Application of miR-124-3p in preparation of medicine for treating cerebral hemorrhage secondary injury and medicine

Abstract

The invention belongs to the technical field of medicine, and particularly provides application of miR-124-3p in preparation of a medicine for treating cerebral hemorrhage secondary injury and the medicine, it is found for the first time that miR-124-3p participates in regulation and control of reactive astrocytes of neuroinflammation caused by cerebral hemorrhage, inhibition of injury of the astrocytes to neurons is achieved, and the application of miR-124-3p in preparation of a medicine for treating cerebral hemorrhage secondary injury is achieved. The compound has a wide application prospect in preparation of medicines related to neuroinflammation after cerebral hemorrhage.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and in particular relates to an application of miR-124-3p in the preparation of a drug for treating secondary injury of cerebral hemorrhage and a drug. Background Art

[0002] Acute intracerebral hemorrhage (ICH) is a potentially devastating clinical condition caused by rupture of a cerebral blood vessel and entry of blood into the brain parenchyma. Although ICH accounts for only 20-30% of all acute strokes, ICH causes more disability-adjusted life years (DALYs) than ischemic stroke. The pathophysiology of ICH is complex and involves mechanical hematoma expansion, mass effect (local pressure of hemorrhage on adjacent brain structures), and secondary injury (primarily caused by an inflammatory response induced by blood components). Secondary injury occurs when the hematoma and its contents enter the brain tissue, leading to blood-brain barrier (BBB) ​​disruption and activation of inflammatory pathways, ultimately causing more extensive neuroinflammation and injury.

[0003] Inflammation is the body's protective response to injury or pathogen infection. Inflammatory reactions in the central nervous system are often referred to as "neuroinflammation". Neuroinflammation is an immune response activated by glial cells in the central nervous system, which usually occurs under stimulation such as nerve injury, infection and toxins or under autoimmunity. The role of neuroinflammation is multifaceted, with both advantages and disadvantages. On the one hand, it is essential for the central nervous system to defend against infection and repair tissue damage. In the acute phase, neuroinflammation helps to isolate and clear pathogens or damaged cells and initiate the tissue repair process. On the other hand, chronic neuroinflammation is a common pathological feature of many neurodegenerative diseases. Long-term inflammation can lead to the continuous release of proinflammatory cytokines and other harmful substances, resulting in neuronal damage and loss.

[0004] Astrocytes are an important component of the nervous system. They play a vital role in the maintenance and protection of neural networks and have complex and diverse functions. Astrocytes regulate important processes such as synaptic development and transmission, blood flow, and inflammatory response by interacting with all cell types in the brain. When the brain is damaged or pathologically damaged, astrocytes undergo a transition from a steady state to a reactive state (reactive astrocytes). At this time, astrocytes lose their normal function of nourishing and supporting neurons, and instead produce a large amount of secretory proteins, fatty acids and other substances, which promote neuronal apoptosis and lead to neural damage.

[0005] Type I interferon (IFN) is an inflammatory mediator induced by the activation of pathogen recognition receptors by microbial nucleic acids or misplaced endogenous DNA in the cytosol. It can generally be divided into two types: α and β. These two types of interferons are derived from leukocytes and fibroblasts, respectively, and have antiviral and anti-cell division effects. In the central nervous system, type I IFN responses have pleiotropic effects, playing an anti-replication role in viral infection, immunosuppression in multiple sclerosis, or autoinflammatory effects in interferon disease. Studies have found that the rs2039381 polymorphism of interferon-ε (IFN-ε) is associated with ICH, and the association between the rs2039381T allele and ICH is more obvious. However, the role of IFNβ in cerebral hemorrhage remains unknown.

