Molecular marker and primer probe group for identifying soft and weak enteromorpha and application of molecular marker and primer probe group

Abstract

The invention provides a molecular marker for identifying soft and weak enteromorpha, a primer probe group and application of the molecular marker and the primer probe group, and relates to the technical field of molecular markers. The nucleotide sequence of the molecular marker disclosed by the invention is as shown in SEQ ID NO. 1. The soft and weak enteromorpha 5S ribosome RNA gene sequence is used as a molecular marker, the specific primer and the fluorescent probe are designed, the optimal PCR reaction condition is determined, a frond sample can be rapidly identified through a real-time fluorescent quantitative PCR technology, a microscopic propagule sample and an environmental DNA sample can be detected, and the method is more reliable, convenient and rapid compared with a conventional method, and has a good application prospect. The method has important significance in the aspects of identification of soft and weak enteromorpha green tide dominant species, early warning of green tide disasters caused by the green algae and research of green tide formation causes.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a molecular marker, a primer probe set and an application thereof for identifying Enteromorpha tenuifolia. Background Art

[0002] The frequent occurrence of green tides in coastal waters has become a global marine ecological and environmental problem. A new species of green algae of the genus Ulva was discovered in the green tide disasters that occurred in recent years and was named Enteromorpha tenuifolia ( Ulva delicatissima ), its main morphological characteristics are: the algae is bright green, weak and slender, with a height of <10cm, and the holdfast is composed of rhizoid filaments extended from the base cells, and the rhizoids are not well developed. The algae is a single-layer cell hollow tubular structure, the main branch is not obvious, the diameter is 70~400μm, usually less than 1mm, there is no air capsule, the branches are numerous and dense, and they are very easy to break. There are 4~5 branches, and the diameter of the main branch is larger than the secondary branch. The top of the algae's terminal branch is usually a single row of cells, the number of single row cells can reach 30, and the diameter is 10~18μm. From the surface, the algae cells are rectangular or square, with a cell length of 14~35, a width of 10~25µm, and a height of 12~25µm. The cells are obviously arranged longitudinally, the chromatophores are not full, and the cells at the base of the main branch are arranged irregularly. In cross-section, the body cavity is surrounded by 4 to 76 cells, which are rectangular or oval, with a body wall thickness of 10 to 25 μm. The chromatophores are concentrated in the cells on the outer edge of the body cavity, and there are 2 to 4 starch nuclei. The traditional classification of green algae is mainly based on the morphological characteristics of the thallus. Due to the strong morphological plasticity of Ulva green algae, many algae are difficult to distinguish only by traditional morphological classification methods. With the rapid development of molecular biology, in recent years, the classification and identification of Ulva green algae have mostly adopted a combination of morphology and molecular marker sequencing and comparison. The molecular markers commonly used for the identification of Ulva green algae include: ITS, rbcL, tufA and 18S. Due to the limited resolution of a single molecular marker, multiple molecular markers are often used in combination; in addition, due to the complex natural environment, the difficulty in removing sample impurities, the universality of primers and other problems, non-specific amplification often occurs, resulting in sequencing failure, and the identification process requires PCR amplification, electrophoresis detection of amplified products, gel recovery, sequencing, sequence alignment analysis, etc., which are complex to operate, costly and time-consuming. In addition, the traditional detection method for microscopic propagules in the environment is to count the thallus after laboratory cultivation and to conduct morphological and molecular biological identification on partial sampling, which takes a long time and a lot of work.

[0003] Therefore, discovering the specific molecular markers of Enteromorpha tenuifolia and developing a rapid and effective identification method for Enteromorpha tenuifolia are of great significance in guiding the prevention and control of green tide disasters caused by Enteromorpha tenuifolia. Summary of the invention

[0004] In view of this, an object of the present invention is to provide a molecular marker for identifying Enteromorpha tenuifolia, which has strong specificity and can be used to identify Enteromorpha tenuifolia.

