SNP (Single Nucleotide Polymorphism) molecular marker related to immune traits of yaks, detection method and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular biological detection, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to immune traits of yaks and application of the SNP molecular marker. According to the invention, the SNP molecular marker related to the immune traits of yaks is obtained through screening and is located at the 163684421th site on a chromosome 1 of a yak reference genome LUBosgruv3.0 version, and a mutant basic group is C or T. The content of immune globulin A, immune globulin G and immune globulin M of a yak individual can be obtained by utilizing the SNP molecular marker, a new SNP molecular marker resource is provided for non-diagnostic yak immune character marker-assisted selection, and a basis is provided for high-immunity yak breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and in particular to a SNP molecular marker related to yak immune traits, a detection method and application thereof. Background Art

[0002] Livestock diseases are not only harmful to livestock themselves, but also have a great impact on the development of animal husbandry. Livestock diseases have always been prevented and controlled mainly by methods such as vaccination or drug treatment, but this has not fundamentally eliminated and controlled the occurrence and spread of diseases. The resistance or susceptibility of livestock to diseases is affected by genetic material and environmental factors, and the disease resistance of different livestock is different. Therefore, studying the relationship between disease resistance genes and diseases is of great significance for the prevention and control of livestock diseases.

[0003] Immunoglobulin (Ig) is a type of globulin with antibody activity or a chemical structure similar to that of an antibody. It is the main reactant of humoral immune response. It has antibacterial and antiviral effects, enhances the phagocytic function of cells, and kills or dissolves pathogenic microorganisms under synergistic effects. It is an important component of the body's fight against disease.

[0004] Yaks (Bos grunniens), known as the "boat of the plateau", are important native mammals in the plateau region. They are mainly distributed in the Qinghai-Tibet Plateau and its adjacent high-altitude and low-oxygen areas. After a long period of natural selection, yaks are able to adapt to the high-altitude and low-oxygen environment and have very strong resistance to adversity. Oxidative stress in mammalian cells can cause damage to cell macromolecules and organ dysfunction, reduce production performance, and even infect various diseases. At the same time, immune stress can also cause changes in livestock behavior, metabolism, and neurosecretion, ultimately inhibiting their growth. Under the traditional grazing production and breeding model of raising livestock, the nutritional intake of yaks will be affected by the seasonal changes in forage yield and nutrients. When the forage supply is insufficient or the nutritional level is too low, it will cause long-term nutritional deficiencies in pregnant cows and newborn calves, leading to delayed or even stagnant growth and development of yaks. The harsh environment in the plateau pastoral areas leads to a high incidence of disease in yak calves. Calves in sub-healthy conditions are prone to stunted growth and development. Yaks are important livestock for local herders in terms of economy and agriculture. Several diseases pose a serious threat to the health of yaks and cause significant economic losses to local herders.

[0005] The combined effects of genes and the environment determine the phenotypic traits of an organism, and the diversity of genes determines the basic immune function of an organism. Understanding immune-related factors is very important for studying the immune response and pathological changes during infectious and non-infectious diseases in yaks. Summary of the invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to yak immune traits and application thereof.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 163684421st base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0009] Preferably, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the contents of immunoglobulin A and immunoglobulin G in yak individuals with genotype CC are higher than those in yak individuals with genotype CT or TT; the content of immunoglobulin M in yak individuals with genotype CC is higher than that in yak individuals with genotype TT.

[0010] The present invention provides the use of the SNP molecular marker in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0011] The present invention provides a primer pair for amplifying the SNP molecular markers described in the claims, and the sequence of the primer pair is shown in SEQ ID NOs: 1-2.

[0012] The present invention provides application of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0013] The invention provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0014] The invention provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extracting yak genomic DNA;

[0017] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0018] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0019] Preferably, the amplification system in step (2) comprises 25 μL in total, 12.5 μL of 2×L-Exp TaqMasterMix (dye plus), 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0020] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0021] By adopting the above technical solution, the present invention has the following beneficial effects:

[0022] The present invention provides a SNP molecular marker related to yak immune indicators and its role in breeding. Through research, the present invention finds that the SNP site related to yak immunity is located at the 163684421th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, the variation type is C / T, and there are 3 genotypes. When the 163684421th base on chromosome 1 is C, the genotype is CC or CT: when the 163684421th base on chromosome 1 is T, the genotype is TT.

[0023] Through the association analysis between different genotypes and the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it was found that the contents of immunoglobulin A and immunoglobulin G in yak individuals with the CC genotype were higher than those in yak individuals with the CT or TT genotypes (p<0.05); the content of immunoglobulin M in yak individuals with the CC genotype was higher than that in yak individuals with the TT genotype (p<0.05).