[0006] miRNA (microRNA) is a type of non-coding RNA with a length of about 18-22 nucleotides. It participates in regulating the synthesis of target proteins by inducing RNA-induced silencing complex degradation or preventing the translation of target messenger RNA. In the field of neurology, miRNA plays a key role in maintaining normal functions of neural development and neural circuits, including synaptic plasticity, axon growth, etc. Studies have found that after hemorrhagic stroke, the miRNA profile in blood and cerebrospinal fluid changes. Treatment of hemorrhagic stroke with miRNA analogs can reduce brain edema and secondary brain damage caused by inflammatory response.

[0007] At present, studies have found that miR-124-3p can promote the transformation of M1 microglia to M2 microglia, reduce neuroinflammation, and promote neural repair. However, whether miR-124-3p can regulate the reactivity and neurotoxicity of astrocytes and its effective targets are still unclear. Therefore, the development of gene therapy methods based on miR-124-3p is of great significance for the research of small molecule therapeutic drugs for neuroinflammation. Summary of the invention

[0008] In view of the above technical problems, the present invention provides an application of miR-124-3p in the preparation of a drug for treating secondary injury caused by cerebral hemorrhage and a drug, which has broad application prospects for drugs related to neuroinflammation after cerebral hemorrhage.

[0009] To achieve the above object, the technical solution of the present invention is:

[0010] The first aspect of the present invention provides an application of miR-124-3p in the preparation of a drug for treating secondary injury caused by cerebral hemorrhage.

[0011] In one preferred embodiment of the technical solution of the first aspect of the present invention, the miR-124-3p is configured to target the IFNβ gene, reverse neurotoxic astrocytes, and inhibit their damage to neurons.

[0012] In one preferred embodiment of the technical solution of the first aspect of the present invention, the miR-124-3p is configured to target and bind to the IFNβ gene, and overexpression of miR-124-3p inhibits the protein expression of the IFNβ gene, thereby reducing the type I interferon response caused by reactive astrocytes and reversing the phenotype of astrocytes.

[0013] In one preferred embodiment of the technical solution of the first aspect of the present invention, the miR-124-3p inhibits the protein expression of the IFNβ gene through the miRNA-CDS binding mechanism.

[0014] The second aspect of the present invention provides a drug for treating secondary injury of cerebral hemorrhage, comprising a virus of a miR-124-3p vector and a medically acceptable carrier or excipient.

[0015] In one preferred embodiment of the technical solution of the first aspect of the present invention, the drug is an injection or an oral agent.

[0016] Due to the adoption of the above technical solution, the present invention has the following advantages and positive effects compared with the prior art:

[0017] The present invention discovered for the first time that miR-124-3p is involved in regulating neurotoxic glial cells that cause neuroinflammation after cerebral hemorrhage, inhibiting the damage of neurotoxic glial cells to neurons, and has broad application prospects in the preparation of drugs related to neuroinflammation after cerebral hemorrhage. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 These are fluorescence staining images of primary astrocytes infected with different groups of viruses and stimulated with three factors in Example 1 of the present invention, wherein (a) is an antibody fluorescence staining image of primary astrocytes stimulated with three factors, and (b) is a fluorescence microscope count of related C3 antibodies in different groups;

[0019] Figure 2 The neuron survival after stimulation by the three factors in different groups in Example 1 of the present invention is shown in FIG. Figure 1 (a) Immunofluorescence staining of different groups to identify the survival of neurons killed by ACM; Figure 1 (b) Fluorescence microscopy counts of stained neurons in neuronal culture media of different groups;

[0020] Figure 3This is a differential analysis of transcriptional sequencing after transfection of primary planetary glial cells with miR-124-3p in Example 2 of the present invention, with or without TIC stimulation; wherein a is a schematic diagram of the process of transfection of primary planetary glial cells and TIC stimulation; b is a graph of RNA transcriptional sequencing of the miR-124-3p group transfected primary planetary glial cells 48 hours after; c is a graph of RNA transcriptional sequencing of the miR-124-3p group transfected primary planetary glial cells and TIC stimulation 48 hours after;