[0005] Another object of the present invention is to provide a primer probe set for identifying Enteromorpha tenuifolia, which has extremely high resolution, strong stability, and strong probe specificity, and can quickly and effectively perform Enteromorpha tenuifolia species identification and environmental DNA quantitative detection.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a molecular marker for identifying Enteromorpha tenuifolia. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1.

[0007] The present invention also provides a primer probe set for identifying Enteromorpha tenuifolia, wherein the primer probe set is designed with an upstream primer, a downstream primer and a fluorescent probe according to the molecular marker; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.4.

[0008] The present invention also provides a kit for identifying Enteromorpha tenuifolia, which comprises the molecular marker and primer probe group.

[0009] The present invention also provides an application of the molecular marker, the primer probe set or the kit in identifying Enteromorpha tenuifolia.

[0010] The present invention also provides a method for identifying Enteromorpha tenuifolia, comprising the following steps: Extracting genomic DNA from the sample to be tested; The genomic DNA of the above sample is used as a template, and the primer probe set or the kit is used to perform qPCR amplification; after the reaction is completed, whether the Enteromorpha tenuifolia in the sample to be tested is positive is determined based on the amplification curve and the Ct value.

[0011] Preferably, the sample to be tested is a plant sample or an environmental sample.

[0012] Preferably, the reaction procedure of the qPCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 55-63°C for 60 s, 40 cycles; and measuring the fluorescence intensity after each cycle.

[0013] Preferably, the reaction system of the qPCR amplification is 25 μL as follows: 2 μL of DNA template, 12.5 μL of 2×PCR mix, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 0.5 μL of 10 μM fluorescent probe, and 8 μL of sterile double distilled water.

[0014] Preferably, when the sample to be tested is a plant sample, the identification criteria are as follows: if no amplification curve appears in the detection or the Ct value is greater than the Ct value at 100 copies in the standard series, the sample to be tested is not Enteromorpha tenuifolia; if the detected Ct value is ≤ the Ct value at 100 copies in the standard series, the sample to be tested is Enteromorpha tenuifolia.

[0015] Preferably, when the sample to be tested is an environmental sample, the identification criteria are as follows: if no amplification curve appears in the detection or the Ct value is greater than the Ct value at 10 copies in the standard series, the sample to be tested does not contain Enteromorpha tenuifolia; if the detected Ct value is ≤ the Ct value at 10 copies in the standard series, the sample to be tested contains Enteromorpha tenuifolia.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The present invention utilizes Enteromorpha tenuifolia ( Ulva delicatissima ) characteristic 5S ribosomal RNA gene sequence (5S rDNA) as a molecular marker, by designing specific primers and taqman probes, determining the optimal PCR reaction conditions, and quickly identifying algal samples by real-time fluorescence quantitative PCR (qPCR) technology. The qPCR method can quickly and efficiently identify whether the green algae is Enteromorpha tenuissima within 5 to 8 hours, and whether the environmental sample contains Enteromorpha tenuissima micropropagules or DNA. The identification method constructed by the present invention is more reliable and convenient than the conventional method, and has important guiding significance for the identification of dominant species of Enteromorpha tenuissima green tide, as well as the early warning of green tide disasters caused by the green algae and the study of the causes of green tide. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the positions of primers and probes on molecular markers, in which SEQ1 is the molecular marker gene sequence, SEQ2 is the upstream primer sequence, SEQ3 is the reverse complementary sequence of the downstream primer, and SEQ4 is the fluorescent probe sequence; Figure 2 is the qPCR standard curve of the present invention; Figure 3 The standard series 10 of the qPCR detection system of the present invention 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1copy amplification curve; Figure 4 These are the amplification curves of 9 green algae samples, 9 groups of blank controls and 7 groups of environmental samples under the detection system of the present invention. DETAILED DESCRIPTION

[0018] The invention provides a molecular marker for identifying Enteromorpha tenuifolia. The nucleotide sequence of the molecular marker is 5'-TGCAGGTGGTGGCGAAAACGGCTGCGGCCGCTAGCGAGCCAACGGGAACGGCGCCGTGAAGCTCTGGCAGATGCTTGAAGAGAGAGTTGGCTGGCATGAA-3' (SEQ ID NO.1).

