Electrochemical aptamer sensor for uric acid detection

Abstract

The invention discloses a double-affinity aptamer sensor with a wide dynamic range as well as preparation and application of the double-affinity aptamer sensor. According to the sensor, a uric acid aptamer of which the tail end is marked with redox reporter methylene blue (MB) is fixed on the surface, and an auxiliary chain complementary with a 5'tail end region of the uric acid aptamer is introduced, so that a probe part on a sensing interface is hybridized, a background signal of the sensor is reduced, and the sensitivity is remarkably improved. Meanwhile, due to the introduction of the auxiliary chain, the aptamer probe on the surface of the sensor has two different affinities, so that the dynamic range of the sensor is widened from 81 times to about 3000 times; according to the present invention, the limitation that the traditional E-AB sensor only has the limited dynamic range is solved, such that the application of the E-AB sensor in the wide concentration range is expanded, and the wide application prospects are provided in the fields of medical diagnosis (such as monitoring of hyperuricemia, gout and other diseases), food safety detection (such as detection of the uric acid content in food), biochemical research and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of electrochemical biosensors, and in particular relates to a dual-affinity aptamer sensor with a wide dynamic range and the preparation and application thereof. Background Art

[0002] Uric acid is the final product of purine metabolism and plays a key role in the diagnosis of a variety of diseases including gout, kidney disease and hyperuricemia. In addition, uric acid levels are also closely related to a variety of metabolic diseases, such as diabetes and obesity. Although diagnostic technology has made significant progress, accurately monitoring uric acid levels remains a challenge. This is mainly because uric acid concentrations are affected by multiple factors such as diet, metabolic state and renal function, resulting in large differences in uric acid levels between different individuals and the same person at different times. In addition, the use of certain drugs can affect uric acid metabolism and excretion, and differences in uric acid levels need to be closely monitored during drug treatment. Therefore, the development of a biosensor technology with a wide dynamic range and the ability to accurately assess changes in uric acid levels is of great significance for disease status monitoring and drug efficacy evaluation.

[0003] At present, the main methods for determining uric acid include enzymatic method, voltammetric method and liquid chromatography. Although the enzymatic method is stable and reliable, it relies on a single enzymatic reaction to obtain the uric acid content, has a limited detection range and is costly. Voltammetric method has excellent sensitivity, but glutathione and ascorbic acid in the body fluid to be tested have overlapping voltammetric responses with uric acid molecules, resulting in poor sensor specificity. High-performance liquid chromatography has a wide detection range and sensitivity, but requires professional technology and cumbersome operation. In this context, electrochemical aptamer-based sensors (EABs) are expected to become advanced analytical tools for uric acid detection due to their good specificity and robustness. This type of sensor relies on the conformational change of the aptamer labeled with a redox reporter when it binds to the target, resulting in a change in the redox current for detection. In addition, serum analysis based on electrochemical aptamer sensors does not require any extraction or separation steps and has the possibility of adapting to automated measurement systems. However, due to its reliance on a single binding site recognition mechanism, it only has an 81-fold useful dynamic range. Therefore, there is an urgent need for an effective means to adjust the dynamic range of EAB sensors so as to improve their performance in practical applications. Summary of the invention

[0004] In view of the current technical status that traditional electrochemical aptamer sensors for detecting uric acid rely on a single binding site recognition mechanism, resulting in a narrow useful dynamic range, there is an urgent need for a method that can effectively adjust the dynamic range of electrochemical aptamer sensors. The present invention aims to provide an electrochemical aptamer sensor with a wide dynamic range for uric acid detection, as well as its preparation and application.

[0005] In order to achieve the above object, the specific technical solution adopted by the present invention is as follows:

[0006] The present invention provides a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range. The dual-affinity aptamer sensor is a three-electrode system sensor. The working electrode of the dual-affinity aptamer sensor is obtained by sequentially modifying a uric acid aptamer and an auxiliary chain on the surface of a gold electrode; the auxiliary chain is a sequence partially complementary to the uric acid aptamer; the auxiliary chain has a length of 13 to 34 bp; the 5' end of the uric acid aptamer is labeled with a thiol group, and the 3' end is labeled with a redox reporter methylene blue.

[0007] The auxiliary chain is any one of the nucleotide sequences shown in SEQ ID NO: 2-7, and the auxiliary chain concentration is 10 nM to 300 nM.