[0021] Figure 4 This is the RNA transcription sequencing diagram of primary planetary glial cells after TIC stimulation for 24 hours and miR-124-3p transfection of neurotoxic glial cells for 24 hours in Example 2 of the present invention;

[0022] Figure 5 This is the functional enrichment analysis of primary planetary glial cells stimulated by TIC for 24 hours and neurotoxic glial cells transfected with miR-124-3p for 24 hours in Example 2 of the present invention;

[0023] Figure 6 The expression graphs of interferon pathway related genes detected by qPCR of total RNA obtained after transfection of different groups in Example 3 of the present invention, wherein (a) is the expression of interferon pathway related genes Stat1, Stat2, IFNα, and IFNβ, and (b) is the expression of interferon pathway related genes Stat1, Stat2, IFNα, and IFNβ in the miR control group and miR-124-3p group after TIC three-factor stimulation;

[0024] Figure 7 Comparison of the sequences after mutation of the CDS binding region of miR-124-3p and IFNβ;

[0025] Figure 8 The qPCR quantitative analysis diagram of IFNβ mRNA collected in Example 4 of the present invention, wherein (a) is the IFNβ expression in HEK293T transfected with wild-type IFNβ plasmid, and (b) is the IFNβ expression in HEK293T transfected with mutant IFNβ plasmid. DETAILED DESCRIPTION

[0026] The following is a further detailed description of the application of miR-124-3p in the preparation of a drug for treating acute cerebral hemorrhage and the drug for treating acute cerebral hemorrhage proposed by the present invention in conjunction with the accompanying drawings and specific embodiments. The advantages and features of the present invention will become clearer according to the following description.

[0027] Example 1 Role of miR-124-5p / miR-124-3p in TIC triple factor-induced astrocyte neurotoxicity

[0028] 1. Construction of miR-124-5p / miR-124-3p expression vector

[0029] After obtaining the sequence of miR-124, we constructed the 5p sequence cgtgttcacagcggaccttgat (SEQ ID NO.1) and the 3p sequence taaggcacgcggtgaatgcc (SEQ ID NO.2) behind the U6 promoter, namely miR-124-5p / miR-124-3p overexpression plasmids, and packaged them into lentivirus.

[0030] 2. Isolation and culture of neural astrocytes

[0031] Take a c57bl6 mouse on the day of birth, separate the brain tissue, put it in HBSS solution, use fine forceps to carefully peel off the meninges on the surface of the brain and the meninges of the cortex, remove the cerebellum, thalamus, and striatum, and only keep the cortex. Wash with pre-cooled PBS and cut the brain tissue into small pieces of about 1mm. Transfer the brain tissue to a centrifuge tube, centrifuge at 1000rpm for 3min, and remove the supernatant. Add 1ml Accutase stem cell digestion solution to each two mouse brains and digest them in a 37℃ incubator for 7min. Add an equal amount of astrocyte culture medium to the digested brain tissue, stop digestion, blow and mix, centrifuge at 1000rpm for 3min, and discard the supernatant. Add 5-10ml NSCs culture medium to resuspend, pass through a 70μm cell filter, add 106 cells to each 10cm cell culture dish, and after 7 days of culture, repeatedly tap the wall of the culture dish to make the microglia, OPCs and other cells that are not firmly attached to the wall float, and remove the supernatant. Add astrocyte culture medium again, repeat the beating process, remove the supernatant and culture in an incubator containing 5% CO2 and 37°C. Use 0.25% trypsin to digest for 2-3 minutes, then add complete culture medium to terminate digestion. After three subcultures, use for subsequent experiments.

[0032] 3. Constructed lentiviral transfection and TIC three-factor stimulation

[0033] Primary astrocytes were cultured at 2 x 10 5 The cell density of cells / well was placed in a 12-well plate. 500ul of cell culture medium was added to each well. Astrocytes were identified under a light microscope to grow to an appropriate density, and the constructed lentivirus was used to infect primary astrocytes. After 24 hours, the astrocyte culture medium was changed, and IL-1α (final concentration 3ng / ml), TNF (final concentration 30ng / ml), and C1q (final concentration 400ng / ml) were added for stimulation. Primary astrocytes were stimulated into neurotoxic glial cells, and immunofluorescence staining and RT-qPCR detection were performed after 48 hours.

