonuclease, a GeoCas9 polypeptide, a GeoCas9 fusion polypeptide, and the like), and / or regulate the translation of the encoded polypeptide.

[0135] A "promoter" is a DNA regulatory region that is capable of binding RNA polymerase and initiating transcription of downstream (3' direction) coding or non-coding sequences. For the purposes of this disclosure, a promoter sequence is bound by a transcription start site at its 3' end and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at a detectable level above background. A transcription start site will be found within the promoter sequence, as well as a protein binding domain responsible for binding RNA polymerase. Eukaryotic promoters will typically (but not always) include a "TATA" box and a "CAT" box. Various promoters, including inducible promoters, can be used to drive expression of various vectors of this disclosure.

[0136] The term "cleavage" refers to the rupture of the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Cutting can be initiated by a variety of methods, including but not limited to enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-stranded and double-stranded cleavage are possible, and double-stranded cleavage can occur due to two distinct single-stranded cleavage events.

[0137] "Nuclease" and "endonuclease" are used interchangeably herein to refer to an enzyme with catalytic activity for nucleic acid cleavage (e.g., ribonuclease activity (ribonucleolytic cleavage), deoxyribonuclease activity (deoxyribonucleolytic cleavage), etc.).

[0138] By "cleavage domain" or "active domain" or "nuclease domain" of a nuclease is meant a polypeptide sequence or domain within a nuclease that has catalytic activity for nucleic acid cleavage. A cleavage domain may be contained within a single polypeptide chain or the cleavage activity may result from the association of two (or more) polypeptides. A single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide.

[0139] The terms "dead Cas12", "dcas12" are used interchangeably herein and have the same meaning, including the cas12 protein whose DNA cleavage activity is reduced, and also including the cas12 protein whose DNA cleavage activity is eliminated. For example, by performing at least one amino acid modification or transformation (such as insertion, deletion, change of amino terminal, etc.) on the cas12 protein screened by the application, or performing sequence truncation, the obtained protein that reduces or eliminates the DNA cleavage activity of the parent cas12 protein. Preferably, it can be that its RuvC domain, Cas12 superfamily domain and / or InsQ superfamily domain (particularly cas12k domain, cas12b domain, RuvC_1 domain and / or OrfB / InsQ domain) are modified or transformed or sequence truncation is performed.

[0140] CRISPR system

[0141] CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR-associated protein 9)-mediated RNA editing is becoming a promising tool for disease diagnosis and treatment, plant breeding, and other aspects.

[0142] CRISPR is a DNA locus containing short repetitions of base sequences. Each repetition is followed by a short segment of "spacer DNA" from previous exposure to viruses. CRISPR is found in about 40% of sequenced eubacterial genomes and 90% of sequenced archaea. CRISPR is typically associated with Cas genes that encode proteins associated with CRISPR. The CRISPR / Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements (such as plasmids and phages) and provides a form of acquired immunity. The CRISPR spacer recognizes and silences these exogenous genetic elements (such as RNAi) in eukaryotic organisms.

[0143] CRISPR repeats range in size from 24 to 48 base pairs. They typically display some two-fold symmetry, meaning they form secondary structures such as hairpins, but not true palindromes. The repeats are separated by spacers of similar length. Some CRISPR spacer sequences exactly match sequences from plasmids and phages, while some spacers match prokaryotic genomes. New spacers can be rapidly added in response to phage infection.

[0144] crRNA is the abbreviation of CRISPR RNA, which contains a DR sequence and a spacer sequence targeting the target region.

[0145] Guide RNA (gRNA) refers to a segment of RNA used by the CRISPR-Cas system to guide the action of effector proteins on specific nucleic acid sites. The CRISPR-Cas12 system includes a combination of crRNA and tracrRNA or only contains crRNA, which is used for the recognition of CRISPR-Cas12 targeted DNA sequences.

[0146] The gRNA sequence described in the present application mainly includes a direct repeat (DR) sequence and a sequence of the spacer region targeting the target sequence portion. For a candidate protein with tracrRNA, the gRNA corresponding to the protein also includes a trans-acting CRISPR RNA (tracrRNA).

[0147] Nuclease

[0148] Cas nuclease. CRISPR-related (Cas) genes are generally associated with CRISPR repeat-spacer arrays. As of 2013, more than 40 different Cas protein families have been described. Among these protein families, Cas1 is ubiquitous in different CRISPR / Cas systems. Specific combinations of Cas genes and repeat sequence structures have been used to define 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube), some of which are associated with additional gene modules encoding repeat-associated mysterious proteins (RAMPs). More than one CRISPR subtype may exist in a single genome. The sporadic distribution of CRISPR / Cas subtypes suggests that the system has undergone horizontal gene transfer during microbial evolution.

