Construction method of overexpression MR-1 transgenic colorectal cancer model mouse

Abstract

The invention relates to a construction method of an overexpression MR-1 transgenic colorectal cancer model mouse, which comprises the following steps: step 1, construction of a PNKD gene knock-in model mouse; step 2, constructing a Vil1-cre tool mouse; step 3, constructing a transgenic mouse of which the large intestine epithelial cells overexpress MR-1; and step 4, constructing a mouse of the AOM / DSS induced cPNKD-KI transgenic colorectal cancer model.

Description

Technical Field

[0001] The invention belongs to the technical field of pharmaceutical molecular biology, and particularly relates to a method for constructing a MR-1 overexpressing transgenic colorectal cancer mouse model. Background Art

[0002] Currently, the commonly used technologies for constructing colorectal cancer models include the following:

[0003] 1. Tumor cell transplantation model: Colon cancer cells (commonly used MC-38, CT26 and other cells) are transplanted into the subcutaneous part of mice to form tumors. This model can simulate different subtypes and mutations by selecting different colon cancer cell lines. The advantages are that it is easy to establish and operate, and can form tumors quickly. The disadvantage is that it lacks the interaction between the tumor microenvironment and the immune system, and may not be able to fully simulate the complexity of the tumor.

[0004] 2. Chemical induced model: Use chemical substances (such as carcinogens) to induce colorectal cancer in mice. This model can simulate the effects of certain environmental factors on the occurrence of colorectal cancer. The most commonly used reagents for establishing colorectal cancer induced models are dimethylhydrazine (DMH) and azoxymethane (AOM), and AOM is more stable than DMH. In order to shorten the experimental cycle and stabilize the colorectal cancer tumor condition, it can be used in conjunction with dextran sulfate sodium (DSS). The advantage is that it is relatively simple and easy, and can simulate colorectal cancer caused by environmental exposure. The disadvantage is that the selection and dosage of chemicals need to be carefully controlled, and may not be able to fully simulate the diversity of human colorectal cancer.

[0005] 3. Transgenic animal model: Gene editing technology (such as CRISPR / Cas9) or transgenic technology is used to introduce mutations or overexpression of genes related to colorectal cancer. At present, the research on transgenic colorectal cancer models mainly focuses on the establishment and observation of benign adenoma models. The related genes are mainly concentrated on APC and MMR genes. APC or MMR genes are mutated by injecting gene mutation viruses to construct colorectal cancer mouse models. The disadvantage is that it takes a long time to establish and maintain these models and the incidence of colorectal cancer is still low. Summary of the invention

[0006] The present invention relates to an animal model for inducing colorectal cancer by knocking in MR-1 gene, improving the success rate of constructing colorectal cancer mice, advancing the onset time and shortening the experimental period.

[0007] The animal model of the present invention more accurately simulates the development process of human colorectal cancer.

[0008] The animal model of the present invention is characterized in that the MR-1 gene is knocked in, and the animal model is preferably a rodent, such as a mouse, more preferably a rat or a mouse.

[0009] The so-called model constructed by the present invention is actually a model mouse with colorectal cancer. The mouse has the ability to overexpress MR-1. After colorectal cancer cells are injected or induced, the prepared model mouse suffers from colorectal cancer. This colorectal cancer model can be used in the laboratory to study drugs or colorectal cancer treatment and disease diagnosis and analysis. The construction method of the present invention can quickly and accurately prepare colorectal cancer model mice in large quantities.

[0010] To this end, the present invention provides a method for constructing a colorectal cancer model mouse, the method comprising the following steps:

[0011] Step 1, construction of PNKD gene knock-in model mice;

[0012] Step 2, construction of Vil1-cre tool mice;

[0013] Step 3, construction of transgenic mice overexpressing MR-1 in colon epithelial cells;

[0014] Step 4, construction of AOM / DSS-induced cPNKD-KI transgenic colorectal cancer model mice.

[0015] Wherein, step 1, construction of PNKD gene knock-in model mice, further comprises the following steps:

[0016] (1) sgRNA design and vector construction: According to the design principles of the target site region, Cas9 / sgRNA was designed and sgRNA was linked to a plasmid vector with a T7 promoter. In vitro transcription was performed, and the construction of the targeting vector was confirmed by enzyme digestion and sequencing.