[0019] The present invention utilizes the large difference of 5S rDNA sequence of Ulva genus and selects Enteromorpha tenuifolia ( Ulva delicatissima ) characteristic 5S ribosomal RNA gene sequence (5S rDNA) was used as a molecular marker, which has strong specificity and is only highly homologous to Enteromorpha tenuissima in NCBI Genbank.

[0020] The present invention also provides a primer probe set for identifying Enteromorpha tenuifolia, wherein the primer probe set designs an upstream primer, a downstream primer and a fluorescent probe according to the above-mentioned molecular marker; the nucleotide sequence of the upstream primer is 5'-TGCAGGTGGTGGCGAAAAC-3' (SEQ ID NO.2); the nucleotide sequence of the downstream primer is 5'-TTCATGCCAGCCAACTCTCTCT-3' (SEQ ID NO.3); the nucleotide sequence of the fluorescent probe is 5'-CTGCGGCCGCTAGCGAGCCA-3' (SEQ ID NO.4). The present invention designs specific primers and taqman probes based on the above-mentioned molecular markers, determines the optimal PCR reaction conditions, can quickly identify algal samples through real-time fluorescence quantitative PCR (qPCR) technology, and can also detect microscopic propagule samples and environmental DNA samples, which is more reliable and convenient than conventional methods.

[0021] In the present invention, the 5' end of the fluorescent probe is labeled with a reporter group, and the 3' end is labeled with a quencher group. In the present invention, the 5' end labeled reporter group includes but is not limited to FAM, FITC, TET, HEX, JOE. The 5' end labeled reporter group in the present invention is further preferably a FAM group; the 3' end labeled quencher group includes but is not limited to DABCYL, TAMRA, MGB, BHQ-0, BHQ-1, BHQ-2 or BHQ-3, and the 3' end labeled quencher group in the present invention is further preferably a BHQ-1 group.

[0022] The present invention also provides a kit for identifying Enteromorpha tenuifolia, the kit preferably comprising the molecular marker and the primer probe set; more preferably comprising the pMV vector plasmid standard series and the primer probe set of the molecular marker sequence. In the present invention, the kit also includes 2×PCR mix, sterile double distilled water, a positive control and a negative control. In the present invention, the sterile double distilled water is free of DNase and RNase. In the present invention, the positive control is a DNA sequence containing the Enteromorpha tenuifolia molecular marker; the negative control is sterile double distilled water.

[0023] The present invention also provides an application of the molecular marker, the primer probe set or the kit in identifying Enteromorpha tenuifolia.

[0024] The present invention also provides a method for identifying Enteromorpha tenuifolia, which preferably comprises the following steps: Extracting genomic DNA from the sample to be tested; The genomic DNA of the above sample is used as a template, and the primer probe set or the kit is used to perform qPCR amplification; after the reaction is completed, whether the Enteromorpha tenuifolia in the sample to be tested is positive is determined based on the amplification curve and the Ct value.

[0025] In the present invention, the sample to be tested is preferably a plant sample or an environmental sample.

[0026] In the present invention, as an practicable method, when the environmental sample is seawater, the seawater sample to be tested is filtered with a hydrophilic filter membrane to extract the total DNA enriched in the filter membrane; the total DNA of the above sample is used as a template, and qPCR amplification is performed using the primer probe set or the kit; after the reaction is completed, it is determined whether the sample to be tested contains microscopic reproductive bodies or DNA of Enteromorpha tenuifolia based on the amplification curve and the Ct value.

[0027] In the present invention, the reaction procedure of the qPCR amplification is preferably: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 55-63°C for 60 s, 40 cycles; and measuring the fluorescence intensity after each cycle. In the present invention, annealing and extension are performed simultaneously in the qPCR amplification procedure, and the temperature of the annealing and extension is more preferably 60.5°C.