[0149] The exogenous DNA is apparently processed into small elements (about 30 base pairs in length) by proteins encoded by the Cas genes, which are then somehow inserted into the CRISPR locus near the leader sequence. RNA from the CRISPR locus is constitutively expressed and processed by the Cas protein into small RNAs consisting of separate exogenous sequence elements with flanking repeats. RNA guides other Cas proteins to silence exogenous genetic elements at the RNA or DNA level.

[0150] Example

[0151] Example 1: Screening of novel Cas12 proteins

[0152] Download all bacterial, archaeal genome and metagenome sequences from NCBI and IMG as of July 2021, and use CRISPR array identification software (such as Pilercr) to identify the CRISPR array region; search for 6 adjacent proteins upstream and downstream of the CRISPR array region for target domain analysis.

[0153] The amino acid sequence numbers, DNA cleavage domain types and other information of the obtained candidate proteins are shown in Table 3. The candidate proteins screened have RuvC domains, InsQ, or Cas12 superfamily domains.

[0154] Example 2: Functional verification of knockdown of 293T endogenous genes by novel candidate Cas12 protein

[0155] In order to verify the ability of the candidate proteins screened in Example 1 to cut endogenous genes, we selected DZ356, DZ738, DZ761, DZ837 and other proteins from the candidate proteins (Table 3) and the positive control LbCas12 protein to cut the endogenous gene (TYR) of 293T cells.

[0156] First, two sgRNAs (containing crRNA and tracrRNA) were randomly designed for the TYR endogenous gene, and the corresponding plasmids were constructed, namely sg1 (targeting spacer sequence is atgctttgctaaagtgaggt (SEQ ID NO: 285)) and sg2 (targeting spacer sequence is gatgcattattatgtgtcaa (SEQ ID NO: 286)).

[0157] Then, sgRNA and candidate protein were transiently transfected into 293T cell line (HEK-293T, commercially available). After 48 h, the top 15% positive cells were flow cytometry sorted for deep-seq library construction and sequencing.

[0158] The sequencing results aligned to the TYR sequence near sg1 and sg2, which target the TYR gene. Through de-redundancy and PCR amplification, a bam file suitable for IGV visualization was generated. Figure 5 shows the results of the Yangshen protein LbCas12 cleaving the endogenous TYR gene in 293T. It can be seen that the experimental group exhibited many faults and indels near sg1 and sg2, while the control group did not. This demonstrates that the system we constructed for cleaving endogenous genes in eukaryotic cells is reliable. As shown in Figures 1 to 4, the experimental groups of candidate proteins DZ356, DZ738, DZ761, and DZ837 exhibited a certain degree of faults and partial indels near the sgRNA, while the control group had a very clean background and almost no faults near the TYR designed sgRNA, indicating that the candidate proteins have the potential to cleave DNA.

[0159] Example 3: Knockdown of candidate protein mCherry fluorescent protein

[0160] In order to detect the effect of candidate proteins on cutting exogenously expressed genes, an mCherry-expressing plasmid (expressing red light) and a candidate protein and an all-in-one plasmid corresponding to mCherry were constructed (the plasmid carries GFP fluorescent protein). The all-in-one plasmid uses the CMV promoter to start the candidate protein and simultaneously expresses GFP green light through T2A. At the same time, the u6 promoter is used to start the sgRNA targeting mCherry; and the two are constructed into one plasmid, which is an all-in-one plasmid. By transiently transfecting the 293T cell line, flow cytometry analysis was performed after 72 hours. The results are shown in Figures 6 to 9. Compared with the control group, the experimental groups of DZ402, DZ428, DZ738, and DZ761 can affect the expression of mCherry to a certain extent; the remaining rate of red and green dual light after the candidate protein cuts mCherry (Q2 area of ​​the flow analysis) is further counted, and the results are shown in Figure 10.

[0161] Example 4: Verification of the cleavage activity of candidate proteins in prokaryotes

[0162] With reference to Lee, JK, Jeong, E., Lee, J. et al. Nat Commun 9, 3048 (2018), a method for positively screening Cas9 protein mutants using Escherichia coli was used. By introducing a lethal protein gene called ccdb (source Bernard, P. and M. Couturier, Cell killing by the F plasmid CcdB protein involves poisoning of DNA-topoisomerase II complexes. J Mol Biol, 1992. 226 (3): p. 735-45), it was induced to express, which would lead to the death of Escherichia coli. When the cutting target of the CRISPR / Cas system is set on the ccdb lethal protein gene, once cutting occurs, it will show that Escherichia coli survives and grows a single clone.