[0034] Immunofluorescence staining: Remove the cell supernatant and wash three times with PBS. Add 4% paraformaldehyde (PFA) and fix for 10 minutes. Remove PFA and wash three times with PBS. Soak in 0.3% TritonX-100 (prepared in PBS solution) for 30 minutes, and wash three times with PBS, each time for 3 minutes. Dilute the corresponding primary antibody with immunofluorescence primary antibody diluent, add it to the cell culture slide, and incubate at 4°C overnight. Remove the primary antibody the next day, wash three times with PBS, each time for 10 minutes. Use the diluted corresponding species fluorescent secondary antibody, add it to the cell culture slide, and place it on a shaker at room temperature for 2 hours. After that, remove the secondary antibody, wash three times with PBS, each time for 10 minutes. Add DAPI solution, incubate at 37°C in the dark for 20 minutes, and wash three times with PBS, each time for 10 minutes. Remove the cell culture slide, add anti-fluorescence quencher, cover with a coverslip, and seal the slide with nail polish. Observe and collect images under a confocal microscope.

[0035] like Figure 1 As shown in (a), the fluorescent staining diagram of the constructed lentivirus-infected primary astrocytes and stimulated with three factors, where the Ctrl group is a blank control group, the Ctrl-EGFP group is a green fluorescent protein control group, the miR-124-5p group is another miRNA control group, and the miR-124-3p group is an experimental group. Compared with other groups, miR-124-3p can significantly reduce the expression of C3. As shown in Figure (b), it can also be clearly seen that miR-124-3p can significantly reduce the expression of C3. For this reason, miR-124-3p can be selected as the mature form for further analysis.

[0036] 4. Synthesize miR-124-3p mimic (mimic, experimental group) and control microRNA (control group), and transfect primary astrocytes using RNAi transfection.

[0037] Astrocyte culture supernatant (ACM) kills and stimulates neurons: PBS (untreated group), TIC three-factor stimulation (blank control group), TIC three-factor stimulation + microRNA, TIC three-factor stimulation + miR-124-3p after 48 hours of treatment ACM was added to the neuronal culture medium (the final concentration ratio of ACM to neuronal culture medium was 1:3). After 24 hours, neurons were stained with CAM (final concentration 1.33μM) and EH (final concentration 2.5μM) and counted using a fluorescence microscope within 10 minutes.

[0038] The results are as follows Figure 2As shown in (a) and (b), the ACM neuron killing experiment showed that the neuronal survival rate of astrocytes treated with ACM in the miR-124-3p transfected group was significantly increased compared with that in the control group.

[0039] Example 2 Transcriptome sequencing of miR-124-3p inhibiting neurotoxic astrocytes

[0040] 1. RNA transcriptome sequencing of primary astrocytes stimulated by miR-124-3p overexpression and three factors

[0041] Sample preparation: According to the aforementioned RNA extraction protocol, total RNA samples of four groups, namely, Ctrl, miR-124-3p, TIC, and TIC+miR-124-3p, were obtained with or without TIC three-factor stimulation and simultaneous transfection with miR-124-3p, and two groups, namely, Control and miR-124-3p, were obtained with TIC three-factor stimulation and transfection with miR-124-3p for 24 hours.

[0042] RNA library construction: The library was constructed according to the conventional library construction experimental process. The specific steps include: ployA enrichment → mRNA fragmentation → first-strand cDNA synthesis → magnetic bead purification of the first strand → second-strand cDNA synthesis → strand end repair → 3' end addition of A → addition of ligation adapter → purification and library amplification → sequencing sample library construction. The constructed library was used The concentration was detected by 3.0Fluorometer, the size of the library was detected by Agilent2100, and sequencing was performed on the machine.