[0028] In the present invention, the reaction system of qPCR amplification is preferably calculated as follows in 25 μL: 2 μL DNA template, 12.5 μL 2×PCRmix, 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, 0.5 μL 10 μM fluorescent probe, and 8 μL sterile double distilled water.

[0029] In the present invention, when the sample to be tested is a plant sample, the identification standard is preferably as follows: if the test does not show an amplification curve or the Ct value is greater than the Ct value at 100 copies in the standard series, the sample to be tested is not Enteromorpha indica; if the test Ct value is ≤ the Ct value at 100 copies in the standard series, the sample to be tested is Enteromorpha indica. When the sample to be tested is an environmental sample, the identification standard is preferably as follows: if the test does not show an amplification curve or the Ct value is greater than the Ct value at 10 copies in the standard series, the sample to be tested does not contain Enteromorpha indica; if the test Ct value is ≤ the Ct value at 10 copies in the standard series, the sample to be tested contains Enteromorpha indica. In actual detection, due to certain differences in the Ct values ​​measured by different qPCR reagents and experimental batches, the present invention uses the standard series when the DNA content is 100 copies to identify whether the plant sample is Enteromorpha indica, and uses the standard series when the DNA content is 10 copies to identify whether the environmental sample contains Enteromorpha indica.

[0030] In the present invention, as an practicable method, after the Ct value is obtained by detection, the template DNA content of each sample can be calculated by the standard curve to identify whether the sample is Enteromorpha tenuifolia or whether the sample contains Enteromorpha tenuifolia. In the present invention, the calculation formula is as follows: X0=10 （Y-Ct） / A , where: X0 represents the template DNA content (copies) in the qPCR system; Y represents the intercept; Ct represents the sample Ct value; A represents the slope. In the present invention, the standard for identifying Enteromorpha tenuifolia as positive according to the template DNA content in the sample is preferably as follows: if the content of the plant DNA sample (single green algae sample) is 50 copies / μL or more, the sample can be determined to be Enteromorpha tenuifolia; if the content of the environmental DNA sample is 5 copies / μL or more, the sample can be determined to contain Enteromorpha tenuifolia microscopic propagules or DNA.

[0031] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0033] Example 1 A molecular marker for identifying Enteromorpha tenuifolia, wherein the specific sequence of the molecular marker is: 5'-TGCAGGTGGTGGCGAAAACGGCTGCGGCCGCTAGCGAGCCAACGGGAACGGCGCTGAAGCTCTGGCAGATGCTTGAAGAGAGAGTTGGCTGGCATGAA-3' (100 bp).

[0034] The present invention utilizes Enteromorpha tenuifolia ( Ulva delicatissima ) was used as a molecular marker using the characteristic 5S ribosomal RNA gene sequence (5S rDNA), which was highly homologous only to Enteromorpha tenuissima in Genbank.

[0035] Example 2 A primer probe set for identifying Enteromorpha tenuifolia, wherein the primer probe set is designed with upstream primers, downstream primers and fluorescent probes according to the molecular markers described in Example 1, and the specific sequences are as follows: Upstream primer (19 bp): 5′-TGCAGGTGGTGGCGAAAAC-3′; Downstream primer sequence (22 bp): 5′-TTCATGCCAGCCAACTCTCTCT-3′; Fluorescent probe and modification (20 bp): 5'-FAM-CTGCGGCCGCTAGCGAGCCA-BHQ1-3'.

[0036] The positions of primers and probes on molecular markers are shown in Figure 1 In the figure, SEQ1 is the molecular marker gene sequence SEQ ID NO.1, SEQ2 is the upstream primer sequence SEQ ID NO.2, SEQ3 is the reverse complementary sequence of the downstream primer SEQ ID NO.3, and SEQ4 is the fluorescent probe sequence SEQ ID NO.4.