[0163] Figure 11 shows the results of an experiment using SpCas9 to cleave a toxic protein. The experimental group showed many monoclonal colonies, while the control group had almost none, demonstrating the reliability of our constructed positive screening system.

[0164] Figure 12 shows the experimental results of DNA enzyme cleavage positive screening of candidate proteins DZ402, DZ428, DZ832, DZ833 and DZ836. The culture media of DZ402, DZ428, DZ832, DZ833 and DZ836 all produced a large number of single clones, indicating that they can effectively cleave the toxic protein ccdb, while the negative control culture media produced very few or almost no clones.

[0165] The base sequence of the lethal protein expressing ccdb used in this example is as follows:

[0166] Example 13: PAM screening of novel candidate proteins

[0167] For the functional proteins with cleavage activity identified in the above screening, we also used a negative screening method in E. coli to examine the PAMs of candidate proteins, referring to Zetsche et al., 2015, Cell 163, 759–771. Since E. coli lacks a double-strand break repair mechanism, cleavage on a plasmid results in plasmid deletion. Therefore, a 6-N PAM library can be designed, and the plasmid containing this library carries antibiotic resistance. The targeting sequence for the CRISPR / Cas system can be designed on the plasmid containing this 6-N PAM library. Cleavage of specific PAMs by the Cas protein will result in plasmid loss, i.e., a corresponding loss of resistance. Consequently, the protein will not survive in antibiotic-containing medium, while those with mismatched PAMs will not undergo cleavage, allowing the corresponding E. coli to survive. This will manifest as fewer E. coli single colonies in the experimental group than in the control group. Further amplicon sequencing of these colonies and comparison of the differential PAMs between the experimental and control groups can reveal the sequence preference motif for the protein's nucleic acid cleavage.

[0168] The experimental results showed that DZ428 and DZ832 have PAMs. Figure 13 shows the PAM screening results for DZ428. It can be seen that the E. coli clones in the experimental and control groups are significantly different. Next-generation sequencing and analysis revealed that the modified protein has a significant base sequence preference at the 5' end, and its potential motif is 5'-NNNNNT-Spacer-3', where N represents any one of A, T, C, or G. Figure 14 shows the PAM screening results for DZ832. It can be seen that the E. coli clones in the experimental and control groups are significantly different. Next-generation sequencing and analysis revealed that the modified protein has a significant base sequence preference at the 5' end, and its potential motif is 5'-NNNTNN-Spacer-3', where N represents any one of A, T, C, or G.

[0169] Example 6: DNA nucleic acid detection function of the new candidate Cas12 protein

[0170] Given the very strong non-specific bystander DNase activity of the candidate Cas12 protein, it has potential applications in DNA detection, such as DNA viruses and tumor signaling DNA molecules. Simply put, by constructing a CRISPR-Cas system that can cut the target detection nucleic acid (for example, it can be in the form of a test strip, or it can be delivered by a vector coating, etc.), including the candidate CRISPR-Cas12 protein, sgRNA (targeting the target detection virus DNA) and the reporter detection molecule (such as a DNA fluorescent reporter molecule), then when the system binds to the target DNA, it can exert the bystander DNase activity of the candidate Cas12 protein and continue to cut the reporter detection molecule, thereby causing the signal molecule to emit a signal, such as fluorescence. These signals can be received by the detection instrument and converted into electrical signals that can be read out, so that the purpose of detecting the target nucleic acid can be achieved. For example, further integration of machine learning algorithm models can further quantify and predict the target nucleic acid. Therefore, it can be widely used in virus detection, such as HPV virus detection; it can also be widely used in non-invasive diagnosis of diseases (such as tumors), such as liquid biopsy.