[0024] The present invention can obtain the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of individual yaks by detecting the base at the 163684421st nucleotide site on chromosome 1 of yaks. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and provides a basis for breeding yaks with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0026] Figure 1 is the PCR amplification product: M represents Marker; 1, 2, and 3 represent 3 groups of repetitions;

[0027] Figure 2 The peak diagram and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION

[0028] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 163684421st base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0029] In the present invention, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the contents of immunoglobulin A and immunoglobulin G in the yak individuals with the genotype CC are higher than those in the yak individuals with the genotype CT or TT; the content of immunoglobulin M in the yak individuals with the genotype CC is higher than that in the yak individuals with the genotype TT.

[0030] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0031] The present invention also provides a primer pair for amplifying the SNP molecular markers described in the claims, and the sequence of the primer pair is shown in SEQ ID NOs: 1-2.

[0032] In the present invention, the sequence SEQ ID NO: 1 in the primer pair is an upstream primer, and the specific sequence is 5'-GCAGCAGGTCCGTCCACAT-3'; the sequence SEQ ID NO: 2 in the primer pair is a downstream primer, and the specific sequence is 5'-GTAGCCCATCCAGGCCACA-3'.

[0033] The present invention provides application of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0034] The invention provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0035] The invention provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0036] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0037] (1) Extracting yak genomic DNA;

[0038] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0039] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0040] In the present invention, the amplification system described in step (2) is 25 μL in total, including 12.5 μL of 2×L-Exp TaqMasterMix (dyeplus), 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0041] In the present invention, the amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0042] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0043] Example 1

[0044] 1. Sample collection

[0045] The invention uses the Niangya yak breed as the detection object, collects 5 mL of blood samples from 188 fasting yaks from the Jiali County ranch in Nagqu City, Tibet Autonomous Region, and puts them in a clean pro-coagulant vacuum blood collection tube, lets them stand for 30 minutes, and then centrifuges them at 3500r / min for 10 minutes, draws the supernatant into a PE tube, seals it and stores it in a -20°C low-temperature refrigerator; another 5 mL of blood sample is collected and added to a blood collection tube containing EDTA-K2 anticoagulant. After the blood sample is collected, it is quickly mixed, temporarily stored in a sampling box containing an ice pack, and transported back to the laboratory and frozen in a -20°C refrigerator for DNA extraction.

[0046] 2 Main reagents and instruments

[0047] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genome extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Nano Drop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp TaqMasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0048] 3 Methods

[0049] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0050] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0051] 3.2 Extraction of genomic DNA from blood

[0052] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0053] 3.3 Primer design

[0054] Referring to the gene sequence of chromosome 1 of the yak genome LU_Bosgru_v3.0 version (Ensemble accession number: ENSBGRG00000003372), specific primers were designed using Primer5 software, including the g163684421C>T SNP site.

[0055] Primer sequences

[0056] F: 5'-GCAGCAGGTCCGTCCACAT-3' (SEQ ID NO: 1);

[0057] R: 5'-GTAGCCCATCCAGGCCACA-3' (SEQ ID NO: 2).

[0058] The length of the amplified fragment was 496 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0059] 3.4 PCR amplification and sequencing

[0060] PCR amplification system 25 μL: 2×L-Exp Taq MasterMix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template 2 μL.

[0061] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0062] The PCR products were tested by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. Figure 1 shown. Figure 1 The results showed that the length of the sequence obtained by PCR amplification was 496 bp, and sequencing revealed that a C / T mutation occurred in the 280th nucleotide sequence of the amplified product (base 163684421 on chromosome 1 of the genome LU_Bosgru_v3.0 version). The amplified product had clear bands without any other bands, and had good specificity.

[0063] The site was preliminarily identified as a SNP marker site of yak, named g163684421C>T SNP. The sequence obtained by PCR amplification is shown in SEQ ID NO:3, and the 280th position of the sequence is a C mutation. The size of the PCR amplification product fragment is consistent with the expected size, and the next step of the experiment can be carried out.

[0064] SEQ ID NO:3

[0065] GCAGCAGGTCCGTCCACATCTCTATTTGTTTCTAACTGTGTTTCCTTTTAGGATTTGTTTTTGTCAACCATTTCTTAAAAGAAATCTTAAACCTCTTAAATCATTCAAAAATAAGGTCAGTATAAGATGATATATTCAG AAAGTCTCATTCCTACCTCTTCTTATATCCTATTTCCACCTACTTCCTATATGTAGCCATGTTCATTACTTTCTGCTTTACCTCCTGTTTTCTTTTGTAAAATAAGCCAACATAGACATGCAGACACTTATTTCTCATT C TGACCCTACGGAGGGCATGTATTTCAGGACAGGAAGCTGCATGATGATTTCCTCATGCTAGAGTAATTTGGAATCTCTGGATGTGCTCATTTCTTATTGTCACAGAATCCATAGTCTCCATAGTGATACAGTGGGGCAACAGTCTGGGCTGGAGGCAGACAGGCCCAGGCTGGCATCTGGGTTGCCCAGAGTCTCCTTGTGGCCTGGATGGGCTAC

[0066] The biological analysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0067] 4 Statistical analysis

[0068] According to the genotyping results, the number of individuals with different genotypes at each locus was counted. The Popgen32 software was used to calculate the gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g163684421C>T gene, and the polymorphism information content (PIC) was calculated using the PIC (polymorphism information content) calculation software. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0069] 5 Results

[0070] 5.1 PCR Amplification and Sequencing Results

[0071] The amplification products of the g163684421C>T SNP locus on chromosome 1 of yaks were detected using 1% agarose gel (see Figure 1 ), the bands were clear without heterozygous bands, the specificity was good, and the size of the PCR product fragment was 496 bp, which was in line with the expected size, and the next experiment could be carried out.