[0037] Example 3 A kit for identifying Enteromorpha tenuifolia, comprising the molecular marker in Example 1, the primer probe set in Example 2, 2×PCR mix and sterilized double distilled water, a negative control substance and a positive control substance.

[0038] Example 4 A method for identifying Enteromorpha tenuifolia, comprising the following specific steps: The gene sequence of the molecular marker of Example 1 was synthesized and cloned into the pMV vector. After plasmid extraction, the gene concentration (copies / μL) was measured using a nucleic acid analyzer and diluted to 5×10 6 , 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 , 5×10 1 , 5×10 0 A total of 7 concentration gradients were used as templates, with 3 replicates per concentration, to prepare the qPCR standard working curve ( Figure 2). According to the qPCR standard working curve, the primer amplification efficiency was 95.01%, R 2 The value is 0.994 and the slope is -3.448. The qPCR amplification results are shown in Figure 3 , Figure 3 The first six groups of amplification curves are 5×10 6 , 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 , 5×10 1 The amplification curves obtained under 6 concentration ranges showed that the Ct value difference between parallel samples of the same concentration was small and the quantification was accurate; the amplification curves of the 7th and 8th groups were 5×10 0 The amplification curve of the concentration group of copies / μL showed that the relative deviation of Ct values ​​between parallel samples at this concentration was large, and the quantification was inaccurate.

[0039] Using the DNA of the sample to be tested as a template, the primer probe set described in Example 2 was used to perform absolute quantitative qPCR amplification on the sample to be tested, and each sample was repeated more than 2 times.

[0040] The qPCR reaction system (25 μL) includes: 2×PCR mix 12.5 μL, 10 μM upstream primer 1 μL, 10 μM downstream primer 1 μL, 10 μM fluorescent probe 0.5 μL, sterile double distilled water 8.0 μL, template DNA 2 μL; The reaction procedure of qPCR amplification included: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 60.5°C for 60 s, and 40 cycles; and fluorescence intensity was measured after each cycle.

[0041] qPCR method: absolute fluorescence quantitative method, using Ct value as quantitative cycle method.

[0042] Judgment standard: When the sample to be tested is a plant sample, the identification standard is: if the test does not show an amplification curve or the Ct value is greater than the Ct value at 100 copies in the standard series, the sample to be tested is not Enteromorpha tenuifolia; if the test Ct value is ≤ the Ct value at 100 copies in the standard series, the sample to be tested is Enteromorpha tenuifolia. When the sample to be tested is an environmental sample, the identification standard is: if the test does not show an amplification curve or the Ct value is greater than the Ct value at 10 copies in the standard series, the sample to be tested does not contain Enteromorpha tenuifolia; if the test Ct value is ≤ the Ct value at 10 copies in the standard series, the sample to be tested contains Enteromorpha tenuifolia.

[0043] After determining the Ct value, the template DNA content (copies / μL) of each sample was calculated using the standard curve. The calculation formula is: X0=10 （Y-Ct） / A; In the formula: X0 represents the template DNA content (copies) in the qPCR system; Y represents the intercept; Ct represents the sample Ct value; A represents the slope; If the content of single green algae DNA sample is more than 50 copies / μL, it can be determined that the sample is Enteromorpha tenuifolia; if the content of environmental DNA sample is more than 5 copies / μL, it can be determined that the sample contains Enteromorpha tenuifolia microscopic reproductive bodies or DNA.

[0044] Example 5 In this example, the primer-probe combination of Example 2 was used to detect 9 types of green algae samples, and the steps were as follows: The genomic DNA of 9 green algae samples was obtained, and the genomic DNA was used as a template, and absolute quantitative qPCR amplification was performed using the molecular marker standard series of Example 1, the primer probe combination of Example 2, and the reaction system and reaction procedure of Example 4. The information of the 9 green algae samples is shown in Table 1.

[0045] Table 1 Information of 9 species of green algae

[0046] Among them, 1 is a positive sample and 2-9 are negative samples.