[0171] Example 7: Verification of base editing function of the new compact candidate Cas12 protein

[0172] There are currently two main systems for single-base editing, one is the ABE system and the other is the CBE system. Simply put, the DNA cleavage domain (RuvC domain and / or HNH domain) of the candidate Cas12 protein is mutated to obtain a candidate dCas12 protein that only binds to DNA but has no cutting activity, and then the adar enzyme sequence is fused to construct a plasmid for the ABE single-base editing system. Then, the sgRNA for site-directed base mutation of a specific sequence, such as the TYR gene, is designed and the corresponding plasmid vector is constructed. Then, the human 293T cell line is co-transfected, and flow cytometry is performed 48 hours later to obtain the co-transfected cell line. Then, primers are designed 50bp upstream and downstream of the sgRNA, and the target region DNA fragment is amplified, followed by deep-seq library construction and sequencing. After sequencing, the single-base editing efficacy analysis of the corresponding ABE system can be obtained by analyzing the mutation of the DNA near the TYR gene sgRNA design using bioinformatics methods. Thus, the optimal single-base editing system for the target region can be constructed by continuously optimizing the sgRNA.

[0173] Example 8: Homology analysis of candidate Cas12 proteins and known Cas12 proteins

[0174] It is based on the principle that the higher the coverage of the unknown protein in the known protein and the greater the similarity ratio, the closer the homology of the unknown protein to the known protein. After screening the candidate proteins, we first download the relevant protein sequences of Cas12, such as LbCas12a, from the NCBI database and patent literature, and then merge them with our data to build a local blastp index file, and then align the candidate protein sequence to the local blastp index library for protein sequence alignment analysis. For proteins with a similarity (identity) less than 20% or that cannot be aligned to the local index library, we uniformly mark them as 20%; similarly, for coverage (coverage) less than 5% or that cannot be aligned to the local index library, it is marked as 1%. The new Cas12 protein identified by the method of the present invention has a very low level of homology with the known Cas12 proteins of each family. For example, the homology of DZ318, DZ319, DZ325, etc. to the currently known Cas12 categories is less than 65%. Some proteins also have low similarity with the guide RNA-dependent DNA nuclease TnpB, such as DZ380, DZ837, DZ845, etc., whose homology with the currently known TnpB types is less than 60%.

[0175] Through phylogenetic analysis (Figure 15), we found that the candidate proteins screened not only extend the known Cas12 protein family members, but also discovered seven new families that are very distant from the currently known Cas12 family proteins. The amino acid size of these family proteins is generally less than 400 amino acids, which expands our understanding of the ultra-small Cas12 protein family.

[0176] Example 9: Preference Optimization

[0177] Based on past research, Cas12 protein may have a strong preference (PAM) when targeting DNA sequences. Therefore, it is possible to obtain better cleavage activity results by further optimizing the preference of Cas12 protein disclosed in the present application.

[0178] The DR sequences of candidate Cas12 proteins are shown in Table 1 below.

[0179] Table 1. DR sequences of candidate Cas12 proteins

[0180] See Table 2 for a summary of the tracrRNA sequence information of the candidate proteins.

[0181] Table 2. TracrRNA coding sequences of candidate Cas12 proteins

[0182] The amino acid sequence number, length, and domain superfamily type of the final candidate Cas12 protein are shown in Table 3.

[0183] Table 3. Summary of candidate Cas12 proteins

Claims

1. Cas12 protein comprising an amino acid sequence as described in any one of SEQ ID NOs: 1 to 104, or a functional fragment thereof, or an amino acid sequence as described in any one of SEQ ID NOs: 1 to 104 having one or more amino acid substitutions, insertions, and / or deletions.

2. Cas12 albumen according to claim 1, described albumen has the activity of knocking in, knocking out or changing that DNA realizes gene.

3. The Cas12 protein according to claim 1, wherein the Cas12 protein has a RuvC domain, a Cas12 superfamily domain, and / or an InsQ superfamily domain, and at least one amino acid in the RuvC domain, the Cas12 superfamily domain, and / or the InsQ superfamily domain is further modified or modified to reduce or eliminate its DNA cleavage activity, thereby becoming a dCas12 in which DNA cleavage activity is reduced or eliminated; Preferably, the Cas12 protein is fused with one or more heterologous functional domains, wherein the fusion is at the N-terminus, C-terminus or inside the Cas12 protein; More preferably, the heterologous functional domain is capable of cleaving one or more target sequences, or modifying the transcription or translation of a target sequence.

4. The Cas12 protein according to claim 3, wherein the one or more heterologous functional domains have the following activities: deaminases such as cytidine deaminase and deoxyadenosine deaminase, methylases, demethylases, transcriptional activation, transcriptional repression, nucleases, single-stranded DNA cleavage, double-stranded DNA cleavage, DNA or RNA ligases, reporter proteins, detection proteins, localization signals, or any combination thereof.