[0008] The nucleotide sequence of the uric acid aptamer is shown in SEQ ID NO: 1. The concentration of the uric acid aptamer is 1×10 -7 mol / L~1×10 -6 mol / L.

[0009] The present invention provides a method for preparing the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range, comprising:

[0010] (1) preparing a reduced thiolated uric acid aptamer;

[0011] (2) using the reduced thiolated uric acid aptamer obtained in step (1) to modify the gold electrode, freezing, thawing, washing, and sealing to obtain a gold electrode modified with the uric acid aptamer;

[0012] (3) Auxiliary chain hybridization is introduced on the gold electrode modified with the uric acid aptamer in step (2) to obtain a dual-affinity electrochemical aptamer sensor.

[0013] The preparation of the reduced thiolated uric acid aptamer comprises: mixing the reducing agent tri(2-carboxyethyl)phosphine and the thiolated uric acid aptamer in a volume ratio of 2:3, and standing at room temperature in the dark for 1-2 hours; the concentration of the tri(2-carboxyethyl)phosphine is 100mM, and the concentration of the thiolated uric acid aptamer is 100μM.

[0014] The freezing temperature is -20°C, the time is 7 min to 15 min, and the blocking is carried out by incubating at room temperature for 1 h to 2 h with 10 mM Tris-HCl buffer containing 1 mM MCH.

[0015] The concentration of the introduced auxiliary chain is 10nM-300nM, and the amount of the auxiliary chain added is 7μL-10μL.

[0016] The hybridization condition is room temperature reaction for 60 minutes.

[0017] The method for detecting uric acid using the dual-affinity aptamer sensor with a wide dynamic range for uric acid detection comprises:

[0018] The method comprises the following steps: treating a uric acid sample to be tested; dripping a solution of the uric acid sample to be tested onto the working electrode surface of the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range for reaction; placing the working electrode, the counter electrode and the reference electrode in a buffer solution, and detecting the electrical signal of the working electrode by square wave voltammetry; and plotting a standard curve based on the electrical signal versus uric acid concentration to achieve quantitative detection of uric acid.

[0019] The pH value of the buffer solution used for treating the uric acid sample to be tested is 8.3, which is a 20mM Tris-HCl solution containing 10mM MgCl2; when drawing the standard curve, the uric acid sample solution to be tested with a concentration ranging from 0.01μM to 1000μM is added dropwise to the surface of the working electrode to react for 30 minutes; the buffer solution is a phosphate buffer solution containing 100mM NaCl.

[0020] Compared with the prior art, the present invention has the following beneficial technical effects:

[0021] The portable electrochemical aptamer sensor with dual affinity provided by the present invention is characterized by fixing a uric acid aptamer with a redox reporter MB on the surface and introducing an auxiliary chain complementary to the 5' terminal region of the uric acid aptamer, so that the probe part on the sensing interface hybridizes, thereby reducing the sensor background signal and significantly improving the sensitivity. At the same time, the introduction of the auxiliary chain causes the aptamer probe on the sensor surface to have two different affinities, so that the dynamic range of the sensor is widened from 81 times to about 3000 times (0.25-750 μM); the limitation of the traditional E-AB sensor having only a limited dynamic range is solved, thereby expanding its application in a wider concentration range. The electrochemical aptamer sensor of the present invention is based on the specific binding of the aptamer to the target uric acid, has strong specificity, and can effectively avoid the interference of complex components of the actual sample during the detection process; in addition, the present invention is low in cost, simple to make, and has good stability, and has good market value.

[0022] The portable electrochemical aptamer sensor with dual affinity provided by the present invention is used for uric acid detection. The thiol-modified uric acid aptamer probe is assembled on a gold electrode. The signal molecule MB is labeled at the 3' end of the uric acid aptamer probe and an auxiliary chain is introduced to construct a dual affinity electrochemical aptamer sensor with a wide dynamic range. The electrical signal of the modified electrode is recorded and used as a reference value. Then, a serum sample containing uric acid is dropped on the surface of the modified electrode. Uric acid specifically binds to the aptamer probe on the sensor surface, so that the signal molecule MB of the aptamer is close to the electrode surface, promoting efficient electron transfer. Finally, the content of uric acid in the serum is determined according to the change of the electrical signal. The change value of the detected electrical signal and the logarithm of the uric acid concentration show a good linear relationship in the range of 0.25μM to 750μM, and the detection limit is 0.1μM. The sensor has the advantages of wide dynamic range, high sensitivity, high selectivity, and easy preparation and operation. Therefore, it has broad application prospects in medical diagnosis (such as monitoring of diseases such as hyperuricemia and gout), food safety testing (such as detecting the uric acid content in food), and biochemical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the dual-affinity electrochemical aptamer sensor of the present invention for recognizing uric acid (UA);