[0043] Sequencing: Prepare the reagents for sequencing in advance according to the Illumina NovaSeq 6000 User Guide, and then load the flow cell with the cluster. Use the paired-end program to perform double-end (PE) sequencing. The sequencing process is completely controlled by the data collection software provided by Illumina, and the sequencing results are analyzed in real time.

[0044] like Figure 3 As shown in Figure 2, transcriptome sequencing differential analysis found that the reactive markers of astrocytes were significantly increased after stimulation with the three TIC factors, while the reactive markers of astrocytes were significantly decreased after transfection with miR-124-3P. Figure 4 As shown, 24 h after the three-factor stimulation, when neurotoxic glial cells were activated, transfection of miR-124-3P could reverse the mRNA expression of reactive markers in astrocytes.

[0045] Functional enrichment analysis results Figure 5 As shown in the figure, after 24h of three-factor stimulation, the innate immune pathway related to the interferon (IFNs) pathway was significantly downregulated by transfection of miR-124-3P, suggesting that miR-124-3P may inhibit the activation of neurotoxic glial cells by downregulating the interferon pathway.

[0046] Example 3 IFNβ is involved in the toxic activation of astrocytes

[0047] Four groups of cells were stimulated with or without TIC and transfected with miR-124-3p, namely Ctrl, miR-124-3p, TIC, and TIC+miR-124-3p, and two groups of cells were stimulated with TIC for 24 hours and then transfected with miR-124-3p, namely Control and TIC+miR-124-3p. Total RNA was obtained from each group, and the expression of genes related to the interferon pathway was detected by qPCR.

[0048] RNA extraction was performed using the Welling Bio RNA Extraction Kit. Remove the culture medium from the 12-well plate, wash once with PBS, add 800 μl of lysis solution, blow down the attached astrocytes, transfer to a 1.5 ml EP tube, shake for 15 seconds, and let stand at room temperature for 5 minutes. Add 160 μl of chloroform to the tube, shake for 15 seconds, let stand at room temperature for 3 minutes, and centrifuge at 13000 rpm and 4°C for 10 minutes. At this time, the liquid in the EP tube can be seen to be divided into 3 layers, and the upper layer is RNA. Transfer the upper layer of liquid to a new EP tube, add 1 / 2 volume of anhydrous ethanol, shake for 15 seconds, transfer the liquid to the centrifuge column in the kit, centrifuge at 13000 rpm and 4°C for 45 seconds, and discard the liquid in the lower tube. Add 0.5 ml of deproteinization solution RE, centrifuge at 13000 rpm and 4°C for 45 seconds, and discard the liquid in the lower tube. Add 0.5 ml of RW rinse solution, centrifuge at 13000 rpm, 4℃ for 45 seconds, discard the liquid in the lower tube, rinse again with RW, and discard the liquid in the lower tube. Centrifuge at 13000 rpm, 4℃ for 3 minutes, discard the lower tube, and put on a new EP tube to collect RNA. Add 30 μl of RNase-free water, let stand for 2 minutes, and centrifuge at 13000 rpm, 4℃ for 3 minutes to obtain RNA. Use DeNovix to quantify RNA.

[0049] RNA reverse transcription was performed using 1000 ng of RNA. Reverse transcription was performed using the Novagen reverse transcription kit. In brief, DNA was first removed using a 4x DNA wiper, and then reverse transcribed using a 5x reverse transcriptase to obtain a final system of 20 μl cDNA. The qPCR kit used was HiScript III RT SuperMix for qPCR (+gDNA wiper), R323-01, Vazyme, Novagen

[0050] qPCR: qPCR primer sequences are as follows

[0051]

[0052]

[0053] like Figure 6 As shown in (a), after TIC stimulation, the expression of interferon pathway-related genes Stat1 and Stat2 increased, among which the expression of IFNβ increased by more than 50 times, and IFNγ, IFNκ and IFNλ were not detected in astrocytes under any conditions. These data suggest that IFNβ may be an important regulator of the rapid induction of neurotoxic reactive astrocytes. Figure 6 As shown in (b), miR-124-3p showed significant inhibition of IFNβ induction after 24 h of TIC stimulation.