5. The protein according to any one of claims 1 to 4, wherein the Cas12 protein contains a RuvC domain, a Cas12 superfamily domain, and / or an InsQ superfamily domain; Preferably, the Cas12 protein contains a cas12k domain, a cas12b domain, a RuvC_1 domain, and / or an OrfB / InsQ domain.

6. Cas12 protein according to claim 5, wherein the amino acid replacement, insertion and / or deletion are included in RuvC domain, Cas12 superfamily domain and / or InsQ superfamily domain and replace, insert and / or disappearance.

7. Cas12 protein according to claim 6, after one or more amino acid substitutions, insertions, and / or deletions, the Cas12 protein reduces or eliminates the activity of knocking in, knocking out, or changing a gene on DNA.

8. a nucleic acid molecule comprising a nucleotide sequence encoding the Cas12 protein according to any one of claims 1 to 7.

9. The nucleic acid molecule according to claim 8, which is codon-optimized for expression in a host cell.

10. The nucleic acid molecule according to claim 8 or 9, wherein the host cell is a prokaryotic cell or a eukaryotic cell, preferably an animal cell, a plant cell, or a microbial cell.

11. according to the nucleic acid molecule described in any one of claim 8 to 10, it comprises the promoter effectively linked to the nucleotide sequence encoding the Cas12 protein, and preferably the promoter is a constitutive promoter, an inducible promoter, a tissue-specific promoter, an artificial synthetic promoter, a mosaic promoter or a development-specific promoter.

12. An expression vector comprising the nucleic acid molecule according to any one of claims 8 to 11.

13. The expression vector according to claim 12, further comprising a crRNA sequence and / or a tracr RNA sequence.

14. The expression vector of claim 13, further comprising a regulatory element for regulating the nucleic acid molecule, a regulatory element for regulating the crRNA sequence, and / or a regulatory element for regulating the tracr RNA sequence.

15. The expression vector according to claim 14, which is a viral vector, nanoparticle, nanoliposome particle (LNP), cationic polymer (such as PEI), liposome, exosome, virus-like particle (VLP), microvesicle or gene gun; Preferably, the viral vector comprises: Adeno-associated virus (AAV), recombinant adeno-associated virus (rAAV), adenovirus, lentivirus, retrovirus, herpes simplex virus, or oncolytic virus.

16. A CRISPR-Cas system comprising: (1) the Cas12 protein or its derivative or functional fragment according to any one of claims 1 to 7, or the nucleic acid molecule according to any one of claims 8 to 11; (2) a gRNA sequence for targeting a target sequence.

17. The CRISPR-Cas system according to claim 16, wherein the functional fragment of the Cas12 protein is a fragment of the amino acid sequence as described in any one of SEQ ID NO: 1 to 104, which comprises a deletion of at least one amino acid and retains the function of the Cas12 protein.

18. The CRISPR-Cas system according to claim 16 or 17, wherein the derivative of the Cas12 protein is a protein having 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more amino acid sequence identity with any protein in SEQ ID NO: 1 to 104 or a functional fragment thereof; Preferably, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids are inserted, deleted, and / or substituted based on the amino acid sequence of any one of SEQ ID NOs: 1 to 104.

19. The CRISPR-Cas system of claim 18, wherein the gRNA sequence comprises a direct repeat (DR) sequence, a trans-acting CRISPR RNA (tracrRNA), and a sequence of a spacer region that targets a portion of the target sequence.

20. The CRISPR-Cas system of claim 19, wherein the DR sequence is a sequence shown in any one of SEQ ID NOs: 105 to 262 or a sequence shown in any one of SEQ ID NOs: 269 to 276.

21. The CRISPR-Cas system of claim 19, wherein the tracrRNA sequence is any one of SEQ ID NOs: 263 to 268.

22. The CRISPR-Cas system according to claim 19, wherein the spacer sequence is 10-50 nucleotides, preferably 15-25 nucleotides, more preferably 20 nucleotides.