[0072] The peak map and sequence obtained after purifying and sequencing the PCR products are shown in Figure 2 . As can be seen from Figure 2 , a C-T mutation occurred at the g163684421C>T SNP locus, and there were three genotypes: CC, CT, and TT.

[0073] 5.2 Statistical Analysis Results

[0074] The genotypes and allele frequencies of the g163684421C>T SNP locus on chromosome 1 of yaks were analyzed from the perspective of population genetics. As can be seen from Table 1, at the g163684421C>T SNP locus, the CT genotype frequency was the highest, which was the dominant genotype, and the T allele frequency was 54.8%, showing the dominant allele. The χ 2 adaptive test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.495, and the PIC was 0.373, 0.25<PIC<0.50, belonging to moderate polymorphism.

[0075] Table 1 Polymorphism of the g163684421C>T SNP Locus on Chromosome 1 of Yaks

[0076]

[0077] 5.3 Association analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0078] The general linear model in IBM SPSS Statistics26 software was used to analyze the association between different genotypes of yaks and the content of immunoglobulins IgA, IgG, and IgM. The results showed that the immunoglobulins IgA and IgG of yak individuals with CC genotype were significantly higher than those of individuals with CT and TT genotypes (p<0.05), and there was no significant difference in immunoglobulins IgA and IgG between individuals with CT and TT genotypes (p>0.05). The immunoglobulin IgM of yak individuals with CC genotype was significantly higher than that of individuals with TT genotypes (p<0.05), and there was no significant difference in immunoglobulin IgM between individuals with CT and CC and TT genotypes (p>0.05), indicating that the base of the g163684421C>T SNP site on chromosome 1 of yak is significantly correlated with yak IgA, IgG, and IgM, and is a SNP marker related to yak IgA, IgG, and IgM. The results are shown in Table 2.

[0079] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0080]

[0081] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0082] The SNP molecular marker described in the present invention is located at the 163684421th base on chromosome 1 of the yak genome LU_Bosgru_v3.0 version; the variation type is C / T, named g163684421C>T, and there are three genotypes. When the 163684421th base on chromosome 1 is C, the genotype is CC or CT; when the 163684421th base on chromosome 1 is T, the genotype is TT; by comparing different genotypes with immunoglobulins IgA, I The correlation analysis of the content of gG and IgM found that the immunoglobulin IgA and IgG of the CC genotype yak individuals were significantly higher than those of the CT and TT genotype individuals (p<0.05), and there was no significant difference in immunoglobulin IgA and IgG between the CT and TT genotype individuals (p>0.05). The immunoglobulin IgM of the CC genotype yak individuals was significantly higher than that of the TT genotype individuals (p<0.05), and there was no significant difference in immunoglobulin IgM between the CT and CC, TT genotype individuals (p>0.05). The present invention can determine the content of immunoglobulin IgA, IgG, and IgM of yak individuals by detecting the base of the 163684421st nucleotide site on chromosome 1 of the yak. ​​The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with yak immune traits, characterized in that: The SNP molecular marker is located at the 163684421st base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

2. The SNP molecular marker according to claim 1, characterized in that: The genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the contents of immunoglobulin A and immunoglobulin G in yak individuals with genotype CC are higher than those in yak individuals with genotype CT or TT; the content of immunoglobulin M in yak individuals with genotype CC is higher than that in yak individuals with genotype TT.

3. Use of the SNP molecular marker described in claim 1 or 2 in the preparation of products for detecting yak immunity or products for yak assisted breeding.

4. A primer pair for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: The sequences of the primer pairs are shown in SEQ ID NOs: 1-2.

5. Use of the primer pair according to claim 4 in preparing a product for detecting yak immunity or a product for yak assisted breeding.

6. A kit for detecting yak immunity, characterized in that: It comprises a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 4.

7. A kit for yak assisted breeding, characterized in that: Contains a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 4.

8. A method for marker-assisted selection of yak immune traits for non-diagnostic purposes, characterized in that: The steps include: (1) Extracting yak genomic DNA; (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair described in claim 4 to obtain an amplified product; (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

9. The method according to claim 8, characterized in that The amplification system described in step (2) contains a total of 25 μL, 2×L-ExpTaq MasterMix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.

10. The method according to claim 8, characterized in that The amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

Images