[0024] Figure 2 The relevant performance comparison diagram of the present invention for detecting uric acid (the uric acid concentration is 0.25 μM), wherein A is a square wave voltammetry curve of the electrochemical aptamer sensor for detecting uric acid, and B is a square wave voltammetry curve of the sensor before and after binding with the target uric acid after the auxiliary chain 5'-13mer is introduced;

[0025] Figure 3 The auxiliary chain-related parameter optimization diagram for constructing a dual-affinity electrochemical aptamer sensor for detecting uric acid. A is the signal gain diagram for identifying target uric acid after the auxiliary chain binds to different positions of the aptamer, and B is the signal gain diagram for the sensor binding to target uric acid after introducing auxiliary chains of different lengths (13bp to 34bp);

[0026] Figure 4 The performance verification diagram of the stability and selectivity of the dual-affinity electrochemical aptamer sensor for detecting uric acid. Among them, A is the signal attenuation diagram before and after storing the sensor for two weeks, B is the repeatability verification diagram of the dual-affinity aptamer sensor constructed using five electrodes, and C is the signal response diagram of the electrochemical aptamer sensor to other interfering substances in body fluids.

[0027] Figure 5 This is the linear relationship between the signal gain of the dual-affinity electrochemical aptamer sensor and the logarithm of the uric acid concentration.

[0028] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0029] Example 1: Dual-affinity aptamer sensor for wide dynamic range of uric acid detection

[0030] The present embodiment provides a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range. The dual-affinity aptamer sensor is a three-electrode system sensor. The working electrode is obtained by sequentially modifying a uric acid aptamer and an auxiliary chain on the surface of a gold electrode; the auxiliary chain is a sequence that is partially complementary to the uric acid aptamer; the auxiliary chain is 13 to 34 bp in length; the uric acid aptamer is labeled with a thiol group at the 5' end and a redox reporter methylene blue at the 3' end.

[0031] The auxiliary chain is any one of the nucleotide sequences shown in SEQ ID NOs: 2-7, the length of the auxiliary chain is 13 to 34 bp, and the concentration of the auxiliary chain is 10 nM to 300 nM; the nucleotide sequence of the auxiliary chain 5'-13mer is CTTGCCCTGTCGT (as shown in SEQ ID NO: 2); the nucleotide sequence of the auxiliary chain 5'-16mer is CCT CTT GCC CTGTCG T (as shown in SEQ ID NO: 3); the nucleotide sequence of the auxiliary chain 5'-19mer is AAA CCT CTT GCC CTG TCGT (as shown in SEQ ID NO: 4); the nucleotide sequence of the auxiliary chain 5'-22mer is GTAAAA CCT CTT GCC CTG TCGT (as shown in SEQ ID NO: 5); the nucleotide sequence of the auxiliary chain 5'-28mer is AGG TAAGTAAAA CCT CTT GCCCTG TCG T (as shown in SEQ ID NO: 6); the nucleotide sequence of the auxiliary chain 5'-34mer is TTC CTTAGG TAAGTAAAA CCT CTT GCC CTG TCG T (as shown in SEQ ID NO: 7);

[0032] The nucleotide sequence of the uric acid aptamer is ACGACAGGGCAAGAGGTTTTACTTACCTAAGGAATGTCGT (as shown in SEQ ID NO: 1), and the concentration of the uric acid aptamer is 1×10 -7 mol / L~1×10 -6mol / L.

[0033] The construction process is shown in the attached Figure 1 As shown, the dual-affinity aptamer sensor uses a uric acid aptamer (UA-apt) as the aptamer and a 5'-13mer as the auxiliary strand. The specific preparation process is as follows:

[0034] (1) Reduction of thiolated uric acid aptamers

[0035] To reduce the disulfide bonds in the thiolated uric acid aptamer, 4 μL of 100 mM TCEP was mixed with 6 μL of 100 μM thiolated probe and allowed to stand for 1 h at room temperature in the dark. 6 μL of 1 μM reduced thiolated uric acid aptamer probe was dissolved in 20 mM Tris-HCl (pH 7.4) and dropped onto the surface of the freshly cleaned electrode. The electrode was then placed in a laboratory freezer (-20 ° C) for 15 min; after thawing to room temperature (about 22 ° C) for 1 min, the surface was washed three times with 20 mM Tris-HCl (pH 7.4); to block the uric acid aptamer probe modified electrode, the prepared electrode was incubated in 10 mM Tris-HCl buffer containing 1 mM MCH at room temperature for 1 hour; subsequently, the electrode was rinsed with excess Tris-HCl buffer (20 mM, pH 7.4) and stored at 4 ° C before use; the reduced thiolated uric acid aptamer was obtained;

[0036] (2) Preparation of dual-affinity aptamer sensors

[0037] Using 0.5M sulfuric acid as the electrolyte, the gold screen-printed electrode was scanned by cyclic voltammetry, and the parameters were set as the starting potential of -0.1V, the highest potential of 1.4V, the lowest potential of -0.1V, the end potential of 1.4V, 10 scans, and the scan rate of 0.05V / s; then 6μL of the reduced thiolated uric acid aptamer probe with a molar concentration of 1μM was dropped on the surface of the gold screen-printed electrode; then the electrode was placed in a -20℃ environment and frozen for 15min, thawed and washed at room temperature, and blocked with 1mM 6-mercaptohexanol for 1 hour; then, 8μL of the auxiliary chain with a concentration of 50nM was added and hybridized at room temperature for 60min to obtain a dual-affinity electrochemical aptamer sensor, which was stored at 4℃ for future use.

[0038] (3) Electrical signal acquisition method

[0039] The test was conducted using a screen-printed gold electrode of an integrated three-electrode system, with a gold electrode as the working electrode, a platinum wire electrode as the counter electrode, and Ag / AgCl as the reference electrode. The electrodes were inserted into a phosphate buffer solution containing 100 mM NaCl. A PalmSens4 portable electrochemical workstation was used for square wave voltammetry (SWV) analysis, with a potential range of 0 to -0.5 V (VsAg / AgCl), an amplitude of 50 mV, a step potential of 1 mV, and a frequency of 60 Hz to detect the electrical signal generated on the surface of the working electrode.

[0040] (4) Determination of uric acid

[0041] Take 5 μL UA binding buffer (20 mM Tris-HCl pH 8.3, 10 mM Mg 2+ ) was dropped on the surface of the screen-printed gold electrode of the modified probe, reacted at room temperature for 30 minutes, and the electrical signal of the modified electrode was collected as the blank value; different concentrations of uric acid (final concentration was 0.01 μM~1000 μM) were dissolved in binding buffer, dropped on the surface of the sensing electrode, reacted at room temperature for 30 minutes, rinsed with buffer, blown dry with N2, and the corresponding electrical signal was detected; a standard curve was drawn by plotting the electrical signal against the uric acid concentration.

[0042] 4 μL of 100 mM TCEP was mixed with 6 μL of 100 μM thiolated probe and allowed to stand for 1 hour at room temperature in the dark. 6 μL of 1 μM reduced thiolated uric acid aptamer probe was dissolved in 20 mM Tris-HCl (pH 7.4) and dropped onto the freshly cleaned electrode surface. The electrode was then placed in a laboratory freezer (-20°C) and frozen for 15 minutes. After thawing to room temperature (about 22°C) for 1 minute, the surface was washed three times with 20 mM Tris-HCl (pH 7.4). In order to block the uric acid aptamer probe modified electrode, the prepared electrode was incubated in 10 mM Tris-HCl buffer containing 1 mM MCH at room temperature for 1 hour. Subsequently, the electrode was rinsed with an excess of Tris-HCl buffer (20 mM, pH 7.4) and stored at 4°C before use.

[0043] Example 3: Application of electrochemical aptasensor for uric acid detection

[0044] The present invention discloses a method for measuring uric acid using a portable sensor based on a dual-affinity electrochemical aptamer:

[0045] (1) Detection principle

[0046] Firstly, the thiol-modified uric acid aptamer probe was assembled on the gold electrode by freezing method. The 3' end of the uric acid aptamer probe was labeled with the signal molecule methylene blue (MB). After the auxiliary chain was introduced, an aptamer sensor with a wide dynamic range was obtained. The electrical signal of the modified electrode was collected and the signal value was used as the blank value. The serum sample containing uric acid was dropped on the surface of the modified electrode. Uric acid specifically bound to the aptamer probe on the sensor surface. The signal molecule MB of the aptamer was close to the electrode surface, supporting efficient electron transfer. The electrical signal of the modified electrode was collected, and the serum uric acid was determined according to the change of the electrical signal.