23. The CRISPR-Cas system according to claim 19, wherein the DR sequence is any one of the following derivatives (i) to (iv), wherein: The derivative (i) has one or more nucleotide additions, deletions, or substitutions compared to any one of the sequences shown in SEQ ID NOs: 105 to 262 or any one of the sequences shown in SEQ ID NOs: 269 to 276; The derivative (ii) is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 2500%, 3000%, 4000%, 5000%, 6000%, 7000%, 8000%, 9000%, 10000%, 25000%, 30000%, 40000%, 50000%, 60000%, 70000%, 80000%, 90000%, 100000%, 250000%, 300000%, 500000%, 600000%, 700000%, 800000%, 800000%, 900000%, 1000000 95% or 97% sequence identity; The derivative (iii) hybridizes under stringent conditions with any one of the sequences shown in SEQ ID NOs: 105 to 262 or any one of the sequences shown in SEQ ID NOs: 269 to 276, or with any one of (i) and (ii); or The derivative (iv) is the complement of any one of the derivatives (i)-(iii), provided that the derivative is not any one of the sequences shown in any one of SEQ ID NOs: 105 to 262 or any one of the sequences shown in any one of SEQ ID NOs: 269 to 276, and the derivative encodes RNA, or is itself RNA, and the RNA maintains substantially the same secondary structure as any RNA encoded by any one of SEQ ID NOs: 105-262 or any one of SEQ ID NOs: 269 to 276.

24. The CRISPR-Cas system according to claim 23, wherein the tracrRNA sequence comprises a pairing base that can be reverse complementary to the DR sequence, preferably the tracrRNA sequence and the DR sequence form at least 6 base pairings, 8 base pairings, 10 base pairings or 12 base pairings, and the base pairings are continuous pairings or intermittent pairings. Preferably, the tracrRNA sequence is the sequence shown in any one of SEQ ID NOs: 263 to 268.

25. The CRISPR-Cas system according to claim 24, wherein the tracrRNA is any one of the following derivatives (i) to (iv), wherein: The derivative (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) nucleotide additions, deletions, or substitutions compared to any of the sequences shown in any one of SEQ ID NOs: 263 to 268; The derivative (ii) has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 97% sequence identity with any one of the sequences shown in any one of SEQ ID NOs: 263 to 268; The derivative (iii) hybridizes under stringent conditions with any one of the sequences shown in any one of SEQ ID NOs: 263 to 268, or with any one of (i) and (ii); or The derivative (iv) is the complement of any one of the derivatives (i)-(iii), provided that the derivative is not any one of the sequences shown in any one of SEQ ID NOs: 263 to 268, and the derivative encodes RNA, or is itself RNA, and the RNA maintains substantially the same secondary structure as any RNA encoded by SEQ ID NOs: 263-268.

26. The CRISPR-Cas system according to any one of claims 16-25, further comprising: (3) target DNA. Preferably, the CRISPR-Cas system causes cleavage of the target DNA sequence, sequence alteration, single-base editing, sequence insertion or deletion, sequence modification or degradation, or delivers epigenetic modifiers or transcriptional or translational activation or repression signals at or near the target DNA.

27. The CRISPR-Cas system of claim 26, wherein the target DNA is double-stranded DNA, single-stranded DNA, double-stranded circular DNA, or single-stranded circular DNA.

28. A method for degrading or cutting a target sequence in a target cell, modifying a target sequence in a target cell, or delivering an exogenous nucleic acid to a cell or cell vicinity comprising a target sequence, comprising using the Cas12 protein according to any one of claims 1 to 7, the nucleic acid molecule according to any one of claims 8 to 11, the expression vector according to any one of claims 12 to 15, or the CRISPR-Cas system according to any one of claims 16 to 27.

29. The method according to claim 28, wherein the target cell is a prokaryotic cell or a eukaryotic cell, preferably an animal cell, a plant cell, or a microbial cell.

30. The method of claim 29, wherein the target cell is an in vitro cell or an in vivo cell.

31. A method for detecting a target DNA, which utilizes the Cas12 protein or its derivative or functional fragment according to any one of claims 1 to 7, the Cas12 protein or its derivative or functional fragment expressed by the nucleic acid molecule according to any one of claims 8 to 11, the Cas12 protein or its derivative or functional fragment expressed by the expression vector according to any one of claims 12 to 15, or the CRISPR-Cas system according to any one of claims 16 to 27 to detect the target DNA.

32. The method according to claim 31, further comprising using an sgRNA targeting the target DNA and a reporter detection molecule, and utilizing the Cas12 protein or its derivative or functional fragment as described in any one of claims 1 to 7, the Cas12 protein or its derivative or functional fragment expressed by the nucleic acid molecule as described in any one of claims 8 to 11, the Cas12 protein or its derivative or functional fragment expressed by the expression vector as described in any one of claims 12 to 15, or the CRISPR-Cas system as described in any one of claims 16 to 27 to bind to the target DNA to exert the side-cutting DNA cleavage activity of the Cas12 protein to cut the reporter molecule and detect the signal emitted by the reporter detection molecule.

Images