Tubular plant DNA (deoxyribonucleic acid) rapid extraction reagent as well as use method and application thereof

Abstract

The invention relates to a plant DNA rapid extraction reagent, a use method and application thereof. The reagent is prepared from sodium hydroxide, disodium ethylene diamine tetraacetate, potassium acetate, guanidine hydrochloride and Tween-80. By using the reagent, plant DNA can be rapidly extracted in a one-tube mode, the extraction rate is high, the extraction quality is good, and the molecular stability is high; the obtained sample can be directly connected with PCR or LAMP reaction, liquid nitrogen or sample freezing is not needed, and operation is easy, convenient and rapid. Compared with a traditional DNA extraction method, the method is small in reagent dosage, easy to operate and small in toxic and side effect.

Description

Technical Field

[0001] The invention relates to the technical field of nucleic acid extraction, and in particular to a one-tube plant DNA rapid extraction reagent, a use method and an application thereof. Background Art

[0002] Rapid preparation of DNA is the basis for in-depth molecular biology research on plants. PCR-based technology has been widely used in gene localization, cloning, detection, etc., all of which require a lot of DNA extraction. However, the conventional DNA extraction process is a tedious task that consumes manpower and material resources. Therefore, it is very important to establish a simple, fast, and efficient DNA extraction technology suitable for PCR and LAMP analysis.

[0003] At present, relevant methods for extracting plant DNA have been reported, such as the SDS method (Goldenberger et al., 1999) and the CTAB method (Porebski et al., 1997). Such methods have high quality of DNA extraction, but the process is cumbersome and it is difficult to achieve high-throughput nucleic acid preparation. At the same time, this method partially relies on highly toxic chemical reagents, which poses a safety hazard to the operating environment and personnel. In recent years, with the development of nucleic acid extraction technology, some biological companies have also developed some genomic DNA extraction kits, such as: CN 103289991 A, but the method described in this document has more operating procedures and higher nucleic acid extraction costs. At the same time, it is not convenient for large-scale extraction and has no universality. Summary of the invention

[0004] The present invention provides a simple, rapid and efficient one-tube plant DNA rapid extraction reagent, a method of use and its application. The reagent of the present invention meets the needs of detection technologies such as PCR and LAMP, and is particularly suitable for molecular detection of rice, wheat field plants and genetically modified crops.

[0005] The technical solution of the present invention:

[0006] A one-tube plant DNA rapid extraction reagent, the active ingredients of which include: sodium hydroxide, disodium ethylenediaminetetraacetic acid, potassium acetate, guanidine hydrochloride and Tween-80. Preferably, the concentration of sodium hydroxide is 0.3-0.5 mol / L, the concentration of disodium ethylenediaminetetraacetic acid is 8-12 mmol / L, the concentration of potassium acetate is 1-3 mol / L, the concentration of guanidine hydrochloride is 0.05-0.2 mol / L, and the concentration of Tween-80 is 1%-3%. More preferably, the concentration of sodium hydroxide is 0.5 mol / L, the concentration of disodium ethylenediaminetetraacetic acid is 10 mmol / L, the concentration of potassium acetate is 2 mol / L, the concentration of guanidine hydrochloride is 0.1 mol / L, and the concentration of Tween-80 is 2%.

[0007] The molar ratio of sodium hydroxide, disodium ethylenediaminetetraacetate, potassium acetate and guanidine hydrochloride in the reagent is 50:1:200:10.

[0008] A one-tube plant tissue DNA rapid extraction method is carried out according to the following steps:

[0009] 1) Take 5-20 mg of plant leaves, cut them into small strips of about 1 mm × (1-5) mm in length and width, and place them in a 2 mL centrifuge tube;

[0010] 2) Add 50-200 μL of the above reagent to a centrifuge tube and let stand for 3-10 min; the ratio of sample to the reagent (M / V) is 1:40-1:10, preferably 1:20;

[0011] 3) The plant DNA is lysed and released into a centrifuge tube, and can be used for PCR or LAMP amplification experiments after being diluted 10 times.

[0012] A one-tube plant DNA rapid extraction method, using the reagent of the present invention as a plant DNA extraction reagent, the method is suitable for rapid extraction of DNA from a variety of plants, the extraction site includes stems or leaves, the extracted DNA can meet conventional PCR, LAMP amplification tests, and Sanger sequencing; the plant is a field crop or a horticultural crop or a weed, the field crop is selected from rice, wheat, corn, soybean, rapeseed, cotton or peanut; the horticultural crop is selected from cabbage, cucumber, radish, tomato or pepper; the weed is selected from Echinochloa, Leptochloa, Alopecuroides, Japanese Alopecuroides, Glechoma, Chickweed, Chickweed, Eleutherodactyla or Alopecuroides. The plant also includes gene transformation or gene editing products, such as transgenic or gene edited corn, soybean, rapeseed, rice, etc.