[0017] (2) The sgRNA sequence used in this step is: 5'-AAGGCCGCACCCTTCTCCGGAGG-3'

[0018] (3) Mouse fertilized egg injection: The Cas9 / sgRNA targeting vector was microinjected into mouse fertilized eggs to construct PNKD gene knock-in mice.

[0019] (4) Identification of the tail genotype of the F0 generation mice and mating: Mice with positive genotype identification results are selected from the F0 mice and mated with wild-type mice to obtain F1 generation mice with stable genotypes.

[0020] (5) Genotype identification and expression detection of F1 mice: Genotype identification of F1 mice can be performed by using RT-PCR and Southern blot technology to detect the expression of the PNKD gene. F1 mice with stable genotypes are screened and then bred to obtain F1 mice with PNKD overexpression transgenes.

[0021] The genotyping primers used in this step are as follows:

[0022] Cre-F:TGTAGAGAAGGCACTTAGC

[0023] Cre-R: CCAGGTTACGGATATAGTTCA

[0024] Among them, step 2, construction of Vil1-cre tool mice, further includes the following steps: Vil1-cre mice have Cre recombinase driven by Villin1 promoter, which can specifically knock out target genes with flox in villus and crypt cells of small intestine and large intestine, and are important tool mice for studying intestinal organ formation. Strain number: VSM000023 Strain name: B6.Cg-Tg (Vil1-Cre) / V, referred to as Vil1-cre Vil1-cre tool mice are genotyped using RT-PCR technology.

[0025] The primer sequences used are as follows:

[0026] Cre-F TGTAGAGAAGGCACTTAGC

[0027] Cre-R CCAGGTTACGGATATAGTTCA

[0028] Wherein, step 3, construction of transgenic mice in which colon epithelial cells overexpress MR-1, further comprises the following steps:

[0029] Vil1-cre mice were mated with PNKD knock-in mice, and the expression level of MR-1 in the intestinal epithelial tissue of transgenic mice was detected by Western blotting. Mice with MR-1 overexpression were screened and named cPNKD-KI mice.

[0030] Wherein, step 4, construction of AOM / DSS-induced cPNKD-KI transgenic colorectal cancer model mice, further comprises the following steps:

[0031] The transgenic mice of the control group (Vill-Cre) and the intestinal epithelial cell-directed overexpression MR-1 group (cPNKD-KI) were intraperitoneally injected with 12.5 mg / kg of AOM (azomethane), and were fed alternately with pure water at a predetermined time period (a total of 65 days) to induce the occurrence and development of colorectal cancer. The resulting mice with colorectal cancer are the colorectal cancer model mice of the present invention.

[0032] The present invention further relates to the use and function of the mouse model. The present invention further conducts the following functional tests on the prepared mouse model: the effect of MR-1 overexpression on the metastasis and invasion of colorectal cancer, and comprehensively evaluates the effect of MR-1 overexpression on the metastasis and invasion of colorectal cancer from the perspectives of the general living conditions of mice, the number and diameter of tumors, the degree of spleen metastasis and histopathology.

[0033] Genotype identification: The present invention uses reliable RT-PCR technology to identify the genotype of mice and confirms that the desired transgenic mice are successfully constructed. The resulting mice with colorectal cancer are the colorectal cancer model mice of the present invention.

[0034] Explanation of terms and terms:

[0035] 1. Overexpression: refers to the expression level of a gene in a cell or organism being higher than the normal level. It is usually achieved by introducing exogenous DNA or increasing the number of gene copies. Overexpression can be used to study gene function, protein function and its effects in organisms.

[0036] 2. Transgenic: refers to the process of introducing foreign genes or DNA sequences into an organism. Transgenic technology usually involves introducing foreign genes into the genome of the target organism so that they can be expressed in the cells of the target organism.

[0037] 3. Colorectal cancer: Also known as colorectal cancer, it is a common type of cancer. Colorectal cancer is the third most common cancer in the world, accounting for about 10% of all cancer cases. It is also the second leading cause of cancer-related deaths worldwide. Adenocarcinoma is the most common pathological type, and very few are squamous cell carcinomas. Colorectal cancer mainly affects the elderly, with most cases occurring in people aged 50 and above, and more in men than in women.