[0047] Attached Figure 2 The changes of electrical signals when the electrochemical aptasensor is used for detection are demonstrated. Figure 2 The data shows that Figure 2 In the figure, A is a square wave voltammetry curve of the electrochemical aptamer sensor for detecting uric acid, and B is a square wave voltammetry curve of the sensor before and after binding with the target uric acid after the auxiliary chain 5'-13mer is introduced. When the auxiliary chain is not introduced, the change of the electrical signal before and after the electrochemical aptamer sensor binds to the target uric acid is not obvious, and it is difficult to use for quantitative analysis; after the auxiliary chain is introduced, the background signal of the sensor is reduced, and the signal gain before and after the target binding reaches 56.5%, which is significantly improved compared with the interface without the auxiliary chain, indicating that the electrochemical aptamer sensor for uric acid detection designed by the present invention can significantly improve the sensing performance.

[0048] (2) Optimization of detection conditions

[0049] During the experiment, the effects of the auxiliary chain binding position and the auxiliary chain length on the performance of the constructed electrochemical aptamer sensor were investigated. For specific test results, see the attached Figure 3 .

[0050] By the attached Figure 3 From the data, A is the effect of changing the auxiliary chain binding position on the change of the electrical signal, and B is the effect of changing the auxiliary chain length on the change of the electrical signal. When the auxiliary chain binding position is closer to the electrode end, the background signal is more effectively suppressed, and the signal gain obtained by the sensor is also greater. Among them, the auxiliary chain 5′-13mer performs best; auxiliary chains of different lengths (13-34bp) and partially complementary to the aptamer are used. The data show that the signal gain depends on the length of the auxiliary chain. The longer the auxiliary chain, the weaker the signal change generated by the sensor. This is because the equilibrium is more transferred to the non-binding state, thereby reducing its target affinity. Therefore, the auxiliary chain 5′-13mer was selected as the auxiliary chain for subsequent experiments.

[0051] (3) Feasibility analysis of sensors in practical applications:

[0052] The test was carried out using a three-electrode system, with the gold electrode modified with the uric acid aptamer as the working electrode, the platinum wire electrode as the counter electrode, and Ag / AgCl as the reference electrode; the above electrodes were inserted into the electrolyte solution, and the electrochemical test was carried out using square wave voltammetry (SWV) with a potential range of 0 to -0.5 V (VsAg / AgCl), an amplitude of 50 mV, a step potential of 1 mV, and a frequency of 60 Hz.

[0053] The serum sample of uric acid needs to contain 10mM MgCl2, and the pH is adjusted to 8.3; the reaction time of uric acid and electrochemical aptamer sensor is 30min. The auxiliary chain concentration is 10nM to 300nM. The pH value of the electrolyte for collecting the electrical signal of the modified electrode is 8.0, and the composition is 20mM Tris-HCl containing 100mM NaCl.

[0054] The inventors have thoroughly evaluated the feasibility of the sensor in practical applications, and the experimental results can be found in the attached Figure 4 .

[0055] By the attached Figure 4 The data shows that Figure 4 In the figure, A is a signal attenuation diagram before and after storing the sensor for two weeks, B is a repeatability verification diagram of the dual-affinity aptamer sensor constructed using five electrodes, and C is a signal response diagram of the electrochemical aptamer sensor to other interfering substances in body fluids; within 15 days, the relative change of the current is small, indicating that the dual-affinity aptamer sensor for uric acid detection in a wide dynamic range of the present invention has good stability; under the same experimental conditions, 5 electrodes were used to assemble the aptamer, and the current signal of the electrochemical aptamer sensor obtained by combining with the auxiliary chain to test different electrode assemblies, and the results showed that the relative standard deviation (RSD) was 5.48%, indicating that the experimental results have good repeatability. In order to evaluate the anti-interference ability of the sensor, the inventors made the sensor combined with the auxiliary chain bind to different targets, including uric acid (UA), potassium chloride (KCl), sodium chloride (NaCl), ascorbic acid (AA) and dopamine (DA). Only when the binding target was uric acid, the signal of the sensor would be enhanced, which showed that the dual-affinity aptamer sensor for uric acid detection in a wide dynamic range has strong specificity and anti-interference ability, which provides reliable support for detection in more complex body fluid samples.