[0013] Further, the plant DNA includes an Accase gene fragment (1061 bp) of Digitaria tangutica, and the nucleotide sequence of its amplification primer DsAccase-F / R is shown in SEQ ID NO.1 and SEQ ID NO.2; or an EcAccase gene fragment (1061 bp) of Echinochloa crusgalli, and the nucleotide sequence of its amplification primer EcAccase-F / R bp is shown in SEQ ID NO.3 and SEQ ID NO.4; or an AmAccase gene fragment (1024 bp) of Alopecuroides australis, and the nucleotide sequence of its amplification primer AmAccase-F / R is shown in SEQ ID NO.5 and SEQ ID NO.6; or a chloroplast rbcL gene fragment (1018 bp) of the large subunit of ribulose-1,5-bisphosphate carboxylase / oxygenase of Alopecuroides australis, and the nucleotide sequence of its amplification primer BsRbcL-F / R is shown in SEQ ID NO.7 and SEQ ID NO.8.

[0014] The use of the reagent of the present invention can not only ensure that the extracted DNA has a high concentration and good integrity, and can be used as a template for PCR or LAMP amplification, but also save extraction time, and has low cost and high safety for operators.

[0015] Compared with the commercial rapid extraction method (Tiangen method) technology, the present invention has the following advantages:

[0016] (1) Long storage time: The DNA extracted by the present invention can be stored at 4°C-80°C for 30 days and is not easily degraded.

[0017] (2) Simple operation: The DNA extraction method provided by the present invention is simple to operate, does not require grinding samples with liquid nitrogen, does not require the use of toxic chemical reagents, and does not require repeated extractions. Only one addition of reagents is required.

[0018] (3) Economical: The present invention uses fewer reagents and has lower costs.

[0019] (4) High quality: The DNA extracted by the present invention is suitable for a variety of gene analysis scenarios: such as PCR amplification, LAMP isothermal amplification, SSR molecular marker analysis, KASP marker analysis, and single nucleotide variation analysis.

[0020] (5) Wide application: Suitable for extracting DNA from leaves of many different plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the rapid plant DNA extraction method.

[0022] Figure 2 The PCR electrophoresis results of DNA extraction from Digitaria tangutica leaves. 1-3 are samples, P is the positive control, and N is the negative control.

[0023] Figure 3 The PCR amplification product of Digitaria tangutica Accase gene was sequenced and compared with the reference gene (excerpt 412bp-560bp), P is the positive control, and Accase is the reference gene.

[0024] Figure 4 These are the test results of DNA extraction from leaves of different plants. 1 is Digitaria (1061bp), 2 is Echinochloa crusgalli (1061bp), 3 is Alopecuroides (1024bp), 4 is Glechoma longituba (1018bp), 5 is Rice (376bp), P is the positive control, and N is the negative control.

[0025] Figure 5 A is the fluorescence result of LAMP amplification of a tube-type plant leaf DNA extraction reagent. Figure 5 B is the visualization result of LAMP amplification using a tube-type plant leaf DNA extraction reagent. DETAILED DESCRIPTION

[0026] Example 1: Experiment on amplification of acetyl-CoA carboxylase gene in crabgrass leaves.

[0027] 1. Experimental Materials

[0028] Weed leaves: Crabgrass (Digitaria sanguinalis)

[0029] Extraction reagents:

[0030] The composition of a tube-type plant DNA extraction reagent is as follows: the concentration of sodium hydroxide is 0.5 mol / L, the concentration of disodium ethylenediaminetetraacetate is 10 mmol / L, the concentration of potassium acetate is 2 mol / L, the concentration of guanidine hydrochloride is 0.1 mol / L, and the concentration of Tween80 is 2%.

[0031] 2. Experimental Methods

[0032] like Figure 1 Take a plant leaf, cut it into small strips of about 1mm×5mm in width with scissors, and place it in a 2mL centrifuge tube, or use a puncher with a diameter of about 3-5mm to take a sample, the sample is about 20mg.

[0033] Add 200 μL of the above-mentioned one-tube plant DNA rapid extraction reagent to the centrifuge tube, mix well, and let it stand for 5 minutes.