[0038] 4. Myofibrillogenesis regulator 1 (MR1): is a protein that is involved in regulating the formation and organization of muscle fibers. It plays an important role in muscle development and muscle cell function.

[0039] 5. PNKD: PNKD stands for Paroxysmal nonkinesigenic dyskinesia, a rare movement disorder that presents as intermittent, non-motor-induced involuntary movements, including muscle spasms, muscle twisting, and limb incoordination.

[0040] 6. Gene editing technology (such as CRISPR / Cas9): Gene editing technology is a method used to modify the genome of an organism. CRISPR / Cas9 is a commonly used gene editing tool that uses the guide RNA (sgRNA) and Cas9 protein of the CRISPR-Cas9 system to achieve precise editing of the genome, including gene knockout, gene knockin, and gene modification.

[0041] 7. PNKD gene knock-in: PNKD gene knock-in refers to the introduction of the PNKD gene into the genome of the target organism so that it can be expressed in the cells of the target organism.

[0042] 8.sgRNA: sgRNA stands for single-guide RNA, which is an RNA molecule in the CRISPR / Cas9 system. sgRNA binds to the Cas9 protein and guides the Cas9 protein to accurately identify and cut specific DNA sequences in the target genome, thereby achieving genome editing.

[0043] 9. T7 promoter plasmid vector: T7 promoter is a commonly used promoter sequence that can promote the transcription process of genes. Plasmid vectors are DNA molecules used to carry foreign DNA fragments. T7 promoter plasmid vectors are plasmid vectors containing T7 promoter sequences, which are used to express genes compatible with T7 promoter in cells.

[0044] 10. Targeting vector: A targeting vector is a vector used to guide genome editing tools (such as CRISPR / Cas9 system) to the target genomic site. It usually contains a DNA sequence complementary to the target genomic site to guide the accurate positioning and cutting of the editing tool.

[0045] 11.RT-PCR: RT-PCR (Reverse Transcription Polymerase Chain Reaction) is a technique used to detect and amplify RNA molecules. It first converts RNA into cDNA through reverse transcription, and then uses polymerase chain reaction (PCR) to amplify the target DNA sequence.

[0046] 12. Southern blot: It is a technique used to detect specific DNA sequences. It involves separating the DNA sample by electrophoresis, using DNA probes to specifically bind to the target DNA sequence, and then detecting the presence of the target DNA sequence by radioactive or fluorescent labeling of the probes.

[0047] 13.Vil1-cre: Cre recombinase driven by the Villin1 promoter can specifically knock out the target gene with flox in the villi and crypt cells of the small and large intestines. Cre recombinase is a commonly used gene recombination tool used to induce gene recombination in specific cell types.

[0048] 14. AOM / DSS induction: In genetically engineered mouse studies, AOM / DSS can be used as an inducer to promote the development of intestinal tissue inflammation. The AOM / DSS model is a powerful, reproducible and relatively inexpensive starting promotion model that utilizes chemical induction of DNA damage and then repeated colitis cycles.

[0049] Beneficial Effects of the Invention

[0050] 1. The Vil1-cre and PNKD gene targeted intestinal knock-in mice obtained by the present invention can form a colorectal cancer model, improve the success rate of constructing colorectal cancer mice, advance the onset time, and shorten the experimental period.

[0051] 2. The constructed model is a natural colorectal cancer pathogenesis model, which simulates the human disease process and can provide a good research and application model for the occurrence of colorectal cancer and the development of colorectal cancer drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 :AOM / DSS-induced colorectal cancer model in mice

[0053] Figure 2 :A: Cas9 / sgRNA targeting vector map; B: Southern identification results of F1 generation genotype

[0054] Figure 3 :PCR detection of Cre gene in mouse tissue, 1.5% agarose gel, 2# / 3# is Vil1-cre(+), 1# is WT

[0055] Figure 4 .PCR detection of the expression of MR-1 gene in mouse toes. #1 / #2 / #3 / #6 / #8 are Vil1-cre(+), #4 is cPNKD-KI(heterozygous), #5 / #7 are MR-1KI(heterozygous), M is Marker

[0056] Figure 5 :Anal prolapse in cPNKD-KI mice

[0057] Figure 6 :MR-1 promotes the disease progression of AOM / DSS-induced colorectal cancer in mice. A: Representative images of H&E staining of intestinal tissues of Vill-Cre mice and cPNKD-KI mice; B: Tumor data and size of mouse intestinal tissues