[0056] (4) Detection effect of the sensor under optimized conditions

[0057] The introduction of the auxiliary chain results in the sensor surface aptamer probe having two different affinities. The dynamic range of the electrochemical aptamer sensor with the auxiliary chain introduced in the present invention is tested, and the effect is shown in the attached figure. Figure 5 .

[0058] By the attached Figure 5The data show that the dynamic range of the sensor is expanded from 81 times to about 3000 times (0.25-750 μM). The results show that the measurement dynamic range of the electrochemical aptamer sensor of the present invention is expanded to 3000 times, covering more than three orders of magnitude of uric acid concentration changes.

[0059] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A dual-affinity aptamer sensor for uric acid detection with a wide dynamic range, the dual-affinity aptamer sensor being a three-electrode system sensor, characterized in that: The working electrode of the dual-affinity aptamer sensor is obtained by sequentially modifying the uric acid aptamer and the auxiliary chain on the surface of the gold electrode; the auxiliary chain is a sequence partially complementary to the uric acid aptamer; the auxiliary chain length is 13 to 34 bp; the uric acid aptamer 5' end is labeled with a thiol group, and the 3' end is labeled with a redox reporter methylene blue.

2. The dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 1, characterized in that: The auxiliary chain is any one of the nucleotide sequences shown in SEQ ID NO: 2-7, and the auxiliary chain concentration is 10 nM to 300 nM.

3. The dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 1, characterized in that: The nucleotide sequence of the uric acid aptamer is shown in SEQ ID NO:

1. The concentration of the uric acid aptamer is 1×10 - 7 mol / L~1×10 -6 mol / L.

4. The method for preparing the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to any one of claims 1 to 3, characterized in that: include: (1) preparing a reduced thiolated uric acid aptamer; (2) using the reduced thiolated uric acid aptamer obtained in step (1) to modify the gold electrode, freezing, thawing, washing, and sealing to obtain a gold electrode modified with the uric acid aptamer; (3) Auxiliary chain hybridization is introduced on the gold electrode modified with the uric acid aptamer in step (2) to obtain a dual-affinity electrochemical aptamer sensor.

5. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The preparation of the reduced thiolated uric acid aptamer comprises: mixing a reducing agent tri(2-carboxyethyl)phosphine and a thiolated uric acid aptamer in a volume ratio of 2:3, and standing at room temperature in the dark for 1 hour to 2 hours; the concentration of the tri(2-carboxyethyl)phosphine is 100 mM, and the concentration of the thiolated uric acid aptamer is 100 μM.

6. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The freezing temperature is -20°C, the time is 7 min to 15 min, the blocking agent used in the blocking is 10 mM Tris-HCl buffer containing 1 mM 6-mercaptohexanol (MCH), and the blocking condition is incubation at room temperature for 1 h to 2 h.

7. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The concentration of the introduced auxiliary chain is 10nM-300nM, and the amount of the auxiliary chain added is 7-10μL.

8. The method for preparing a dual-affinity aptamer sensor for uric acid detection with a wide dynamic range according to claim 4, characterized in that: The hybridization condition is room temperature reaction for 1 hour.

9. The method for detecting uric acid using a dual-affinity aptamer sensor with a wide dynamic range for uric acid detection according to any one of claims 1 to 3, characterized in that: include: Processing of uric acid samples to be tested; The uric acid sample solution to be tested is added dropwise to the working electrode surface of the dual-affinity aptamer sensor for uric acid detection with a wide dynamic range as described in any one of claims 1 to 3 to react; the working electrode, the counter electrode and the reference electrode are placed in a buffer solution, and the electrical signal of the working electrode is detected by square wave voltammetry; a standard curve is drawn based on the electrical signal and the uric acid concentration to achieve quantitative detection of uric acid.

10. The method for detecting uric acid using a dual-affinity aptamer sensor with a wide dynamic range for uric acid detection according to claim 9, characterized in that: The pH value of the buffer solution used for the treatment of the uric acid sample to be tested is 8.3, which is a 20mM Tris-HCl solution containing 10mM MgCl2; when drawing the standard curve, the uric acid sample solution to be tested with a concentration ranging from 0.01μM to 1000μM is added dropwise to the surface of the working electrode to react for 30 minutes; the buffer solution is a phosphate buffer solution containing 100mM NaCl.

Images