[0034] Take 10 μL of the lysis release solution obtained in the previous step, add 90 μL of DNA / RNA enzyme-free double distilled water, dilute 10 times, and take 2 μL for subsequent PCR and LAMP amplification experiments.

[0035] 3. Experimental results:

[0036] PCR amplification reaction reagent 2×Rapid Taq Master Mix (produced by Nanjing Novigene Co., Ltd., catalog number: P222-01). The specific system configuration is shown in Table 1:

[0037] Table 1. PCR amplification reaction components

[0038]

[0039] Amplification program: The PCR reaction program was 34 cycles of pre-denaturation at 95°C for 5 min, denaturation at 95°C for 25 sec, annealing at 56°C for 25 sec, and extension at 72°C for 30 sec, and ended with extension at 72°C for 10 min. Agarose gel electrophoresis analysis was performed after amplification.

[0040] The results are as follows Figure 2As shown: 1-3 represent different leaves of individual Digitaria, the size of Marker (M) is 2000, 1500, 750, 500, 250, 100 bp, P is a positive control, and N is a negative control. The amplification result is in line with expectations, with a size of 1061 bp, indicating that the one-tube plant DNA extraction reagent can be used to extract genes from Digitaria leaves.

[0041] The PCR product was sent to Bioengineering (Shanghai) for sequencing. Figure 3 As shown, the PCR amplification results were in line with expectations, indicating that the quality of DNA extracted by the one-tube plant DNA extraction reagent can meet sequencing requirements.

[0042] Example 2: Rapid DNA extraction experiment from leaves of different crops / weed plants

[0043] 1. Experimental Materials

[0044] Crop / weed foliage: Crabgrass (Digitaria sanguinalis), Barnyardgrass (Echinochloacrusgalli), Foxtail Grass (Alopecurus aequalis Sobol), Foxtail Grass (Beckmannia syzigachne), and Rice (Oryza sativa L.).

[0045] Extraction reagent: same as in Example 1.

[0046] 2. Experimental method: Same as Example 1.

[0047] 3. Experimental results:

[0048] The experimental results are as follows Figure 4 As shown, a one-tube plant DNA extraction reagent was used to extract DNA from leaves of different plants, and PCR amplification electrophoresis test was performed. The results showed that the one-tube plant DNA extraction reagent can be used for extraction and PCR amplification analysis of leaf DNA of a variety of plants.

[0049] Example 3: One-tube plant DNA extraction reagent LAMP amplification test

[0050] 1. Experimental Materials

[0051] Weed leaves: Crabgrass (Digitaria sanguinalis)

[0052] Extraction reagent: same as in Example 1.

[0053] 2. Experimental Methods

[0054] Take a plant leaf and cut it into small strips of about 1mm×5mm with scissors, and place it in a 2mL centrifuge tube, or use a hole puncher with a diameter of about 3mm to take samples. Add 200μL of the above-mentioned one-tube plant DNA quick extraction reagent to the centrifuge tube, mix well, and let it stand for 5 minutes. Take 10μL of the above-mentioned lysis release solution and add 90μL of DNA / RNA enzyme-free double distilled water, dilute 10 times, and take 2μL for subsequent LAMP amplification experiments.

[0055] The system and procedure used for LAMP amplification are as follows: Bst polymerase: 1μL, 10× buffer: 2μL, FIP: 2μL, BIP: 2μL; LF: 1μL, LB: 1μL, F3: 0.5μL, B3: 0.5μL, template: 2μL, ddH2O: 7μL, SYBR-Green I 20×: 1μL. Amplify at 65℃ for 60 minutes, and collect fluorescence signals every 1 minute.

[0056] 3. Experimental results

[0057] The fluorescence results of the LAMP amplification test of DNA extraction reagent from crabgrass leaves are as follows Figure 5 As shown in A, the results show that the one-tube method is equally effective in LAMP amplification compared with the traditional method and can be applied to LAMP amplification detection reactions. In addition, 2 μL 1000×SYBR Green I was added to the LAMP amplification product for color development reaction. The results are shown in Figure 5 As shown in B, Positive is the positive control, Negative is the negative control, and the LAMP amplification results of DNA extracted by the one-tube method are consistent with the results of the British Crown, indicating that this method can be applied to LAMP amplification detection.