[0054] Example 4: Relationship between miR-124-3p and IFNβ through CDS region binding and targeting regulation

[0055] 1. Prediction of miR-124-3p and IFNβ binding sites

[0056] Searches in public databases did not reveal any binding sites of miR-124-3p to IFNβ 3'UTR, indicating that miR-124-3p is unlikely to inhibit IFNβ expression through a 3'UTR binding mechanism. Therefore, we speculated whether the reduction of IFNβ mRNA levels induced by miR-124-3p was mediated by a microRNA CDS binding mechanism.

[0057] like Figure 7 As shown, we aligned the binding sequences of miR-124-3p and IFNβ CDS and identified a highly likely binding site corresponding to the mRNA region at amino acids 93–98 of the IFNβ CDS region.

[0058] 2. Construction and Transfection of Mutant and Wild-type IFNβ Plasmids

[0059] Mutated IFNβ was constructed by using mutagenic primers and the Gibson seamless cloning method for seamless connection. The cDNA is driven by a short CAG promoter and connected to the EGFP sequence through a 2A sequence. For transfection, 2 μg of wild-type and mutant IFNβ (mut IFNβ) plasmids were transfected into HEK293T cells cultured in one well of a 6-well plate using EZ Trans-Cell transfection Reagent (AC04L098). After plasmid transfection, 30 pmol of mouse miR-124-3p was transfected into HEK293T cells using Rfect siRNA transfection reagent (#11012). The culture medium was changed 24 hours after transfection. After 48 hours, RNA was collected for qPCR analysis.

[0060] Real-time quantitative PCR is the same as in Example 3

[0061] like Figure 8 As shown in (a), after overexpression of miR-124-3p, the expression level of wild-type IFNβ mRNA was significantly decreased, as shown in Figure 8 As shown in (b), after this targeted mutation, miR-124-3p no longer reduces the expression level of IFNβ mRNA. Therefore, these findings suggest that miR-124-3p inhibits IFNβ expression through a miRNA-CDS binding mechanism and plays a role in transcriptional regulation in astrocytes.

[0062] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Even if various changes are made to the present invention, if these changes fall within the scope of the claims of the present invention and their equivalents, they still fall within the protection scope of the present invention.

Claims

1. An application of miR-124-3p in the preparation of a drug for treating secondary injury caused by cerebral hemorrhage.

2. The use of miR-124-3p according to claim 1 in the preparation of a drug for treating secondary injury of cerebral hemorrhage, characterized in that: The miR-124-3p is configured to target the IFNβ gene, reverse the neurotoxic astrocytes, and inhibit the damage of the neurotoxic astrocytes to neurons.

3. The use of miR-124-3p according to claim 2 in the preparation of a drug for treating secondary injury of cerebral hemorrhage, characterized in that: The miR-124-3p is configured to bind to the IFNβ gene, and overexpression of miR-124-3p inhibits the protein expression of the IFNβ gene, thereby reducing the type I interferon response caused by neurotoxic astrocytes and reversing the phenotype of astrocytes.

4. The use of miR-124-3p according to claim 3 in the preparation of a drug for treating secondary injury of cerebral hemorrhage, characterized in that: The miR-124-3p inhibits the protein expression of the IFNβ gene through the miRNA-CDS binding mechanism.

5. A drug for treating secondary damage caused by cerebral hemorrhage, characterized in that: A virus comprising a miR-124-3p vector and a medically acceptable carrier or excipient.

6. The drug for treating secondary injury of cerebral hemorrhage according to claim 5, characterized in that: The medicine is an injection or an oral preparation.

Images