[0058] Figure 7 :MR-1 promotes splenic metastasis of colorectal cancer in mice DETAILED DESCRIPTION

[0059] Example 1: Construction of PNKD gene knock-in model mice

[0060] Based on the principle of homologous recombination, gene targeting technology ( Figure 2 A), CAG promoter, loxp-Stop-loxp regulatory element and EGE-PNKD-CDS-IRES-EGFP-WPRE-pA expression element were inserted into the Rosa26 locus, and then the gene knock-in mice were constructed by injecting Cas9 / sgRNA into fertilized eggs. F0 generation mice were born after microinjection into mouse fertilized eggs. The F0 generation tail type positive mice were mated with wild-type C57BL / 6 mice, and the genotype of the F1 generation mice was identified by Southern technology to obtain F1 generation mice with stable genotypes.

[0061] Figure 2 :A: Cas9 / sgRNA targeting vector map; B: Southern identification results of F1 genotype

[0062] Example 2: Genotype identification of Vil1-cre tool mice

[0063] PCR technology was used to identify the genotype of Vil1-cre tool mice. The results showed that Vil1-cre mice can clearly express the Cre gene. The specific results are as follows:

[0064] Figure 3 :PCR detection of Cre gene in mouse tissue, 1.5% agarose gel, 2# / 3# is Vil1-cre(+), 1# is WT

[0065] Example 3: Screening of transgenic mice with overexpression of MR-1 in colon epithelial cells

[0066] Vil1-Cre mice were crossed with cMR1-KI mice to obtain the desired cPNKD-KI mice (directed to highly express the MR-1 gene in intestinal tissue). The toes of the mice were taken for genotyping at 2 weeks of age, and wild-type mice were eliminated in time. Vil-1-cre mice were used as control mice.

[0067] Figure 4 .PCR detection of the expression of MR-1 gene in mouse toes. #1 / #2 / #3 / #6 / #8 are Vil1-cre(+), #4 is cPNKD-KI(heterozygous), #5 / #7 are MR-1KI(heterozygous), M is Marker

[0068] Example 4: AOM / DSS induces the development of colorectal cancer in cPNKD-KI transgenic mice

[0069] After the transgenic mice were intraperitoneally injected with AOM and received three cycles of DSS free drinking, the incidence of colorectal cancer in the mice was observed. The cPNKD-KI mice showed obvious emaciation, blood in the stool, and rectal prolapse, which showed that the cPNKD-KI mice showed more severe colorectal cancer symptoms.

[0070] Figure 5 :Anal prolapse in cPNKD-KI mice

[0071] The results of colorectal cancer autopsy showed that the H&E results of Vill-Cre mice and cPNKD-KI mice showed that the intestinal tumors of Vill-Cre mice showed adenocarcinoma characteristics, while the intestinal tumors of cPNKD-KI mice showed poorly differentiated adenocarcinoma characteristics. The inflammatory infiltration damage of the intestine of cPNKD-KI mice was more significant ( Figure 6 A). Compared with Vill-Cre mice, the number and diameter of intestinal tumors in cPNKD-KI mice were significantly increased ( Figure 6 B).

[0072] Figure 6 :MR-1 promotes disease progression of AOM / DSS-induced colorectal cancer in mice. A: Representative images of H&E staining of intestinal tissues of Vill-Cre mice and cPNKD-KI mice; B: Tumor data and size of mouse intestinal tissues. The main metastatic modes of colorectal cancer are divided into local invasion and metastasis, metastasis through the lymphatic system, metastasis through the blood, and tumor metastasis. During the mouse dissection, we found that 33.3% (1 / 3) of cPNKD-KI mice invaded the spleen through local infiltration, and obvious metastatic foci were found in spleen dissection ( Figure 7 ). No splenic metastasis of colorectal cancer was found in Vill-Cre mice. The above results indicate that MR-1 overexpression accelerates the progression of colorectal cancer to the late stage in mice and promotes local metastasis and invasion of tumors.