[0047] according to Figure 4 As can be seen from the results in Table 2, the positive samples of the green algae of the present invention all showed obvious amplification curves, and the Ct values ​​were all less than or equal to the Ct value (28.989) at 100 copies in the standard series; the negative samples did not show obvious amplification curves or Ct values ​​(28.989) at 100 copies in the standard series.

[0048] Table 2 Ct value results of the standard series of the present invention, 9 green algae samples and blank control

[0049] Example 6 In this embodiment, whether the environmental sample contains Enteromorpha tenuifolia is detected, and the specific steps are as follows: More than 1L of seawater was collected from the northern coastal waters of Yantai using a clean sample bottle. After filtering with a filter membrane with a pore size of 0.45 μm, total DNA from the filter membrane was extracted as an environmental sample template. Absolute quantitative qPCR amplification was performed using the molecular marker standard series of Example 1, the primer-probe combination of Example 2, and the reaction system and reaction procedure in Example 4.

[0050] Table 3 Ct value results of the standard series of the present invention, 7 groups of environmental samples and blank control

[0051] according to Figure 4As can be seen from the results in Table 3, the environmental positive samples of the present invention all showed obvious amplification curves, and the Ct values ​​were all less than or equal to the Ct value of 10 copies in the standard series (32.626); the negative samples did not show obvious amplification curves or the Ct values ​​were higher than the Ct value of 10 copies in the standard series (32.626).

[0052] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker for identifying Enteromorpha tenuifolia. It is characterized in that The nucleotide sequence of the molecular marker is shown as SEQ ID NO.

1.

2. A primer probe set for identifying Enteromorpha tenuifolia, It is characterized in that The primer-probe set is designed with an upstream primer, a downstream primer and a fluorescent probe according to the molecular marker described in claim 1; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.

4.

3. A kit for identifying Enteromorpha tenuifolia, It is characterized in that The kit comprises the molecular marker according to claim 1 and the primer probe set according to claim 2.

4. Use of the molecular marker according to claim 1, the primer-probe set according to claim 2, or the kit according to claim 3 in identifying Enteromorpha tenuifolia.

5. A method for identifying Enteromorpha tenuifolia. It is characterized in that The steps include: Extracting genomic DNA from the sample to be tested; The genomic DNA of the above sample is used as a template, and qPCR amplification is performed using the primer probe set described in claim 2 or the kit described in claim 3; after the reaction is completed, whether the Enteromorpha tenuifolia in the sample to be tested is positive is determined based on the amplification curve and the Ct value.

6. The identification method according to claim 5, It is characterized in that The sample to be tested is a plant sample or an environmental sample.

7. The identification method according to claim 5, It is characterized in that The reaction procedure of the qPCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 55-63°C for 60 s, 40 cycles; and measuring the fluorescence intensity after each cycle.

8. The identification method according to claim 5, It is characterized in that The reaction system of the qPCR amplification is calculated as 25 μL: 2 μL of DNA template, 12.5 μL of 2×PCR mix, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 0.5 μL of 10 μM fluorescent probe, and 8 μL of sterile double distilled water.

9. The identification method according to claim 5, It is characterized in that When the sample to be tested is a plant sample, the identification criteria are as follows: if no amplification curve appears in the test or the Ct value is greater than the Ct value at 100 copies in the standard series, the sample to be tested is not Enteromorpha tenuifolia; if the test Ct value is ≤ the Ct value at 100 copies in the standard series, the sample to be tested is Enteromorpha tenuifolia.

10. The identification method according to claim 5, It is characterized in that When the sample to be tested is an environmental sample, the identification criteria are as follows: if no amplification curve appears in the test or the Ct value is greater than the Ct value at 10 copies in the standard series, the sample to be tested does not contain Enteromorpha tenuifolia; if the detected Ct value is ≤ the Ct value at 100 copies in the standard series, the sample to be tested contains Enteromorpha tenuifolia.

Images