[0058] The primer sequences used in the present invention are as follows:

[0059] SEQ ID NO.1:AGGTGGATTATTGACTCTGTTGTG

[0060] SEQ ID NO.2:TCTTGGAGTCCTCTGATCTGAA

[0061] SEQ ID NO.3: AGGTGGATTATTGACTCTGTTGTG

[0062] SEQ ID NO.4: TCTTGGAGTTCCTCCGACCTGAA

[0063] SEQ ID NO.5: GGTGTTGTCCATCTGACTGTTC

[0064] SEQ ID NO.6:GCCTCCTCCGTAATCTCTTGTA

[0065] SEQ ID NO.7:CTTGGCAGCATTCCGAGTAA

[0066] SEQ ID NO.8:TATAACACCTGGCATGGATACC。

Claims

1. An extraction composition, characterized in that The active ingredients of the composition consist of sodium hydroxide, disodium edetate, potassium acetate, guanidine hydrochloride and Tween-80.

2. A one-tube plant DNA rapid extraction reagent, characterized in that: The active ingredients of the reagent include sodium hydroxide, disodium ethylenediaminetetraacetate, potassium acetate, guanidine hydrochloride and Tween-80; preferably, the concentration of sodium hydroxide is 0.3-0.5 mol / L, the concentration of disodium ethylenediaminetetraacetate is 8-12 mmol / L, the concentration of potassium acetate is 1-3 mol / L, the concentration of guanidine hydrochloride is 0.05-0.2 mol / L, and the concentration of Tween-80 is 1%-2%.

3. The reagent according to claim 2, characterized in that The mixed molar ratio of sodium hydroxide, disodium ethylenediaminetetraacetate, potassium acetate and guanidine hydrochloride is 50:1:200:

10.

4. A one-tube plant DNA rapid extraction method, characterized in that: Proceed as follows: 1) Take 5-20 mg of plant leaves, cut them into small strips of about 1 mm × 5 mm in length and width, and place them in a 2 mL centrifuge tube; 2) Add 50-200 μL of the reagent according to claim 2 or 3 to a centrifuge tube and let stand for 3-10 minutes; 3) The plant DNA is lysed and released into a centrifuge tube, and can be used for PCR or LAMP amplification experiments after being diluted 10 times.

5. The method according to claim 4, characterized in that In step 1), the preferred amount of sample is 5 mg-20 mg; In step 2), 20 μL of the reagent is added dropwise to every 1 mg of the sample, that is, the weight-to-volume ratio of the sample to the reagent is 1:20 (mg:μL).

6. The method according to claim 4, characterized in that The extracted plant DNA was diluted 10 times with sterile, enzyme-free water and then amplified by PCR. The initial target amplification amount was 1-5 μL.

7. A one-tube plant DNA rapid extraction method, characterized in that: The method uses the composition or reagent described in any one of claims 1 to 3 as a rapid plant DNA extraction reagent, and the method is applicable to the rapid extraction of DNA from a variety of plants, the extraction site includes stems or leaves, and the extracted DNA can meet conventional PCR, LAMP amplification tests, and Sanger sequencing; the plant is a field crop or a horticultural crop or a weed, and the field crop is selected from rice, wheat, corn, soybean, rapeseed, cotton or peanut; the horticultural crop is selected from cabbage, cucumber, loofah, radish, tomato or pepper; the weed is selected from Echinochloa, Leptochloa chinensis, Alopecuroides, Japanese Alopecurus, Glechoma longituba, Chickweed, Chickweed, Eleutherodactyla or Alopecurus macrostachya, and the plant also includes gene transformation or gene editing products, such as transgenic or gene edited corn, soybean, rapeseed, rice, etc.

8. The method according to claim 7, characterized in that: The plant DNA includes a Digitaria tangutica Accase gene fragment (1061 bp), and the nucleotide sequence of its amplification primer DsAccase-F / R is shown in SEQ ID NO.1 and SEQ ID NO.2; or a Echinochloa crusgalli EcAccase gene fragment (1061 bp), and the nucleotide sequence of its amplification primer EcAccase-F / R bp is shown in SEQ ID NO.3 and SEQ ID NO.4; or a Alopecuroides australis AmAccase gene fragment (1024 bp), and the nucleotide sequence of its amplification primer AmAccase-F / R is shown in SEQ ID NO.5 and SEQ ID NO.6; or a chloroplast rbcL gene fragment (1018 bp) of the large subunit of ribulose-1,5-bisphosphate carboxylase / oxygenase of Alopecuroides australis, and the nucleotide sequence of its amplification primer BsRbcL-F / R is shown in SEQ ID NO.7 and SEQ ID NO.8.

Images