[0073] Figure 7 :MR-1 promotes splenic metastasis of colorectal cancer in mice

[0074] The above description is only a preferred embodiment of the present invention. It should be noted that the embodiments of the present invention are not limited to the embodiments. Without departing from the principle of the present invention, a number of changes, modifications, substitutions, combinations, and simplifications can be made, all of which should be equivalent replacement methods and should also be considered as the protection scope of the present invention. Key technical points and points to be protected of the present invention

[0075] 1. Genotype identification: Use reliable RT-PCR technology to identify the genotype of mice and confirm whether the desired transgenic mice have been successfully constructed.

[0076] 2. Construction of cPNKD-KI mice: Ensure that the colorectal epithelial cells of cPNKD-KI mice overexpress the MR-1 gene, which is a model for the rapid development of colorectal cancer.

Claims

1. A transgenic colorectal cancer model mouse overexpressing MR-1, characterized in that: Possesses the ability to overexpress MR-1.

2. The method for constructing a colorectal cancer model mouse according to claim 1, characterized in that: The method comprises the following steps: Step 1, construction of PNKD gene knock-in model mice; Step 2, construction of Vil1-cre tool mice; Step 3, construction of transgenic mice overexpressing MR-1 in colon epithelial cells; Step 4: Construction of AOM / DSS-induced cPNKD-KI transgenic mouse colorectal cancer model.

3. The method for constructing a colorectal cancer model mouse according to claim 1, characterized in that: in, Step 1, construction of PNKD gene knock-in model mice, further comprising the following steps: (1) sgRNA design and vector construction: According to the design principles of the target site region, Cas9 / sgRNA is designed and sgRNA is connected to a plasmid vector with a T7 promoter. In vitro transcription is performed, and the construction of the targeting vector is confirmed by enzyme digestion and sequencing; (2) The sgRNA sequence used in this step is: 5′-AAGGCCGCACCCTTCTCCGGAGG-3′; (3) Mouse fertilized egg injection: The Cas9 / sgRNA targeting vector was microinjected into mouse fertilized eggs to construct PNKD gene knock-in mice; (4) Identification of the tail genotype of the F0 generation mice and mating: Select mice with positive genotype identification results from the F0 mice and mate them with wild-type mice to obtain F1 generation mice with stable genotypes; (5) Genotype identification and expression detection of F1 mice: The genotype of F1 mice can be identified by using RT-PCR and Southern blot technology to detect the expression of PNKD gene; F1 mice with stable genotypes are screened and then bred to obtain F1 mice with PNKD overexpression transgene; the genotype identification primers in this step are as follows: Cre-F:TGTAGAGAAGGCACTTAGC Cre-R: CCAGGTTACGGATATAGTTCA.

4. The method for constructing a colorectal cancer model mouse according to claim 1, characterized in that: in, Step 2, Vil1-cre tool mouse construction, further includes the following steps: Vil1-cre mice have Cre recombinase driven by the Villin1 promoter, which can specifically knock out target genes with flox in the villi and crypt cells of the small and large intestines. They are important tool mice for studying intestinal organ formation; strain number: VSM000023 strain name: B6.Cg-Tg (Vil1-Cre) / V, referred to as Vil1-cre Vil1-cre tool mice were genotyped using RT-PCR technology; The primer sequences used are as follows: Cre-F TGTAGAGAAGGCACTTAGC Cre-R CCAGGTTACGGATATAGTTCA.

5. The method for constructing a colorectal cancer model mouse according to claim 1, characterized in that: in, Step 3, construction of transgenic mice in which colon epithelial cells overexpress MR-1, further comprises the following steps: Vil1-cre mice were mated with PNKD knock-in mice, and the expression level of MR-1 in the intestinal epithelial tissue of transgenic mice was detected by Western blotting. Mice with MR-1 overexpression were screened and named cPNKD-KI mice.

6. The method for constructing a colorectal cancer model mouse according to claim 1, characterized in that: in, Step 4, construction of AOM / DSS-induced cPNKD-KI transgenic mouse colorectal cancer model, further comprising the following steps: The transgenic mice in the control group (Vill-Cre) and the intestinal epithelial cell directed overexpression of MR-1 group (cPNKD-KI) were intraperitoneally injected with 12.5 mg / kg of AOM (azomethane), and were fed alternately with pure water at a predetermined time period (for a total of 65 days) to induce the occurrence and development of colorectal cancer. The resulting mice with colorectal cancer are the colorectal cancer model mice of the present invention.

Images